Core-shell hydrogel microbead sensing platform as well as preparation method and application thereof

Abstract

The invention provides a core-shell hydrogel microbead sensing platform as well as a preparation method and application thereof, and belongs to the technical field of synthetic biology and environmental monitoring. The invention provides an engineering sensing microorganism. The engineering sensing microorganism comprises a recombinant vector, the recombinant vector contains a gene expression cassette with target substance response, transformation and report functions; the gene expression cassette comprises a coding gene of a transcription factor ChpR, a coding gene of a fluorescent reporter protein GFP and a coding gene of a chlorpyrifos degrading enzyme, and the gene expression cassette is assembled into a sensing gene line and then introduced into microorganisms to construct the whole-cell biosensor for detecting chlorpyrifos and a metabolite 3, 5, 6-trichloro-2-pyridinol thereof. According to the invention, the chlorpyrifos degradation conversion module is assembled and optimized, and the performance of the sensor is obviously improved. The core-shell hydrogel microbead prepared by the invention can ensure the biological safety and improve the stability of a sensor, and is suitable for high-sensitivity detection of trace chlorpyrifos residues in fruits, vegetables and environmental samples.

Description

TECHNICAL FIELD

[0002] The present application belongs to the technical field of synthetic biology and environmental monitoring, and particularly relates to a core-shell hydrogel microsphere sensing platform and a preparation method and application thereof. BACKGROUND

[0003] Chlorpyrifos is a broad-spectrum organophosphorus pesticide, and its application utilization rate is low, volatile, and persistent, and it is easy to be residual in soil and water. Therefore, it is very important to carry out chlorpyrifos residue detection to protect food safety and human health.

[0004] At present, the traditional detection method of chlorpyrifos residue mainly depends on high performance liquid chromatography, gas chromatography, electrochemical analysis and other technologies. Although these methods have good selectivity, reliability and accuracy, they are limited by expensive instruments. SUMMARY

[0005] The purpose of the present application is to provide a core-shell hydrogel microsphere sensing platform and a preparation method and application thereof, which can get rid of the limitation of expensive instruments and is suitable for high-sensitivity detection of trace residues of chlorpyrifos in fruit and vegetable and environmental samples.

[0006] The present application provides an engineering sensing microorganism, comprising a recombinant vector; the recombinant vector contains a gene expression cassette; the gene expression cassette comprises a coding gene of transcription factor ChpR, a coding gene of fluorescent reporter protein GFP and a coding gene of chlorpyrifos degrading enzyme; the chlorpyrifos degrading enzyme includes ophB, CPD or mpd.

[0007] Preferably, the gene expression cassette comprises a first gene expression cassette and a second gene expression cassette; the first gene expression cassette comprises a coding gene of transcription factor ChpR and a coding gene of fluorescent reporter protein GFP; the second gene expression cassette comprises a coding gene of chlorpyrifos degrading enzyme.

[0008] Preferably, the promoter for starting the first gene expression cassette comprises a bidirectional promoter P chpA ; the bidirectional promoter P chpA is inserted between the coding gene of transcription factor ChpR and the coding gene of fluorescent reporter protein GFP.

[0009] Preferably, the nucleotide sequence of the coding gene of transcription factor ChpR is shown in SEQ ID NO. 1 1-1665; the nucleotide sequence of the bidirectional promoter P chpA is shown in SEQ ID NO. 1 1666-1846; and the nucleotide sequence of the coding gene of fluorescent reporter protein GFP is shown in SEQ ID NO. 1 1847-2564.

[0010] Preferably, the second gene expression cassette is reversely inserted after the coding gene of the fluorescent reporter protein GFP; the second gene expression cassette comprises, in sequence, a promoter P J23109 、 a ribosome binding site B0030, a coding gene of chlorpyrifos-degrading enzyme and a terminator Ter.

[0011] Preferably, the coding gene of chlorpyrifos-degrading enzyme is codon-optimized; the promoter P J23109 the nucleotide sequence of the ribosome binding site B0030 is shown in SEQ ID NO. 2, positions 36-63; the nucleotide sequence of the coding gene of mpd is shown in SEQ ID NO. 2, positions 64-1059; the nucleotide sequence of the terminator Ter is shown in SEQ ID NO. 2, positions 1060-1176; the nucleotide sequence of ophB is shown in SEQ ID NO. 3; the nucleotide sequence of CPD is shown in SEQ ID NO. 4.

[0012] The present application also provides a core-shell hydrogel microbead comprising the engineered sensing microorganism described in the above scheme, wherein the hydrogel microbead is constructed by sodium alginate and calcium chloride.

[0013] The present application also provides a construction method of the core-shell hydrogel microbead described in the above scheme, comprising the following steps: mixing the mother liquor containing the engineered sensing microorganism and a first sodium alginate solution to obtain a mixed solution; dropping the mixed solution into a first calcium chloride solution to obtain a hydrogel microbead core; transferring the hydrogel microbead core to a second sodium alginate solution for cross-linking for 20-60 s, and then transferring it to a second calcium chloride solution for 9-16 h to obtain the core-shell hydrogel microbead.

[0014] The present application also provides the use of the engineered sensing microorganism described in the above scheme, the core-shell hydrogel microbead or the core-shell hydrogel microbead obtained by the construction method in at least one of the following: 1) indicating or detecting chlorpyrifos and the chlorpyrifos degradation product 3,5,6-trichloro-2-pyridinol; 2) preparing products for indicating or detecting chlorpyrifos and the chlorpyrifos degradation product 3,5,6-trichloro-2-pyridinol.

[0015] The present application also provides a detection method of chlorpyrifos and the chlorpyrifos degradation product 3,5,6-trichloro-2-pyridinol, comprising the following steps: when the sample to be tested is a liquid sample, placing the core-shell hydrogel microbead in the sample to be tested, recovering the core-shell hydrogel microbead, and measuring the fluorescence value thereof, and judging the chlorpyrifos residue in fruits, vegetables and water bodies according to the fluorescence value; When the sample to be detected is a solid sample, the solid sample is crushed and mixed with water to obtain a mixed solution, the core-shell hydrogel microbeads are placed in the mixed solution, the core-shell hydrogel microbeads are recovered, and the fluorescence value is measured, and the residue amount of chlorpyrifos in fruits and vegetables and water bodies is judged according to the fluorescence value. The core-shell hydrogel microbeads are the core-shell hydrogel microbeads described in the above solutions or obtained by the construction method described.

[0016] The application provides an engineered sensing microorganism, comprising a recombinant vector; the recombinant vector contains a gene expression cassette; the gene expression cassette comprises a coding gene of a transcription factor ChpR, a coding gene of a fluorescent reporter protein GFP and a coding gene of a chlorpyrifos-degrading enzyme; the chlorpyrifos-degrading enzyme comprises ophB, CPD or mpd. The engineered sensing microorganism of the application can be used as a whole-cell biosensor for detecting or indicating chlorpyrifos and its metabolite 3,5,6-trichloro-2-pyridinol. The whole-cell biosensor is constructed by using the transcription factor ChpR protein as a core response element to construct a sensing module, using the coding gene of the chlorpyrifos-degrading enzyme as a metabolic conversion module, and using the fluorescent reporter protein GFP as a signal output module. The sensing gene circuit is orderly assembled to construct the chlorpyrifos whole-cell biosensor. The application significantly enhances the fluorescent signal output intensity and improves the dynamic response range of the sensor by assembling and optimizing the chlorpyrifos-degrading conversion module. The detection sensitivity is improved by one time, the response multiple is increased from 17 times to 54 times, the detection limit is reduced from 25.0 nM to 1.5 nM, and high-sensitivity detection of chlorpyrifos is realized. In addition, the whole-cell biosensor is packaged in a hydrogel core-shell structure, the detection limit of the core-shell hydrogel microbead is 6 nM, which meets the actual detection requirements, guarantees the biological safety and improves the stability of the sensor, so that it is suitable for high-sensitivity detection of trace residues of chlorpyrifos in fruits and vegetables and environmental samples. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings described below are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.

[0018] Figure 1 Performance optimization, core-shell structure packaging and application schematic diagram of the chlorpyrifos whole-cell sensor; Figure 2Construction and performance characterization of chlorpyrifos whole-cell sensor assembled with degradation conversion module; wherein, a. initial sensing gene circuit schematic diagram; b. binding energy analysis of transcription factor ChpR and chlorpyrifos (CPF); c. sensing gene circuit schematic diagram of assembled degradation conversion module; d. binding energy analysis of transcription factor ChpR and degradation product 3,5,6-trichloro-2-pyridinol (TCP); e. CPF degradation rate of different degradation enzymes (CTR of initial sensing gene circuit without degradation module as standard); f. dose response test based on different degradation enzyme sensors; g. signal response fold of different degradation enzyme sensors induced by 50 μM CPF; Figure 3 Optimization and performance characterization of degradation conversion module; wherein, a, b. gene circuit schematic diagram of degradation conversion module assembly position optimization and its dose response test; c. linear detection range analysis of sensor; d, e. gene circuit schematic diagram of degradation enzyme expression optimization and its dose response test; f. specificity test of sensor; Figure 4 Construction and performance optimization of core-shell hydrogel microbeads; wherein, a. core-shell hydrogel microbead preparation schematic diagram; b, c, d. cell leakage analysis, signal response analysis, and encapsulated cell activity analysis of microbeads with different shell materials; e, f, g, h. leakage analysis, signal response analysis, and encapsulated cell activity analysis of microbeads with different crosslinking time of shell layer, and bright field and dark field micrographs of microbeads; Figure 5 Comprehensive performance characterization of core-shell hydrogel microbeads; wherein, a, b. leakage analysis of hydrogel microbeads with and without shell in liquid and solid culture; c. metabolic activity analysis of encapsulated cells of hydrogel microbeads with and without shell; d. signal reporting schematic diagram of core-shell hydrogel microbeads; e. dose response analysis of core-shell hydrogel microbeads; f. storage stability analysis of core-shell hydrogel microbeads; Figure 6 Application of core-shell hydrogel microbeads; wherein, a. application schematic diagram of core-shell structure hydrogel microbeads; b. performance analysis of core-shell hydrogel microbeads in different detection media (lake water, soil and cucumber samples); c. chlorpyrifos detection recovery rate analysis (taking cucumber as an example). DETAILED DESCRIPTION

[0019] The present application uses the transcription factor ChpR and its homologous promoter P Sinorhizobium meliloti derived from Sinorhizobium meliloti chpA As a sensing module, the green fluorescent reporter protein GFP is used as a signal reporting module, and the sensing gene circuit is introduced into E. coliA whole-cell biosensor for chlorpyrifos was constructed in DH5α cells. Then, based on the idea that ChpR has stronger binding ability with TCP, the degradation and conversion module of chlorpyrifos was added, and the module was optimized, and the performance of the sensor was further improved, and the whole-cell biosensor for chlorpyrifos was obtained. The whole-cell biosensor was further packaged in a hydrogel core-shell structure, and the detection limit of the core-shell hydrogel microbead meets the actual detection requirements, while ensuring the biosafety, the stability of the sensor is improved, so that it is suitable for high-sensitivity detection of trace chlorpyrifos residues in fruits, vegetables and environmental samples. In order to make the technical solutions of the present application more clear, the present application will be further described in detail as follows.

[0020] The application provides an engineered sensing microorganism, comprising a recombinant vector; the recombinant vector contains a gene expression cassette; the gene expression cassette comprises a coding gene of a transcription factor ChpR, a coding gene of a fluorescent reporter protein GFP and a coding gene of a chlorpyrifos degradation enzyme; and the chlorpyrifos degradation enzyme comprises ophB, CPD or mpd.

[0021] As an implementation form, the gene expression cassette comprises a first gene expression cassette and a second gene expression cassette; the first gene expression cassette comprises a coding gene of a transcription factor ChpR and a coding gene of a fluorescent reporter protein GFP; and the second gene expression cassette comprises a coding gene of a chlorpyrifos degradation enzyme.

[0022] The engineered sensing microorganism of the application can express ChpR protein, a chlorpyrifos degradation enzyme and a fluorescent reporter protein GFP.

[0023] The application assembles a degradation and conversion module (chlorpyrifos degradation enzyme) on the sensing gene circuit of the engineered sensing microorganism, converts the target substance chlorpyrifos into 3,5,6-trichloro-2-pyridinol which is a direct response of the transcription factor ChpR, significantly improves the sensitivity of the sensor and reduces the detection limit of the sensor. The engineered sensing microorganism of the application can be used as a whole-cell biosensor for detecting chlorpyrifos and its metabolite 3,5,6-trichloro-2-pyridinol.

[0024] As an implementation form, the promoter for starting the first gene expression cassette comprises a bidirectional promoter P chpA ; the bidirectional promoter P chpA is inserted between the coding gene of the transcription factor ChpR and the coding gene of the fluorescent reporter protein GFP; the nucleotide sequence of the coding gene of the transcription factor ChpR is shown in SEQ ID NO. 1 (template chain) 1-1665; and the bidirectional promoter P chpAthe nucleotide sequence of the coding gene of the fluorescent reporter protein GFP is shown in positions 1847-2564 of SEQ ID NO. 1 (coding strand).

[0025]

[0026] As an embodiment, the second gene expression cassette is reversely inserted after the coding gene of the fluorescent reporter protein GFP; the second gene expression cassette comprises, in sequence, a promoter P J23109 、 a ribosome binding site RBS B0030, a coding gene of chlorpyrifos-degrading enzyme, and a terminator Ter; the coding gene of chlorpyrifos-degrading enzyme is codon-optimized; the promoter P J23109 The nucleotide sequence of the promoter P is shown in SEQ ID NO. 2, positions 1-35; the nucleotide sequence of the ribosome binding site RBS B0030 is shown in SEQ ID NO. 2, positions 36-63; the nucleotide sequence of the coding gene of the chlorpyrifos-degrading enzyme mpd is shown in SEQ ID NO. 2, positions 64-1059 (coding strand); the nucleotide sequence of the terminator Ter is shown in SEQ ID NO. 2, positions 1060-1176; the nucleotide sequence of the ophB is shown in SEQ ID NO. 3; and the nucleotide sequence of the CPD is shown in SEQ ID NO. 4.

[0027] In the present application, the nucleotide sequence shown in SEQ ID NO. 2 is specifically as follows:

[0028] In the present application, the nucleotide sequence represented by SEQ ID NO. 3 is specifically:

[0029] In the present application, the nucleotide sequence represented by SEQ ID NO. 4 is specifically: atgacaaatgcaggatcactagctcccgaaatgcgtgccgttctggagcgcctggcggtcgaggacggcctgcagccggacccgaccattttaccgccggctgagggtcgtgcggtcacggaagcgagcaatcgtcgttggaacttagatggaccgaaaatggcacgcgaactgattgtggaaactccggacggtcgccgtgcgtacgtgtttatcccgggcagagacgacggcacccgtgcaattttgtacatccacggcggcggctggtcgttctgcagcgcggcgacccatgaaggtgctgcacgtcgcctggctcaagaaaccggcgtgccggttgttacgttcgactaccgcttggcgcctgagcacccgtatccggcgggcctcgaggactgtattagcttctgggcgggccgcgacgcgatcttgcccgagcgtaagtggagcatttccggcgatagtgccggtgcgaacttggctgtggccatgatgctgcgtctggacggctgcgatccgccacaaagcggtttgctgttctatggtgtttatgatgcagatttcgactcgccgagctatgtgagcgtagccgacggtccgggtttgacccgtgataagatgcgccgttattgggattactacaccggtgcgcaaaccgatcgtctgtccgatccgtgcctggttccgctgcgtgctagcgttgatgcgctggcgaacctgccaccgctgtacctgaatgcagcagagatcgacccgctccgctccgactctcagcgttttgcagagaaactgtctgctatgggtcgtcaggatctgtttgaaatcgttccgggtgtgatccatggtttcatgcagatgtctatgtggctgccgcaagcgagcgaagcatacagacgagccggtcaggcgtttcgtgccatgacctaa.

[0030] As an implementation form, the engineered sensing microorganism comprises a recombinant Escherichia coli; the original strain of the recombinant Escherichia coli comprises E. coli DH5α.

[0031] The application further provides a core-shell hydrogel microbead, comprising a hydrogel wrapping the engineered sensing microorganism in the above-mentioned scheme; and the hydrogel microbead is constructed by sodium alginate and calcium chloride.

[0032] The core-shell hydrogel microbead of the application is prepared by encapsulating the whole-cell biosensor with the core-shell hydrogel.

[0033] The application encapsulates the whole-cell biosensor with the core-shell structure hydrogel by using the natural polymer hydrogel, which can improve the biological safety in application, enhance the stability of the sensor, maintain the good activity and sensing function of the encapsulated cells, and is suitable for high-sensitivity detection of trace residues of chlorpyrifos in fruits, vegetables and environmental samples. According to the national food safety standard of China, the detection limit of the core-shell hydrogel microbead of the application is 6 nM, which can meet the actual detection requirements, so the core-shell hydrogel microbead of the application has good application prospect in chlorpyrifos detection.

[0034] The application further provides a construction method of the core-shell hydrogel microbead in the above-mentioned scheme, comprising the following steps: Mixing a mother liquor containing the engineered sensing microorganism and a first sodium alginate solution to obtain a mixed liquor; Dropping the mixed liquor into a first calcium chloride solution to obtain a hydrogel microbead core; Transferring the hydrogel microbead core to a second sodium alginate solution for crosslinking for 20-60 s, and then transferring to a second calcium chloride solution for 9-16 h to obtain a core-shell hydrogel microbead.

[0035] The application first mixes a mother liquor containing the engineered sensing microorganism and a first sodium alginate solution to obtain a mixed liquor.

[0036] As an implementation form, the volume ratio of the mother liquor of the engineered sensing microorganism to the first sodium alginate solution is 1:1; the mother liquor of the engineered sensing microorganism is a bacterial liquid, and the concentration is OD 600 =0.6; and the mass concentration of sodium alginate in the first sodium alginate solution is 4.5%.

[0037] After obtaining the mixed liquor, the application drops the mixed liquor into a first calcium chloride solution to obtain a hydrogel microbead core.

[0038] As an embodiment, the volume ratio of the mixed solution and the first calcium chloride solution is 1:2; the concentration of calcium chloride in the first calcium chloride solution is 0.1 M. After the mixed solution is dropped into the first calcium chloride solution, the preferred application of the present application further comprises filtering to remove the excess first calcium chloride solution.

[0039] After obtaining the hydrogel microbead core, the present application transfers the hydrogel microbead core to a second sodium alginate solution for cross-linking for 20-60 s, and then transfers it to a second calcium chloride solution for 9-16 h to obtain a core-shell hydrogel microbead.

[0040] As an embodiment, the mixing of the hydrogel microbead core and the second sodium alginate solution comprises adding the hydrogel microbead core into the second sodium alginate solution; the mass concentration of sodium alginate in the second sodium alginate solution is 0.5%; the concentration of calcium chloride in the second calcium chloride solution is 0.05 M; the time for transferring to the second calcium chloride solution is further 12 h; and the stable shell structure can be obtained after transferring to the second calcium chloride solution.

[0041] The present application optimizes the core-shell material and preparation conditions of the core-shell hydrogel microbead, and the obtained core-shell structure hydrogel microbead improves the safety and stability of the sensor.

[0042] The present application also provides the application of the above-mentioned engineering sensing microorganism, the core-shell hydrogel microbead or the core-shell hydrogel microbead obtained by the construction method in at least one of the following: 1) indicating or detecting chlorpyrifos and chlorpyrifos degradation product 3,5,6-trichloro-2-pyridinol; 2) preparing products for indicating or detecting chlorpyrifos and chlorpyrifos degradation product 3,5,6-trichloro-2-pyridinol.

[0043] The engineering sensing microorganism of the present application can be used as a whole-cell biosensor for efficiently detecting organophosphorus pesticide chlorpyrifos.

[0044] The core-shell hydrogel microbead of the present application can provide a fixed whole-cell biosensor platform for detecting the residue of organophosphorus pesticide chlorpyrifos.

[0045] The present application also provides a detection method for chlorpyrifos and chlorpyrifos degradation product 3,5,6-trichloro-2-pyridinol, comprising the following steps: When the sample to be detected is a liquid sample, the core-shell hydrogel microbead is placed in the sample to be detected, the core-shell hydrogel microbead is recovered, and the fluorescence value is measured, and the residue amount of chlorpyrifos in fruits and vegetables and water bodies is judged according to the fluorescence value; When the sample to be detected is a solid sample, the solid sample is crushed and mixed with water to obtain a mixed solution, the core-shell hydrogel microbead is placed in the mixed solution, the core-shell hydrogel microbead is recovered, and the fluorescence value is measured, and the residue amount of chlorpyrifos in fruits and vegetables and water bodies is judged according to the fluorescence value. The core-shell hydrogel microspheres are the core-shell hydrogel microspheres described in the above scheme or the core-shell hydrogel microspheres obtained by the construction method described above.

[0046] In one embodiment, the solid sample includes fruits and vegetables; the crushing includes crushing; after obtaining the mixture, the liquid component in the mixture is collected; the method of collecting the liquid component in the mixture includes filtering with a 0.22 μM filter and collecting the filtrate; and placing core-shell hydrogel microbeads in the filtrate.

[0047] As one implementation method, the criterion for judgment is: the higher the residual amount of chlorpyrifos, the higher the fluorescence intensity of the core-shell hydrogel microbeads.

[0048] The method of this invention can overcome the limitations of expensive instruments and is a low-cost, simple, accurate and reliable method for detecting chlorpyrifos pesticide residues.

[0049] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, provides a core-shell hydrogel microbead sensing platform, its preparation method, and its applications. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0050] See the schematic diagram of performance optimization, core-shell structure packaging, and application of the chlorpyrifos whole-cell sensor. Figure 1 .

[0051] Example 1: Construction and Performance Analysis of Whole-Cell Sensor I. Construction of recombinant plasmids with different degrading enzymes 1. Construction of CTR (ChpR-GFP) recombinant plasmid: Using pBBR1MCS-2 plasmid as the backbone, and derived from... Sinorhizobium meliloti transcription factor ChpR and bidirectional promoter P chpA Using the green fluorescent protein (GFP) gene as the reporter element and employing multi-fragment homologous recombination, a basic sensing gene circuit, ChpR-GFP, was constructed and named CTR (e.g., ). Figure 2 (a) The specific nucleotide sequence is shown in SEQ ID NO.1.

[0052] 2. Construction of the ophB (ChpR-GFP-ophB) recombinant plasmid: Based on the ChpR-GFP basic recombinant plasmid, an ophB degradative enzyme gene expression cassette was inserted after the green fluorescent protein (GFP) encoding gene. The ophB degradative enzyme gene fragment is derived from... Pseudomonas sp. BF1-3, and after codon optimization, the promoter of the ophB degradation enzyme gene expression cassette is P. J23105, the terminator is Ter, and a sensing gene circuit ChpR-GFP-ophB is obtained, which is named ophB (as shown in c of Figure 2 ). The nucleotide sequence of the ophB degradation enzyme is shown in SEQ ID NO. 3.

[0053] 3. Construction of a recombinant plasmid CPD (ChpR-GFP-CPD): Based on the ChpR-GFP basic recombinant plasmid, a CPD degradation enzyme gene expression cassette is inserted after the green fluorescent protein GFP coding gene. The gene fragment of the CPD degradation enzyme is derived from Paracoccus sp. TRP and is codon-optimized, the promoter of the CPD degradation enzyme gene expression cassette is P J23105 , and the terminator is Ter, and a sensing gene circuit ChpR-GFP-CPD is obtained, which is named CPD (as shown in c of Figure 2 ). The nucleotide sequence of the CPD degradation enzyme is shown in SEQ ID NO. 4.

[0054] 4. Construction of mpd (ChpR-GFP-mpd): Based on the ChpR-GFP basic recombinant plasmid, an mpd degradation enzyme gene expression cassette is inserted after the green fluorescent protein GFP coding gene. The gene fragment of the mpd degradation enzyme is derived from Cupriavidus sp . and is codon-optimized, the promoter of the mpd degradation enzyme gene expression cassette is P J23105 , and the terminator is Ter, and a sensing gene circuit ChpR-GFP-mpd is obtained, which is named mpd (as shown in c of Figure 2 ). The nucleotide sequence of the mpd degradation enzyme is shown in SEQ ID NO. 2 (coding strand).

[0055] The response mechanism of the recombinant plasmid CTR to the target substance is shown in a of Figure 2 . When chlorpyrifos exists, it binds to the transcription factor ChpR, thereby activating the response promoter P chpA , and driving the expression of the green fluorescent protein GFP. The response mechanism of the recombinant plasmids ophB, CPD, and mpd to chlorpyrifos is shown in c of Figure 2 . In this pathway, chlorpyrifos is decomposed by the degradation enzyme to generate the metabolite 3,5,6-trichloro-2-pyridinol (TCP), and the binding ability of the metabolite to the transcription factor ChpR is significantly enhanced (b and d of Figure 2 ), thereby more effectively promoting the expression of GFP.

[0056] II. Construction of recombinant plasmids with different assembly positions and different expression amounts of metabolic modules 1. ChpR-mpd recombinant plasmid, i.e. ChpR-GFP-mpd recombinant plasmid, mpd degrading enzyme gene expression cassette is inserted into ChpR-P chpA -GFP expression cassette upstream, metabolic module assembly position see Figure 3 a.

[0057] 2. Construction of mpd-ChpR recombinant plasmid: based on ChpR-mpd recombinant plasmid, mpd degrading enzyme gene expression cassette is inserted into ChpR-P chpA -GFP expression cassette upstream, to obtain sensor gene circuit mpd-ChpR, metabolic module assembly position see Figure 3 a.

[0058] 3. Construction of ChpR-Ter-mpd recombinant plasmid: based on ChpR-mpd recombinant plasmid, mpd degrading enzyme gene expression cassette is inserted into ChpR-P chpA -GFP expression cassette downstream, metabolic module assembly position see Figure 3 a.

[0059] 4. Construction of ChpR-Ter-mpd-P C recombinant plasmid: based on ChpR-Ter-mpd recombinant plasmid, a series of promoters P J23109 , P J23115 , P J23106 with decreasing transcription intensity are used to replace the original promoter P J23105 in the mpd degrading enzyme gene expression cassette, to construct the corresponding sensor gene circuit ChpR-Ter-mpd-P C , and the recombinant plasmids obtained by different promoters driving mpd expression are shown in Figure 3 d.

[0060] III. Performance analysis of whole cell biosensor 1. Screening of different chlorpyrifos degrading enzymes (1) The recombinant plasmids CTR, ophB, CPD and mpd constructed in Example 1 were introduced into E. coli E. coli DH5α, respectively, to obtain whole cell biosensors DH5α / CTR, DH5α / ophB, DH5α / CPD and DH5α / mpd, respectively.

[0061] (2) Seed solution preparation: three single colonies were picked from the plates of the above four whole cell biosensors, respectively, and inoculated into 48-well plates containing LB medium containing kanamycin. Then, the seed culture solution was obtained by incubating at 37°C, 1000 rpm for 12 h.

[0062] (3) Target substance induction: Seed culture solution was transferred to 96-well plates at a 1% (v / v) inoculation amount for induction culture. Each well system was 200 μL, including 196 μL LB medium containing 50 μg / mL Kanamycin, 2 μL seed solution, 2 μL DMSO (negative control) or 2 μL chlorpyrifos target substance solution. For dose response analysis, another induction experimental group was set up, in which chlorpyrifos target substance was prepared by gradient dilution, and the final concentration gradient was: 50, 12.5, 3.2, 0.8, 0.2, 0.05, 0.025, 0.0125, 0.006, 0.003, 0.0015 and 0 μM. All 96-well plates were placed in an incubator at 30°C, 1000 rpm for 12 h of induction culture.

[0063] (4) Whole cell biosensor performance characterization: ① Bacterial concentration determination. The absorbance (OD 600 ) of the bacterial solution was measured at 600 nm wavelength using a microplate reader to characterize the bacterial concentration; ② Bacterial fluorescence signal intensity determination. 200 μL of bacterial solution was centrifuged at 12000 rpm for 2 min, and the supernatant LB medium was discarded. 300 μL of deionized water was added and vortexed to resuspend the bacterial cells. 200 μL of resuspended bacterial solution was taken to a new 96-well plate, and the gain value was set to 70 on the microplate reader. The fluorescence intensity of green fluorescent protein was measured at an excitation wavelength of 488 nm and an emission wavelength of 510 nm; ③ Relative fluorescence value and response ratio calculation. The relative fluorescence intensity was defined as the ratio of fluorescence intensity value to bacterial concentration (OD 600 ), i.e. Fluo / OD 600 . The response ratio under induction conditions was calculated as (Fluo(+) / OD 600 ) / (Fluo(-) / OD 600 ), where "(+)" represents the chlorpyrifos induction group, and "(-)" represents the DMSO control group.

[0064] Figure 2 The results show that after assembling the chlorpyrifos degradation conversion module, the whole cell biosensor can degrade chlorpyrifos (CPF) into 3,5,6-trichloro-2-pyridinol (TCP), and can significantly improve the performance of the sensor. Figure 2 The molecular docking results of b in and d in 2 show that the binding ability of transcription factor ChpR to metabolite TCP is better than that to the prototype substrate CPF, which explains the subsequent detected performance improvement of the sensor from a mechanism. Figure 2 The results of e in show that the degradation rate of the sensor with added chlorpyrifos degradation module to chlorpyrifos is increased by 15%-50%, verifying the effectiveness of the degradation process. Figure 2The fluorescence signal output intensity and response fold of the sensor with added degradation module are both enhanced by nearly 2 times under the induction of 50 μΜ chlorpyrifos, as shown in f in Figure 2 and g in Figure 2; in the dose response experiment, the detection linear range of the sensor is significantly widened, and the sensitivity is significantly improved.

[0065] 2. Optimization of the assembly position of the degradation conversion module and the enzyme expression amount (1) The recombinant plasmids ChpR-mpd, mpd-ChpR, Chp-Ter-mpd, and ChpR-Ter-mpd-Pc constructed in Example 1 were respectively introduced into Escherichia coli E. coli DH5α to obtain whole-cell biosensors DH5α / ChpR-mpd, DH5α / mpd-ChpR, DH5α / ChpR-Ter-mpd, and DH5α / ChpR-Ter-mpd-Pc, respectively.

[0066] (2) Seed liquid preparation: three single colonies were respectively picked from the plates of the above whole-cell biosensors, and inoculated into 48-well plates containing LB medium containing kanamycin. Then, the seed culture solution was obtained by culturing at 37°C and 1000 rpm for 12 h.

[0067] (3) Target substance induction: the seed culture solution was transferred into 96-well plates at an inoculation amount of 1% (v / v) for induction culture. Each well system was 200 μL, containing 196 μL of LB medium containing 50 μg / mL kanamycin, 2 μL of seed solution, 2 μL of DMSO (negative control), or 2 μL of chlorpyrifos target substance solution. For dose response analysis, another induction experiment group was set up, in which the chlorpyrifos target substance was prepared by gradient dilution, and the final concentration gradient was: 50, 12.5, 3.2, 0.8, 0.2, 0.05, 0.025, 0.0125, 0.006, 0.003, 0.0015 and 0 μM. All 96-well plates were placed at 30°C and 1000 rpm for induction culture for 12 h.

[0068] (4) Performance characterization of the whole-cell biosensor: ① Bacterial concentration determination. The absorbance (OD 600The process involves three steps: ① Characterizing bacterial cell concentration; ② Measuring bacterial fluorescence signal intensity. Take 200 μL of bacterial suspension, centrifuge at 12000 rpm for 2 min, discard the supernatant LB medium, add 300 μL of deionized water, and vortex to resuspend the bacterial cells. Transfer 200 μL of the resuspended bacterial suspension to a new 96-well plate, set the gain value to 70 on a microplate reader, and measure the fluorescence intensity of green fluorescent protein at an excitation wavelength of 488 nm and an emission wavelength of 510 nm; ③ Calculating the relative fluorescence value and response ratio. Relative fluorescence intensity is defined as the fluorescence intensity value versus the bacterial cell concentration (OD). 600 The ratio of Fluo / OD 600 The response ratio under induced conditions is calculated as follows: (Fluo(+) / OD) 600 ) / (Fluo( - ) / OD 600 (), where “(+)” represents the chlorpyrifos-induced group and “(–)” represents the DMSO control group.

[0069] Figure 3 The results showed that optimizing the assembly location and enzyme expression level of the degradation and transformation module significantly improved the sensor's sensitivity and reduced its detection limit. Figure 3 As shown in a~c, the mpd degradative enzyme gene expression cassette is inserted backwards into ChpR-P. chpA Downstream of the -GFP expression cassette (i.e., when constructing ChpR-Ter-mpd), the sensor exhibits the highest signal output intensity, a wider detection linear range, and a detection limit reduced to 1.5 nM. Figure 3 The results in d and e in 3 show that when the promoter P is used J23109 drive mpd When the gene is expressed, the optimal level of degradative enzyme can be obtained. Under this condition, the sensor maintains a high fluorescence signal output while its background fluorescence is significantly reduced, thus achieving a higher response fold.

[0070] 3. Specificity analysis of whole-cell biosensors (1) The recombinant plasmid ChpR-Ter-mpd-P from Example 1 was used. J23109 Introduced into E. coli E. coli In DH5α, the whole-cell sensor ChpR-Ter-mpd-P was obtained. J23109 .

[0071] (2) Seed culture: The whole-cell sensor ChpR-Ter-mpd-P from step 1 was cultured. J23109 Three single clones were picked from the plate and inoculated into 48-well plates containing LB medium containing kanamycin. The plates were then cultured with shaking at 37°C and 1000 rpm for 12 h to obtain seed culture.

[0072] (3) Specificity test: Seed culture was inoculated into 96-well plates at 1% (v / v) for induction culture. Each well contained 200 μL, including 196 μL LB medium containing 50 μg / mL Kanamycin, 2 μL seed liquid, 2 μL DMSO (negative control) or 2 μL test substance (chlorpyrifos and other organophosphorus pesticides) with a final concentration of 50 μM. All 96-well plates were placed in a 30℃, 1000 rpm condition for 12 h of induction culture. Five kinds of organophosphorus pesticides were selected as test substances, which were Fenthion (Penthrin), Phoxim (Phoxim), Parathion-ethyl (Parathion), Malathion (Malathion) and Parathion-methyl (Methyl Parathion).

[0073] (4) Whole-cell biosensor specificity test result characterization: ① Bacterial concentration determination. The absorbance (OD 600 ) of the bacterial solution was measured at 600 nm wavelength using a microplate reader to characterize the bacterial concentration; ② Bacterial fluorescence signal intensity determination. 200 μL of bacterial solution was centrifuged at 12000 rpm for 2 min, and the supernatant LB medium was discarded. 300 μL of deionized water was added and vortexed to resuspend the bacterial cells. 200 μL of resuspended bacterial solution was taken to a new 96-well plate, and the gain value was set to 70 on the microplate reader. The fluorescence intensity of green fluorescent protein was measured at 488 nm excitation wavelength and 510 nm emission wavelength; ③ Relative fluorescence value calculation. The relative fluorescence intensity was defined as the ratio of fluorescence intensity value to bacterial concentration (OD 600 ), i.e. Fluo / OD 600 .

[0074] Figure 3 The f in the above formula indicates that the constructed whole-cell biosensor has high specificity.

[0075] Example 2 Preparation and performance analysis of core-shell hydrogel microbeads I. Preparation of core-shell hydrogel microbeads 1. Preparation of whole-cell sensor strain mother liquor A single colony was picked from the plate of DH5α / ChpR-Ter-mpd-P J23109 strain and inoculated into 5 mL LB medium containing Kanamycin. The culture was incubated at 37℃, 220 rpm for 12 h. Then, the culture was diluted 100 times with fresh LB medium (containing Kanamycin) and incubated at 37℃, 220 rpm until OD 600= 0.6. The obtained bacterial solution was centrifuged at 5000 rpm for 10 min to collect the bacterial cells. The cells were washed once with sterile ddH2O to remove residual LB medium, and finally resuspended in an equal volume of fresh LB medium without antibiotics to prepare the whole-cell sensor strain stock solution.

[0076] 2. Preparation of hydrogel inner core As shown in steps 1-3 in a of Figure 4 , 5 mL of the strain stock solution and 5 mL of a 4.5% (w / v) sodium alginate solution were mixed at a volume ratio of 1:1. The mixture was loaded into a 1 mL syringe for preparing the microspheres. The needle dripping method was used to drop the mixture in the syringe into a continuously gently stirred 20 mL calcium chloride solution (contained in a beaker) drop by drop. After 15 min of crosslinking reaction, the calcium chloride solution was removed by filtration. The obtained hydrogel inner core microbeads were used in subsequent shell preparation experiments, and the excess part was stored in ddH2O at 4°C. Thus, the hydrogel inner core microbeads were obtained.

[0077] 3. Preparation of core-shell hydrogel microbeads As shown in step 4 in a of Figure 4 , the excess calcium chloride solution was removed with a pipette and transferred to a 0.5 wt% sodium alginate solution for crosslinking for 20-60 s before drying. The beaker was shaken to prevent the beads from gathering. Excess ddH2O was added to prevent the shell interface reaction. Finally, the core-shell hydrogel microbeads were placed in a 0.05 M CaCl2 solution for 9-16 h to stabilize the shell structure. Long-term storage in ddH2O was performed to prevent swelling or shrinkage.

[0078] The core-shell hydrogel microbeads were prepared by the above ion crosslinking method. Other whole-cell biosensors can be wrapped by the same method for application.

[0079] II. Optimization of core-shell hydrogel packaging conditions and characterization of microbead performance 1. Effect of shell material on sensor performance To evaluate the effect of different shell materials on the biosafety, biocompatibility, and sensing performance of the hydrogel microbeads, sodium alginate and polyacrylamide were selected as the shell materials, and the microbeads without a shell were used for comparative analysis. The preparation process of the core-shell microbeads with sodium alginate as the shell material is shown in Example 2. In the preparation process of the polyacrylamide shell, the hydrogel inner core microbeads without a shell were first placed in a crosslinking agent (N,N'-methylenebisacrylamide and ammonium persulfate) for crosslinking, and then transferred to a stabilizer (2-morpholinoethanesulfonic acid) for solidification for 3 h to obtain the alginate-polyacrylamide core-shell microbeads.

[0080] To investigate the effect of different shell materials on the leakage of engineered bacteria, three types of microspheres were placed in 400 μL of LB medium containing kanamycin and cultured at 30℃ and 1000 rpm for 12 h. The results are as follows: Figure 4 As shown in b, when polyacrylamide with high cross-linking strength is used as the shell material, the bacterial leakage of core-shell microbeads in liquid LB medium is the lowest; while the anti-leakage effect of sodium alginate shell microbeads is also significantly better than that of unshelled microbeads, showing good biosafety.

[0081] To evaluate the effect of different shell materials on the viability of encapsulated cells, microspheres were harvested at different time points and dissolved in 100 μL of 0.1 M sodium citrate solution. The solution was then diluted orders of magnitude with fresh LB medium and plated, and incubated at 37°C for 12 h. The results are as follows: Figure 4 As shown in d, polyacrylamide crosslinking agents exhibit strong toxicity to cells, severely inhibiting cell activity; while sodium alginate, with its mild gelation conditions, performs excellently in maintaining cell activity, even surpassing shell-less core microbeads.

[0082] To further analyze the influence of different core-shell materials on sensor performance, using 50 μM chlorpyrifos as an inducer, three types of microspheres (two with different shell materials and microspheres without a shell material) were added to 96-well plates (200 μL per well, including 198 μL of LB medium containing 50 μg / mL Kanamycin and 2 μL of DMSO or chlorpyrifos target solution), and incubated at 30℃ and 1000 rpm for 12 h. The results are as follows: Figure 4 As shown in c, the polyacrylamide shell severely weakens the signal output strength of the sensor, while the sodium alginate core-shell microbeads can still maintain a good signal response and meet the detection requirements.

[0083] In summary, sodium alginate exhibits excellent performance in maintaining high cell viability and good biosafety, and therefore was selected as the material for preparing the sensor shell.

[0084] 2. The effect of crosslinking time on sensor performance The preparation time of the hydrogel shell is the key control factor for regulating the shell thickness, which directly affects the comprehensive performance of the core-shell microbeads. When the crosslinking time is too short, the shell formed is too thin, and the microbead structure is not strong enough to effectively constrain the proliferation pressure of the internal bacteria, which is easy to cause the microbead to rupture and the content to leak, bringing biological safety risk. On the contrary, if the crosslinking time is too long, the shell will be too thick, which will help to maintain the structural stability, but at the same time, it will hinder the diffusion of nutrients to the inside, inhibit the normal growth of bacteria, and weaken the input and output efficiency of the signal in the biosensing process. Therefore, it is of great significance to determine an optimal crosslinking time to maximize the reduction of the risk of leakage of the engineered bacteria while balancing the biological safety and sensing performance on the premise of ensuring the structural integrity.

[0085] Therefore, in this study, the crosslinking time in the shell preparation was set to 10 s, 30 s, 60 s, 120 s and 180 s, and its influence on the shell thickness and the sensing performance of the microbeads was systematically evaluated. First, the shell thickness of the solidified core-shell microspheres was observed by inverted fluorescence microscope bright field observation, and the positive correlation between the crosslinking time and the shell thickness was confirmed. The fluorescence signal of the core-shell microspheres after 50 μM induction was observed by inverted fluorescence microscope fluorescence field observation, and the negative correlation between the crosslinking time and the fluorescence signal intensity was confirmed. Figure 4 h in the formula (1).

[0086] To further explore the influence of crosslinking time on the sensor performance, 50 μM chlorpyrifos was used as the inducer, and different crosslinking time core-shell hydrogel microbeads were added in the 96-well plate system (200 μL per well, including 198 μL LB medium containing 50 μg / mL Kanamycin, and 2 μL DMSO or chlorpyrifos target substance solution), and cultured at 30℃, 1000 rpm for 12 h. The results are shown in Figure 4 As shown in e in the formula (2) and f in the formula (4), the microbeads with shorter crosslinking time (thinner shell) have higher sensor signal output, but are prone to bacterial leakage, which poses a biological safety hazard. While the microbeads with longer crosslinking time (thicker shell) effectively control the leakage problem, but the signal output intensity is significantly inhibited.

[0087] On this basis, three crosslinking time points of 10 s, 30 s and 60 s were selected to further evaluate their influence on the activity of encapsulated cells. The microbeads were taken out at different time points, dissolved with 100 μL 0.1 M sodium citrate solution, diluted with fresh LB medium, and then plated and cultured at 37℃ for 12 h. The results show that Figure 4 g in the formula (3), too short or too long crosslinking time is not conducive to maintaining cell activity.

[0088] Considering the shell thickness, the ability to prevent leakage, signal output intensity, and cell activity, etc., 30 s was ultimately determined as the optimal crosslinking time, which can ensure a high signal output while taking into account biological safety and cell activity.

[0089] 3. Comprehensive performance characterization of core-shell hydrogel microspheres Based on the optimized core-shell hydrogel packaging conditions, the hydrogel microspheres were tested and characterized for their biological safety, biocompatibility, and sensing performance. This study systematically characterized the advantages of core-shell structure hydrogel microspheres compared to traditional uncoated (homogeneous) hydrogel microspheres in terms of performance.

[0090] Figure 5 The leakage of encapsulated bacteria inside the hydrogel microspheres with and without shells in liquid and solid culture environments is shown in a and b of FIG. 5. The core-shell structure microspheres showed very low leakage rates under both culture conditions. The uncoated microspheres encapsulated bacteria quickly spread into the liquid culture medium and proliferated; on the surface of the solid culture medium, the leaked bacteria formed a clear diffusion circle around them. This indicates that traditional core hydrogel microspheres cannot effectively limit the escape of internal bacteria, posing certain biological safety problems, which limits their potential for long-term application. This characteristic is crucial for maintaining the concentration of bacteria inside the microspheres, preventing environmental leakage of genetically engineered bacteria, and ensuring the accuracy of detection signals.

[0091] Further, this study evaluated whether the presence or absence of a shell can effectively maintain stable cell proliferation and metabolic activity. The results are shown in c of FIG. 5. Figure 5 At the initial stage, the metabolic activity of the cell aggregates encapsulated in the core-shell structure microspheres was weaker than that of the uncoated microspheres due to weaker nutrient diffusion. After reaching the saturation point, the metabolic activity of the cell aggregates encapsulated in the uncoated microspheres weakened due to the leakage of bacteria and the impact of the external environment, which was lower than that of the core-shell structure microspheres (c of FIG. 5). This indicates that the metabolic activity of the bacteria encapsulated in the core-shell microspheres exhibits more stable and persistent characteristics. The shell structure provides a protected microenvironment for the internal bacterial population, which can buffer the drastic changes in the external environment (such as pH and toxic substance fluctuations), while allowing slow diffusion of nutrients and metabolic products, which is beneficial for long-term packaging and long-term biosensing applications of the microspheres. Figure 5

[0092] Figure 5 ​Figure d shows the signal reporting mechanism of core-shell hydrogel microspheres as a biosensor and their physical images under sunlight and ultraviolet light. To further verify the ability of core-shell hydrogel microspheres to detect chlorpyrifos, LB medium containing kanamycin was prepared using 50 mM chlorpyrifos as the stock solution and a serial dilution method to prepare chlorpyrifos final concentrations of 50, 12.5, 3.2, 0.8, 0.2, 0.05, 0.025, 0.0125, 0.006, 0.003, 0.0015, and 0 μM. 200 μL of LB medium containing different concentrations of chlorpyrifos was added to each well of a 96-well plate, followed by the addition of core-shell hydrogel microspheres, and the plates were incubated at 30°C and 1000 rpm for 12 h. Figure 5 The results in step e validated the detection capability of the core-shell hydrogel microbeads for different concentrations of chlorpyrifos. The output signal intensity of the core-shell microbeads showed a good linear relationship or an "S"-shaped curve relationship with the chlorpyrifos concentration, and the detection limit of the microbeads was 6 nM, meeting the national standard. This demonstrates that the core-shell structure not only did not hinder the detection sensitivity, but also made the detection results more reliable and quantitative by stabilizing the internal reaction environment.

[0093] Figure 5 The 'f' value in the figure represents the storage stability of the core-shell hydrogel microspheres. The outer shell of the core-shell hydrogel effectively reduces moisture loss and protects the internal active ingredients. Core-shell hydrogel microspheres stored at 4 °C retain more than 80% of their initial sensing activity after 30 days. This characteristic is crucial for the commercialization, transportation, and convenience of practical applications of the product.

[0094] In summary, the low detection limit and wide dynamic range indicate that core-shell hydrogel microspheres have the potential for application in real-world complex samples.

[0095] Example 3: Actual Sample Detection of Core-Shell Hydrogel Microbeads To verify the stability of the core-shell hydrogel microspheres in different detection environments, spiked tests were conducted on lake water, soil, and cucumbers from a supermarket. The detection process is as follows: Figure 6 As shown in 'a'. The detection results are as follows: Figure 6 As shown in b, the results indicate that the core-shell hydrogel microspheres have good stability in different detection environments.

[0096] To further verify the reliability of the core-shell hydrogel microbeads in this application, ddH2O was used as the control group and cucumber as the experimental group for spiked recovery. The concentration of chlorpyrifos after spiked samples was set at 5 μM. The fluorescence intensity of each spiked sample was measured using a microplate reader. Three sets of experiments were repeated, and the recovery rate was analyzed. The results are as follows: Figure 6The recovery rate of the added standard indicated by c in the figure is distributed between 90-110%, and the relative standard deviation is 9.77%, indicating that the system has high accuracy and reliability in actual sample detection, and can be applied to qualitative and quantitative detection of chlorpyrifos.

[0097] In summary, the present application provides a core-shell hydrogel microsphere sensing platform for detecting chlorpyrifos and its metabolite residues. First, an efficient engineering sensing microorganism with high sensitivity and low leakage is constructed, and then the engineering sensing microorganism is wrapped in a sodium alginate core-shell hydrogel to construct a core-shell structure hydrogel sensing microsphere. Through the verification of the examples, the core-shell hydrogel microsphere provided by the present application can efficiently detect chlorpyrifos residues in water, soil and fruits and vegetables, and has practical application value.

[0098] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which belong to the protection scope of the present application.

Claims

1. An engineered sensing microorganism, characterized in that, The recombinant vector comprises a gene expression cassette, the gene expression cassette comprises a coding gene of transcription factor ChpR, a coding gene of fluorescent reporter protein GFP and a coding gene of chlorpyrifos-degrading enzyme; the chlorpyrifos-degrading enzyme comprises ophB, CPD or mpd.

2. The engineered sensing microorganism of claim 1, wherein, The gene expression cassette comprises a first gene expression cassette and a second gene expression cassette; the first gene expression cassette comprises a coding gene of transcription factor ChpR and a coding gene of fluorescent reporter protein GFP; the second gene expression cassette comprises a coding gene of chlorpyrifos-degrading enzyme.

3. The engineered sensing microorganism of claim 2, wherein, The promoter of the first gene expression cassette comprises a bidirectional promoter P chpA ; the bidirectional promoter P chpA is inserted between the coding gene of the transcription factor ChpR and the coding gene of the fluorescent reporter protein GFP.

4. The engineered sensing microorganism of claim 3, wherein, The nucleotide sequence of the coding gene of the transcription factor ChpR is shown in SEQ ID NO. 1 at positions 1-1665; the nucleotide sequence of the bidirectional promoter P chpA is shown in SEQ ID NO. 1 at positions 1666-1846; and the nucleotide sequence of the coding gene of the fluorescent reporter protein GFP is shown in SEQ ID NO. 1 at positions 1847-2564.

5. The engineered sensing microorganism of claim 2, wherein, The second genetic expression cassette is inserted reversely after the coding gene of fluorescent reporter protein GFP; the second genetic expression cassette comprises a promoter P J23109 、 Ribosome binding site B0030, coding gene of chlorpyrifos-degrading enzyme, and terminator Ter.

6. The engineered sensing microorganism of claim 5, wherein, The coding gene of the chlorpyrifos-degrading enzyme is codon-optimized; the promoter P J23109 nucleotide sequence of the ribosome binding site B0030 is shown as positions 36-63 of SEQ ID NO. 2; the nucleotide sequence of the coding gene of the mpd is shown as positions 64-1059 of SEQ ID NO. 2; the nucleotide sequence of the terminator Ter is shown as positions 1060-1176 of SEQ ID NO. 2; the nucleotide sequence of the ophB is shown as SEQ ID NO. 3; and the nucleotide sequence of the CPD is shown as SEQ ID NO.

4.

7. A core-shell hydrogel microbead, characterized in that, The hydrogel microbead comprises the engineered sensing microorganism in any one of claims 1-6; the hydrogel microbead is constructed by sodium alginate and calcium chloride.

8. The method of constructing core-shell hydrogel microbeads of claim 7, wherein, The method comprises the following steps: Mixing a mother liquor containing the engineered sensing microorganism and a first sodium alginate solution to obtain a mixed solution; Dropping the mixed solution into a first calcium chloride solution to obtain a hydrogel microbead core; Transferring the hydrogel microbead core to a second sodium alginate solution for crosslinking for 20-60 s, and then transferring the hydrogel microbead core to a second calcium chloride solution for 9-16 h to obtain a core-shell hydrogel microbead.

9. The engineered sensing microorganism in any one of claims 1-6, the core-shell hydrogel microbead in claim 7 or the core-shell hydrogel microbead obtained by the construction method in claim 8 is applied in at least one of the following: 1) application in indicating or detecting chlorpyrifos and chlorpyrifos degradation product 3,5,6-trichloro-2-pyridinol; 2) application in preparing a product for indicating or detecting chlorpyrifos and chlorpyrifos degradation product 3,5,6-trichloro-2-pyridinol.

10. A method for detecting chlorpyrifos and a degradation product of chlorpyrifos, 3,5,6-trichloro-2-pyridinol, characterized by, The method comprises the following steps: When the sample to be detected is a liquid sample, the core-shell hydrogel microbead is placed in the sample to be detected, the core-shell hydrogel microbead is recovered, and the fluorescence value of the core-shell hydrogel microbead is measured to determine the chlorpyrifos residue in fruits, vegetables and water bodies according to the fluorescence value; When the sample to be detected is a solid sample, the solid sample is crushed and mixed with water to obtain a mixed solution, the core-shell hydrogel microbead is placed in the mixed solution, the core-shell hydrogel microbead is recovered, and the fluorescence value of the core-shell hydrogel microbead is measured to determine the chlorpyrifos residue in fruits, vegetables and water bodies according to the fluorescence value; The core-shell hydrogel microbead is the core-shell hydrogel microbead in claim 7 or the core-shell hydrogel microbead obtained by the construction method in claim 8.

Images