Enzyme-responsive brain-targeting sustained-release formulation based on dialkylimidazolium biomimetic lipids, its preparation method and application

Abstract

This invention relates to an enzyme-responsive brain-targeting sustained-release formulation based on dialkylimidazolium biomimetic lipids, its preparation method, and its application, belonging to the field of drug delivery. First, dialkylimidazolium biomimetic lipids are covalently coupled with natural phospholipids to form a dialkylimidazolium conjugate. Then, this dialkylimidazolium conjugate is self-assembled with dialkylimidazolium biomimetic lipids, natural phospholipids, cholesterol, and a therapeutic drug to form a drug-loaded lipid nanoparticle delivery system. This drug delivery system can effectively cross the blood-brain barrier to achieve brain-targeted delivery of the loaded drug. In the glioma microenvironment, this drug delivery system can gradually hydrolyze the dialkylimidazolium conjugate through an enzyme-responsive mechanism to achieve sustained release of the loaded drug, providing a new strategy for improving the brain targeting and efficacy of different types of anti-glioma drugs, such as small nucleic acid drugs, peptide drugs, and small molecule drugs.

Description

Technical Field

[0001] This invention belongs to the field of drug delivery technology, and in particular relates to an enzyme-responsive brain-targeted sustained-release formulation based on dialkyl imidazole biomimetic lipids, its preparation method and application. Background Technology

[0002] Malignant glioma (GBM) is the most common malignant tumor of the central nervous system, characterized by its high invasiveness, high recurrence rate, and extremely poor prognosis. GBM readily infiltrates surrounding normal brain tissue, making complete surgical resection difficult. Furthermore, it exhibits inherent or acquired resistance to radiotherapy and chemotherapy, resulting in a 5-year survival rate of less than 10%. The presence of the blood-brain barrier (BBB) ​​severely hinders drug delivery to the tumor site, leading to excessively low drug concentrations in tumor tissue, hindering effective treatment and causing significant systemic toxicity, greatly limiting clinical translation. The GBM microenvironment possesses unique enzymatic characteristics, with the expression levels of various hydrolases significantly higher than in normal brain tissue, providing specific targets for enzyme-responsive drug delivery systems. Among these, esterases and proteases, which catalyze the hydrolysis of ester and amide bonds respectively, are currently the most widely used response targets. In addition, phospholipases can hydrolyze phosphate ester carrier materials, while phosphoramidases specifically hydrolyze phosphoramide bonds. These two types of enzymes are enriched in the GBM cell membrane and cytoplasm, providing new targets for designing highly specific enzyme-responsive brain-targeted sustained-release drug delivery systems.

[0003] Despite the enormous clinical potential of enzyme-responsive drug delivery systems and their formulations, current technologies still face several challenges: First, it is difficult to simultaneously achieve both the ability of the carrier to cross the blood-brain barrier (BBB) ​​and its targeting capability; most carriers can respond to enzyme signals but cannot effectively cross the BBB for delivery. Second, the release kinetics of enzyme-responsive drugs are uncontrollable, easily leading to premature or delayed release, inducing systemic toxicity or affecting efficacy. Third, the biocompatibility of carrier materials and the safety of degradation products still need optimization. These problems severely restrict the clinical translation of such drug delivery systems, necessitating breakthroughs through the design and structural optimization of novel functional materials.

[0004] Bio-mimetic dialkylimidazolium lipids (BDILs) are a class of imidazole-based cationic lipid compounds with biomimetic structural features. Their structure is designed to mimic the structure of natural phospholipids, exhibiting both amphiphilicity and good biocompatibility. Furthermore, the introduction of primary amine groups of varying alkyl chain lengths at the 2-position of the imidazole ring can mediate the temporary opening of the blood-brain barrier (BBB). Based on the biomimetic properties of BDILs and their "on / off" regulation of the BBB, drug carriers composed of BDILs and lipid excipients such as natural phospholipids and cholesterol hold promise for improving key technical indicators of enzyme-responsive drug delivery systems, including blood-brain barrier permeability, brain-targeted delivery efficiency, and enzyme-responsive drug release kinetics, thus effectively treating malignant gliomas. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an enzyme-responsive brain-targeted sustained-release formulation based on dialkyl imidazole biomimetic lipids, its preparation method, and its application.

[0006] The technical solution adopted in this invention is: an enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticle based on dialkylimidazolium biomimetic lipids, comprising dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugate, dialkylimidazolium biomimetic lipids, natural phospholipids, cholesterol, and therapeutic drugs.

[0007] Preferably, the therapeutic drug is a small nucleic acid drug, a polypeptide drug, or a small molecule drug.

[0008] Preferably, the small nucleic acid drug is one or more of siRNA, snRNA, shRNA, saRNA, and miRNA.

[0009] Preferably, the polypeptide drug is one or more of polypeptide vaccines and small molecule polypeptides.

[0010] Preferably, the small molecule drug is one or more of synthetic small molecule chemical drugs and natural product drugs.

[0011] Preferably, the dialkyl imidazole biomimetic lipid has the structure shown in general formula 1;

[0012] General Formula 1;

[0013] Where R' is C9~C 18 A straight-chain saturated or unsaturated hydrocarbon group, where R'' is C9~C9. 18 The straight-chain saturated hydrocarbon group or unsaturated hydrocarbon group, where R' and R'' are the same group or different groups;

[0014] n is an integer from 3 to 9;

[0015] X - It is an anionic group, specifically I - ,Br - Cl - BF4 - or PF6 - .

[0016] This invention also provides a method for preparing the above-mentioned enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles based on dialkyl imidazole biomimetic lipids, comprising the following steps:

[0017] Step S01: Dissolve dialkylimidazolium biomimetic lipids and phospholipids in an organic solvent, add a coupling agent, and form a dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugate;

[0018] Step S02: The dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugate obtained in step S01 is mixed with dialkylimidazolium biomimetic lipid, natural phospholipid, cholesterol and therapeutic drug to prepare lipid nanoparticles in which the therapeutic drug is loaded.

[0019] Step S03: The lipid nanoparticles obtained in step S02 are sterilized by passing them through a filter membrane to obtain enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles.

[0020] Preferably, the phospholipid in the dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugate is phosphatidic acid or phosphatidylserine.

[0021] Preferably, the phosphatidyl phosphatidyl acid is dihexanoyl phosphatidyl acid (06:0 PA), diheptanoyl phosphatidyl acid (08:0 PA), or didecanoyl phosphatidyl acid (10:0 PA).

[0022] Preferably, the phosphatidylserine is dihexanoylphosphatidylserine (06:0 PS), diheptanoylphosphatidylserine (08:0 PS), or didecanoylphosphatidylserine (10:0 PS).

[0023] Preferably, the coupling agent comprises an activator and a catalyst, wherein the activator is carbodiimide and / or imidazole, and the catalyst is an organic base.

[0024] Preferably, the carbodiimide is dicyclohexylcarbodiimide (DCC) or 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC); the organic base is triethylamine (TEA), 4-dimethylaminopyridine (DMAP) or diisopropylethylamine (DIPEA).

[0025] Preferably, the natural phospholipids in the enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles are one or more of distearylphosphatidylcholine (DSPC), dipalmitoylphosphatidylcholine (DPPC), and myristoylphosphatidylcholine (DMPC).

[0026] Preferably, the molar ratio of the dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugate to the dialkylimidazolium biomimetic lipid, natural phospholipid, and cholesterol in the enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles is (40~75):(50~75):(10~40):(20~35).

[0027] The present invention also provides an enzyme-responsive brain-targeted sustained-release formulation, comprising enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles based on dialkyl imidazole biomimetic lipids.

[0028] Preferably, it also includes pharmaceutically acceptable excipients.

[0029] The present invention also provides the application of enzyme-responsive brain-targeting sustained-release drug-loaded lipid nanoparticles based on dialkylimidazolium biomimetic lipids, enzyme-responsive brain-targeting sustained-release formulations containing enzyme-responsive brain-targeting sustained-release drug-loaded lipid nanoparticles based on dialkylimidazolium biomimetic lipids, and the preparation method of enzyme-responsive brain-targeting sustained-release drug-loaded lipid nanoparticles based on dialkylimidazolium biomimetic lipids in the preparation of drugs for treating glioma.

[0030] The advantages and positive effects of this invention are as follows: the phospholipids in the dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugate (di-lipid conjugate) are short-chain phosphatidic acid or short-chain phosphatidylserine, which are coupled to the dialkylimidazolium biomimetic lipid via phosphoramide bonds or amide bonds, respectively; the phosphoramide and amide bonds exhibit good plasma stability and are not easily degraded, resulting in no leakage of the encapsulated drug. Furthermore, the independent dialkylimidazolium biomimetic lipid component can enhance the delivery efficiency across the blood-brain barrier by regulating it. More significantly, upon entering the glioma microenvironment, the phosphoramide or amide bonds in the di-lipid conjugate can be hydrolyzed by highly expressed phosphoramidase or protease, respectively. On the one hand, phosphatidic acid or phosphatidylserine fragments, as hydrolysis products, preferentially detach from enzyme-responsive brain-targeting sustained-release drug-loaded lipid nanoparticles due to their water solubility and protonated state, entering endosomes or lysosomes. This disrupts the molecular arrangement and integrity of the lipid layer of the drug-loaded lipid nanoparticles, causing them to gradually disintegrate and release the encapsulated drug. On the other hand, the hydrolysis generates new dialkylimidazolium biomimetic lipids, further increasing the proportion of the original dialkylimidazolium biomimetic lipids in the drug-loaded lipid nanoparticles and strengthening the "proton sponge effect," thereby promoting drug release from the drug-loaded lipid nanoparticles. This enzyme-acid cascade response mechanism in the tumor microenvironment enables sustained release of the encapsulated drug. Therefore, the enzyme-responsive brain-targeting sustained-release drug-loaded lipid nanoparticles provided by this invention not only enhance the blood-brain barrier permeability and brain targeting of drugs but also prolong the duration of drug action and reduce drug toxicity through sustained release, thereby improving the efficacy of anti-glioma drugs. Attached Figure Description

[0031] Figure 1 This is a schematic diagram of the structure of enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles based on dialkyl imidazole biomimetic lipids. Figure 1 A is a drug-loaded lipid nanoparticle containing a dialkyl imidazole biomimetic lipid-phosphatidic acid binary lipid conjugate; Figure 1 B is a drug-loaded lipid nanoparticle containing a dialkyl imidazole biomimetic lipid-phosphatidylserine binary lipid conjugate;

[0032] Figure 2 This is a transmission electron microscope (TEM) image of enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles based on dialkyl imidazole biomimetic lipids. Figure 2 A represents lipid nanoparticles PTX@A0-PA / A0 / DPPC / Chol. loaded with paclitaxel (PTX). Figure 2 B represents lipid nanoparticles TM-601@A18-PS / A18 / DSPC / Chol. loaded with chloramphenicol (TM-601). Figure 2 C represents lipid nanoparticles loaded with miR-329, miR-329@A18-PS / A18 / DSPC / Chol.

[0033] Figure 3 This is a nanoflow cytometry (NanoFCM) image of enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles based on dialkyl imidazole biomimetic lipids. Figure 3 A represents lipid nanoparticles PTX@A0-PA / A0 / DPPC / Chol. loaded with paclitaxel (PTX). Figure 3 B represents lipid nanoparticles TM-601@A18-PS / A18 / DSPC / Chol. loaded with chloramphenicol (TM-601). Figure 3 C represents lipid nanoparticles loaded with miR-329, miR-329@A18-PS / A18 / DSPC / Chol.

[0034] Figure 4 Delivery efficiency of paclitaxel (PTX)-loaded lipid nanoparticles PTX / AF660@A0-PA / A0 / DPPC / Chol., labeled with the fluorescent probe AF660, across the in vitro blood-brain barrier model. Figure 4 A is a graph showing the relationship between cytotoxicity and time; Figure 4 B is a graph showing the change in fluorescence intensity over time;

[0035] Figure 5 Delivery efficiency of miR-329 / AF660@A18-PS / A18 / DSPC / Chol., lipid nanoparticles loaded with miR-329 labeled with the fluorescent probe AF660, across the in vitro blood-brain barrier model. Figure 5 A is a graph showing the relationship between cytotoxicity and time; Figure 5 B is a graph showing the change in fluorescence intensity over time;

[0036] Figure 6 The graphs show the brain tissue-to-plasma concentration ratio (B / P) and tumor weight changes at different time points after the lipid nanoparticles PTX@A0-PA / A0 / DPPC / Chol. loaded with paclitaxel (PTX) in a mouse model and the lipid nanoparticles PTX@MC3 / DPPC / Chol. in Comparative Example 1, which deliver the drug across the blood-brain barrier. Figure 6 A is a B / P relationship diagram; Figure 6B is a graph showing the relationship between tumor weight changes;

[0037] Figure 7 The graphs show the brain tissue-to-plasma concentration ratio (B / P) and tumor weight changes at different time points after the lipid nanoparticles TM-601@A18-PS / A18 / DSPC / Chol. loaded with chloramphenicol (TM-601) in a mouse model and the lipid nanoparticles TM-601@MC3 / DSPC / Chol. in Comparative Example 2, which deliver the drug across the blood-brain barrier. Figure 7 A is a B / P relationship diagram; Figure 7 B is a graph showing the relationship between tumor weight changes;

[0038] Figure 8 The graphs show the brain tissue-to-plasma concentration ratio (B / P) and tumor weight changes at different time points after drug delivery across the blood-brain barrier for lipid nanoparticles miR-329@A18-PS / A18 / DSPC / Chol. loaded with miR-329 in a mouse model and the lipid nanoparticles miR-329@MC3 / DSPC / Chol. in Comparative Example 3. Figure 8 A is a B / P relationship diagram; Figure 8 B is a graph showing the relationship between tumor weight changes. Detailed Implementation

[0039] The embodiments of the present invention will now be described with reference to the accompanying drawings.

[0040] This invention relates to an enzyme-responsive brain-targeted sustained-release formulation based on dialkylimidazolium biomimetic lipids, its preparation method, and its application. The method involves coupling dialkylimidazolium biomimetic lipids with short-chain phosphatidic acid or short-chain phosphatidylserine to form a dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugate (di-lipid conjugate). This conjugate is then self-assembled with other lipids to form lipid nanoparticles, which encapsulate small nucleic acid drugs, peptide drugs, or small molecule drugs with anti-glioma activity. This process yields enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles, ultimately achieving brain-targeted drug delivery and sustained release through an enzyme-responsive mechanism in the tumor microenvironment, effectively treating glioma.

[0041] Dialkyl imidazolium biomimetic lipid, with the structure shown in general formula 1;

[0042] General Formula 1;

[0043] Among them, R' and R'' are each independently selected from chains with lengths C9 to C1. 18 The groups are straight-chain saturated or unsaturated hydrocarbon groups, where R' and R'' are the same or different groups. In some embodiments of the present invention, R' and R'' are each independently selected from C. 14 ~C 18A straight-chain alkyl or monoalkenyl group; preferably, R' and R'' are one or both of the following structures:

[0044]

[0045] The carbon chain length and unsaturation of R' and R'' can modulate the biocompatibility and self-assembly polymorphism of dialkylimidazolium biomimetic lipids, thereby affecting the stability of the lipid nanoparticles and their drug loading and delivery efficiency.

[0046] In general formula 1, n is an integer from 3 to 9; in some embodiments of the present invention, n is 4 or 5. - It is an anionic group, specifically I - ,Br - Cl - BF4 - or PF6 - In some embodiments of the present invention, X - For I - or Cl - .

[0047] In some embodiments of the present invention, the above-mentioned dialkyl imidazolium biomimetic lipid is one of the following compounds:

[0048]

[0049] Small nucleic acid drugs are one or more of siRNA, snRNA, shRNA, saRNA, and miRNA; polypeptide drugs are one or more of polypeptide vaccines and small molecule polypeptides; small molecule drugs are one or more of synthetic small molecule chemical drugs and natural product drugs. In some embodiments of the present invention, the small nucleic acid drug is miRNA, preferably miR-329; the polypeptide drug is a small molecule polypeptide, preferably chloramphenicol (TM-601); and the small molecule drug is a natural product drug, preferably paclitaxel (PTX).

[0050] The preparation method for the above-mentioned enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles based on dialkyl imidazole biomimetic lipids includes the following steps:

[0051] Step S01: Dissolve the dialkylimidazolium biomimetic lipid and phospholipid in an organic solvent, and add a coupling agent to complete the coupling of the dialkylimidazolium biomimetic lipid and phospholipid, forming a dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugate (di-lipid conjugate), such as... Figure 1 As shown. Among them, phospholipids are phosphatidic acid (…). Figure 1 A) or phosphatidylserine ( Figure 1B), the phosphatidyl phosphate is dihexanoyl phosphatidyl phosphate (06:0 PA), diheptanoyl phosphatidyl phosphate (08:0 PA), or didecanoyl phosphatidyl phosphate (10:0 PA); the phosphatidyl serine is dihexanoyl phosphatidyl serine (06:0 PS), diheptanoyl phosphatidyl serine (08:0 PS), or didecanoyl phosphatidyl serine (10:0 PS). The coupling aid comprises an activator and a catalyst. The activator is carbodiimide and / or imidazole, preferably dicyclohexylcarbodiimide (DCC) or 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC); the catalyst is an organic base, preferably triethylamine (TEA), 4-dimethylaminopyridine (DMAP), or diisopropylethylamine (DIPEA). In some embodiments of the present invention, phosphatidic acid is preferably 06:0 PA, the activator is preferably EDC and imidazole, and the catalyst is preferably TEA; phosphatidylserine is preferably 08:0 PS, the activator is preferably EDC, and the catalyst is preferably DMAP.

[0052] Step S02: The lipid conjugate obtained in step S01 is mixed with dialkylimidazolium biomimetic lipids, natural phospholipids, cholesterol, and a therapeutic drug in a certain proportion to prepare lipid nanoparticles in which the therapeutic drug is loaded. The natural phospholipid is one or more of dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), and distearate phosphatidylcholine (DSPC); the molar ratio of the lipid conjugate, dialkylimidazolium biomimetic lipids, natural phospholipids, and cholesterol is (40~75):(50~75):(10~40):(20~35). In some embodiments of the present invention, the natural phospholipid is preferably DPPC or DSPC, and the molar ratio of the lipid conjugate, dialkylimidazolium biomimetic lipids, natural phospholipids, and cholesterol is 45:55:15:30.

[0053] Step S03: The lipid nanoparticles obtained in step S02 are sterilized by passing them through a filter membrane with uniform pore size. The preferred pore size of the sterilization filter membrane is 0.22 μm, resulting in enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles, such as... Figure 1 As shown.

[0054] Dialkyl imidazolium biomimetic lipids (BDILs) are designed to mimic the structure of natural phospholipids. They feature a hydrophilic head consisting of a 2-amino-substituted imidazolium ring and a hydrophobic tail consisting of two flexible lipid chains, classifying them as highly biomimetic ionizable cationic lipids. Therefore, lipid nanoparticles formed by the self-assembly of BDILs with phospholipids and cholesterol exhibit excellent biocompatibility with the lipid bilayer of biological membranes, showing no significant cytotoxicity or hemolysis, thus demonstrating ideal biocompatibility.

[0055] Furthermore, the primary amino group of the hydrophilic head of BDILs can couple with the phosphate group of phosphatidic acid via a phosphoramide bond, or with the carboxyl group of phosphatidylserine via an amide bond, forming binary lipid conjugates (BLCs). C6~C 10 Short-chain phosphatidic acid or phosphatidylserine has good water solubility due to its limited hydrophobic tail. The phosphoramide or amide bonds in the lipid conjugate, upon enzymatic hydrolysis, release phosphatidic acid or phosphatidylserine, both of which are soluble in aqueous solution. Furthermore, because the chain lengths of the phosphatidic acid or phosphatidylserine fragments in the lipid conjugate differ significantly from those of the BDILs fragments (C5~C6),... 12 Therefore, BDIL-based lipid conjugates exhibit an inverted conical shape, readily forming stable lipid nanoparticles with other lipid excipients. The average curvature of these particles primarily depends on the difference in lipid chain length between the two segments of the BDIL. A greater difference in chain length facilitates the formation of lipid nanoparticles with a smaller average radius of curvature, while a smaller difference results in lipid nanoparticles with a larger average radius of curvature. Thus, BDIL-based lipid conjugates can be used to design enzyme-responsive drug delivery systems that load different types of drugs.

[0056] Furthermore, the primary amino group at the 2-position of the imidazole ring in BDILs can mediate the temporary opening of the blood-brain barrier (BBB) ​​through interaction with tight junction proteins. Therefore, lipid nanoparticles composed of BDILs, lipid conjugates, natural phospholipids, and cholesterol can cross the BBB and can be used to improve the BBB permeability and brain tissue distribution of different types of drugs. In the plasma environment, the lipid nanoparticles composed of BDILs exhibit good plasma stability due to the presence of lipid conjugates. Upon entering the brain, due to the high permeability and retention effect (EPR effect) of the BBB-glioma tissue, the lipid nanoparticles composed of BDILs are taken up in large quantities by glioma cells and enter the tumor microenvironment. At this point, the lipid conjugates are hydrolyzed by various enzyme systems highly expressed in endosomes and lysosomes. The resulting short-chain phosphatidic acid or phosphatidylserine, due to their water solubility, detaches from the lipid bilayer, thereby disrupting the integrity of the lipid nanoparticles, leading to particle disintegration and drug release. The BDILs generated simultaneously by enzymatic hydrolysis further increase the BDIL content in the lipid nanoparticles. In endosome (pH 5.0–6.5) and lysosomal (pH 4.5–5.0) environments, BDILs are protonated into divalent cationic lipids, triggering a "proton sponge effect" to release the encapsulated drug. This enzyme-acid cascade response mechanism in the tumor microenvironment synergistically enhances drug release. Therefore, drug-loaded lipid nanoparticles composed of BDILs can not only effectively cross the blood-brain barrier, improving the brain-targeted delivery efficiency of the loaded drug, but also achieve sustained drug release through the enzyme-acid cascade response in the tumor microenvironment, effectively killing glioma cells. The brain-targeted delivery efficiency of the enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles based on dialkyl imidazole biomimetic lipids in this invention is significantly superior to that of representative ionizable cationic lipid LNPs delivery systems such as Dlin-MC3-DMA.

[0057] The present invention will now be described with reference to the accompanying drawings. Experimental methods not specifically described in the accompanying drawings are performed according to the corresponding product instructions. Unless otherwise specified, the instruments, reagents, and consumables used in the embodiments can be purchased from commercial companies. It should be noted that, unless otherwise defined, the technical or scientific terms used in this invention should have the ordinary meaning understood by those skilled in the art.

[0058] The structural features and preparation method of the dialkyl imidazolium biomimetic lipid involved in this invention are disclosed in patent CN120757505B.

[0059] Example 1: Preparation of a small molecule enzyme-responsive brain-targeting sustained-release formulation based on dialkyl imidazolium biomimetic lipids

[0060] This embodiment uses paclitaxel (PTX, CAS: 33069-62-4), a small molecule natural product, as the main drug, and utilizes a dialkyl imidazole biomimetic lipid A4Z. 2 15-JI (A0), A4Z ij 2 15-JCl(A1), A5Z 2 15-JI (A10), A4Z 2 18-JI (A18) and A5Z 2 18-JI (A19) and short-chain phosphatidic acid are coupled to form a lipid conjugate. Then, dialkylimidazolium biomimetic lipids and their lipid conjugates are self-assembled with natural phospholipids and cholesterol (Chol.) to form enzyme-responsive brain-targeted sustained-release lipid nanoparticles loaded with PTX. Finally, together with other excipients, they form a PTX enzyme-responsive brain-targeted sustained-release formulation.

[0061] First, select the dialkyl imidazole biomimetic lipid A4Z. 2 15-JI (A0), natural phospholipid DPPC, and cholesterol (Chol.) are the three components constituting lipid nanoparticles. The specific preparation method of PTX-loaded enzyme-responsive brain-targeted sustained-release lipid nanoparticles is as follows:

[0062] Dihexanoyl phosphatidyl acid (PA) and activator 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC) are mixed at a molar ratio of 1:50, and then immediately added to a solution containing A4Z. 2 A chloroform solution of 15-JI (A0), activator imidazole and catalyst triethylamine (TEA) (PA / EDC / imidazole / TEA / A0 molar ratio of 1:50:5:0.1:6.25) was mixed evenly at room temperature and reacted for 35 min. After separation and purification, the lipid conjugate A0-PA of A0 and PA was obtained.

[0063] Prepare four lipid raw materials—A0-PA, A0, DPPC, and Chol—at an accurate molar ratio of 45:55:15:30 and dissolve them in chloroform, denoted as the lipid organic phase. Dissolve PTX in a mixed solution of chloroform and methanol (1:1, v / v), denoted as the drug organic phase. Mix the lipid organic phase and the drug organic phase at a molar ratio of total lipids to PTX of 3.5:1, and after thorough dissolution, obtain a mixed organic phase. After removing the organic solvent from the mixed organic phase by nitrogen blowing or rotary evaporation at 50°C, a semi-transparent mixed lipid film can be formed on the inner wall of the container. Then, add an equal volume of PBS buffer preheated to 45°C to the container, incubate at 45°C for 5 min, and vortex for 1 min to fully hydrate the lipid film. Repeat the above hydration process 5 times to obtain a turbid mixed lipid colloidal solution. After sonication for 30 min, repeatedly extrude the mixed lipid colloidal solution through a 100 nm pore size PC filter membrane 30-40 times to obtain a relatively clear aqueous solution of lipid nanoparticles. The mixture was then transferred to a gravity centrifuge tube packed with CORE400 packing material and centrifuged at 1000 g for 3 min at 25°C to remove residual PTX and free lipids, yielding PTX-loaded lipid nanoparticles. Finally, the nanoparticles were sterilized using a 0.22 μm filter membrane to obtain PTX@A0-PA / A0 / DPPC / Chol., an enzyme-responsive, brain-targeted sustained-release drug-loaded lipid nanoparticle. These nanoparticles can be further formulated with pharmaceutically acceptable excipients to create a PTX enzyme-responsive, brain-targeted sustained-release formulation containing PTX@A0-PA / A0 / DPPC / Chol.

[0064] A4Z 2 Replace 15-JI (A0) with A4Z respectively. ij 2 15-JCl(A1), A5Z 2 15-JI (A10), A4Z 2 18-JI (A18) and A5Z 2 By using 18-JI (A19) and keeping other conditions unchanged, PTX-loaded lipid nanoparticles PTX@A1-PA / A1 / DPPC / Chol., PTX@A10-PA / A10 / DPPC / Chol., PTX@A18-PA / A18 / DPPC / Chol., and PTX@A19-PA / A19 / DPPC / Chol., as well as PTX enzyme-responsive brain-targeted sustained-release formulations containing the above lipid nanoparticles, can be obtained.

[0065] Comparative Example 1:

[0066] A4Z in Example 1 215-JI was replaced with the cationic lipid compound Dlin-MC3-DMA (MC3). MC3, DPPC, and Chol were prepared in an accurate molar ratio of 100:15:30 and dissolved in chloroform, which was denoted as the lipid organic phase. Under the same conditions, lipid nanoparticles PTX@MC3 / DPPC / Chol loaded with PTX could be obtained by thin-film hydration.

[0067] Example 2: Preparation of a peptide-based enzyme-responsive brain-targeting sustained-release formulation based on dialkyl imidazolium biomimetic lipids

[0068] This embodiment uses the polypeptide drug chloramphenicol (TM-601, CAS: 163515-35-3) as the main drug, and utilizes the dialkyl imidazole biomimetic lipid A4Z. 2 15-JI (A0), A4Z ij 2 15-JCl(A1), A5Z 2 15-JI (A10), A4Z 2 18-JI (A18) and A5Z 2 18-JI (A19) and short-chain phosphatidylserine are coupled to form a lipid conjugate. Then, dialkylimidazolium biomimetic lipids and their lipid conjugates are self-assembled with natural phospholipids and cholesterol (Chol.) to form enzyme-responsive brain-targeting sustained-release lipid nanoparticles loaded with TM-601. Finally, together with other excipients, they form the TM-601 enzyme-responsive brain-targeting sustained-release formulation.

[0069] First, select the dialkyl imidazole biomimetic lipid A4Z. 2 15-JI (A0), natural phospholipid DSPC, and cholesterol (Chol.) are the three components constituting lipid nanoparticles. The specific preparation method of enzyme-responsive brain-targeted sustained-release lipid nanoparticles loaded with TM-601 is as follows:

[0070] Dioctanoylphosphatidylserine (PS) was fully dissolved in a solution containing A4Z with activator 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC) and catalyst 4-dimethylaminopyridine (DMAP). 2 A chloroform solution of 15-JI (A0) (PS / EDC / DMAP / A0 molar ratio of 1:1.2:0.1:1.5) was reacted at 35℃ for 4-6 h, and the lipid conjugate A0-PS was obtained after separation and purification.

[0071] Four lipid raw materials, A0-PS, A0, DSPC, and Chol, were simultaneously dissolved in anhydrous ethanol at a precise molar ratio of 45:55:15:30 to form the lipid organic phase. TM-601 was dissolved in citrate buffer (pH 4.0) at a total lipid to TM-601 mass ratio of 1:1 to form the drug aqueous phase. At room temperature, the lipid organic phase and drug aqueous phase were rapidly mixed using an automated high-throughput microfluidic system at a flow rate ratio of 1:3 and a volume ratio of 1:3 through a microfluidic chip at a mixing rate of 10–15 mL / min to prepare drug-loaded lipid nanoparticles. The mixture was then ultrafiltered using an ultrafiltration tube to obtain lipid nanoparticles loaded with TM-601. Finally, sterilization was performed using a 0.22 μm filter membrane to obtain enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles TM-601@A0-PS / A0 / DSPC / Chol. loaded with TM-601. These nanoparticles can be further formulated with pharmaceutically acceptable excipients to create TM-601 enzyme-responsive brain-targeted sustained-release formulations containing TM-601@A0-PS / A0 / DSPC / Chol.

[0072] A4Z 2 Replace 15-JI (A0) with A4Z respectively. ij 2 15-JCl(A1), A5Z 2 15-JI (A10), A4Z 2 18-JI (A18) and A5Z 2 By using 18-JI (A19) and keeping other conditions unchanged, lipid nanoparticles loaded with TM-601, namely TM-601@A1-PS / A1 / DSPC / Chol., TM-601@A10-PS / A10 / DSPC / Chol., TM-601@A18-PS / A18 / DSPC / Chol., and TM-601@A19-PS / A19 / DSPC / Chol., as well as an enzyme-responsive brain-targeted sustained-release formulation containing the above lipid nanoparticles, can be obtained.

[0073] Comparative Example 2:

[0074] A4Z in Example 2 2 15-JI was replaced with the cationic lipid compound Dlin-MC3-DMA (MC3). MC3, DSPC, and Chol were prepared in an accurate molar ratio of 100:15:30 and dissolved in anhydrous ethanol, which was denoted as the lipid organic phase. Under the same conditions, lipid nanoparticles TM-601@MC3 / DSPC / Chol. loaded with TM-601 could be obtained through a microfluidic system.

[0075] Example 3: Preparation of a small nuclease-responsive brain-targeting sustained-release formulation based on dialkyl imidazole biomimetic lipids

[0076] This embodiment uses the small nucleic acid drug miR-329 (sequence AACACACCUGGUUAACCUCU UU, SEQ ID No. 1) as the main drug, and is administered via a dialkyl imidazole biomimetic lipid A4Z. 2 15-JI (A0), A4Z ij 2 15-JCl(A1), A5Z 2 15-JI (A10), A4Z 2 18-JI (A18) and A5Z 2 18-JI (A19) and short-chain phosphatidylserine are coupled to form a lipid conjugate. Then, dialkyl imidazole biomimetic lipids and their lipid conjugates are self-assembled with natural phospholipids and cholesterol (Chol.) to form enzyme-responsive brain-targeted sustained-release lipid nanoparticles loaded with miR-329. Finally, together with other excipients, they form a miR-329 enzyme-responsive brain-targeted sustained-release formulation.

[0077] First, select the dialkyl imidazole biomimetic lipid A4Z. 2 15-JI (A0), natural phospholipid DSPC, and cholesterol (Chol.) are the three components constituting lipid nanoparticles. The specific preparation method of miR-329-loaded enzyme-responsive brain-targeted sustained-release lipid nanoparticles is as follows:

[0078] Dioctanoylphosphatidylserine (PS) was fully dissolved in a solution containing A4Z with activator 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC) and catalyst 4-dimethylaminopyridine (DMAP). 2 A chloroform solution of 15-JI (A0) (PS / EDC / DMAP / A0 molar ratio of 1:1.2:0.1:1.5) was reacted at 35℃ for 4-6 h, and the lipid conjugate A0-PS was obtained after separation and purification.

[0079] Four lipid raw materials, A0-PS, A0, DSPC, and Chol, were simultaneously dissolved in anhydrous ethanol at a precise molar ratio of 45:55:15:30 to form the lipid organic phase. miR-329 was dissolved in citrate buffer (pH 4.0) at an N / P ratio of 5 to form the drug aqueous phase. At room temperature, the lipid organic phase and drug aqueous phase were rapidly mixed using an automated high-throughput microfluidic system at a flow rate ratio of 1:3 and a volume ratio of 1:3, passing through a microfluidic chip at a mixing rate between 10 and 18 mL / min to prepare drug-loaded lipid nanoparticles. After mixing, ultrafiltration was performed using an ultrafiltration tube to obtain lipid nanoparticles loaded with miR-329. Finally, sterilization was performed using a 0.22 μm filter membrane to obtain enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles miR-329@A0-PS / A0 / DSPC / Chol. loaded with miR-329. These nanoparticles can be further formulated with pharmaceutically acceptable excipients to produce miR-329 enzyme-responsive brain-targeted sustained-release formulations containing miR-329@A0-PS / A0 / DSPC / Chol.

[0080] A4Z 2 Replace 15-JI (A0) with A4Z respectively. ij 2 15-JCl(A1), A5Z 2 15-JI (A10), A4Z 2 18-JI (A18) and A5Z 2 By using 18-JI (A19) and keeping other conditions unchanged, lipid nanoparticles loaded with miR-329, namely miR-329@A1-PS / A1 / DSPC / Chol., miR-329@A10-PS / A10 / DSPC / Chol., miR-329@A18-PS / A18 / DSPC / Chol., and miR-329@A19-PS / A19 / DSPC / Chol., as well as miR-329 enzyme-responsive brain-targeted sustained-release formulations containing the above lipid nanoparticles, can be obtained.

[0081] Comparative Example 3:

[0082] A4Z in Example 3 2 15-JI was replaced with the cationic lipid compound Dlin-MC3-DMA (MC3). MC3, DSPC, and Chol were prepared in an accurate molar ratio of 100:15:30 and dissolved in anhydrous ethanol, denoted as the lipid organic phase. Under the same conditions, lipid nanoparticles miR-329@MC3 / DSPC / Chol loaded with miR-329 were obtained via a microfluidic system.

[0083] Example 4: Encapsulation efficiency characterization of enzyme-responsive brain-targeting sustained-release lipid nanoparticles based on dialkyl imidazole biomimetic lipids

[0084] (1) Encapsulation efficiency of enzyme-responsive brain-targeted sustained-release lipid nanoparticles loaded with PTX

[0085] 1% Triton X-100 was added to the lipid nanoparticles in Examples 1 and 1 Comparative Example, and the mixture was incubated in PBS buffer at 25°C for 10 min to release the PTX encapsulated in the lipid nanoparticles. The PTX content was determined by HPLC, and the encapsulation efficiency of PTX in each group of lipid nanoparticles was calculated. The results are shown in Table 1.

[0086] (2) Encapsulation efficiency of enzyme-responsive brain-targeted sustained-release lipid nanoparticles loaded with TM-601

[0087] 1% Triton X-100 was added to each group of lipid nanoparticles in Example 2 and Comparative Example 2, and the mixture was incubated in PBS buffer at 25°C for 15 min to release TM-601 encapsulated by the lipid nanoparticles. The content of TM-601 was determined by HPLC, and the encapsulation efficiency of TM-601 by each group of lipid nanoparticles was calculated. The results are shown in Table 1.

[0088] (3) Encapsulation efficiency of enzyme-responsive brain-targeted sustained-release lipid nanoparticles loaded with miR-329

[0089] miR-329 was labeled with 5-carboxyfluorescein (5-FAM) and designated as (5-FAM)-miR-329. The content of (5-FAM)-miR-329 was determined by fluorescence spectrophotometry (excitation / emission wavelength: 488 nm / 525 nm), and the encapsulation efficiency of miR-329 by lipid nanoparticles in each group of Example 3 and Comparative Example 3 was calculated. The results are shown in Table 1.

[0090] Table 1

[0091]

[0092] As shown in Table 1, the encapsulation efficiency of PTX by the lipid nanoparticles in Example 1 ranged from 72.6% to 85.5%, with PTX@A0-PA / A0 / DPPC / Chol. exhibiting the highest encapsulation efficiency of 85.5%. In contrast, the encapsulation efficiency of PTX@MC3 / DPPC / Chol. in Comparative Example 1 was only 35.2%.

[0093] In Example 2, the encapsulation efficiency of TM-601 by the lipid nanoparticles ranged from 63.1% to 81.8%, with TM-601@A18-PS / A18 / DSPC / Chol. exhibiting the highest encapsulation efficiency of 81.8%. In contrast, the encapsulation efficiency of TM-601@MC3 / DSPC / Chol. in Comparative Example 2 was only 30.5%.

[0094] The lipid nanoparticles in Example 3 exhibited encapsulation rates of miR-329 ranging from 68.6% to 82.7%, with miR-329@A18-PS / A18 / DSPC / Chol. showing the highest encapsulation rate of 82.7%. In contrast, the miR-329@MC3 / DSPC / Chol. in Comparative Example 3 only achieved an encapsulation rate of 46.6% for miR-329.

[0095] In summary, regardless of the type of active drug loaded, the encapsulation efficiency of enzyme-responsive brain-targeting sustained-release lipid nanoparticles based on dialkyl imidazole biomimetic lipids is significantly better than that of the drug-loaded lipid nanoparticles composed of MC3 in the comparative example. Among them, the small molecule enzyme-responsive brain-targeting sustained-release lipid nanoparticles PTX@A0-PA / A0 / DPPC / Chol., the peptide enzyme-responsive brain-targeting sustained-release lipid nanoparticles TM-601@A18-PS / A18 / DSPC / Chol., and the small nuclease-responsive brain-targeting sustained-release lipid nanoparticles miR-329@A18-PS / A18 / DSPC / Chol. have the highest encapsulation efficiency.

[0096] Example 5: Physicochemical characterization of enzyme-responsive brain-targeting sustained-release lipid nanoparticles based on dialkyl imidazolium biomimetic lipids

[0097] Based on the results shown in Table 1 of Example 4, lipid nanoparticles with the highest encapsulation efficiency were screened from Examples 1 to 3, namely PTX@A0-PA / A0 / DPPC / Chol., TM-601@A18-PS / A18 / DSPC / Chol., and miR-329@A18-PS / A18 / DSPC / Chol., and the following physicochemical characterization was performed on these three lipid nanoparticles.

[0098] (1) Morphology

[0099] The morphology of the three types of lipid nanoparticles was characterized using transmission electron microscopy (TEM). Figure 2 As shown, all three lipid nanoparticles exhibit a complete spherical vesicle morphology. Furthermore, the other enzyme-responsive brain-targeting sustained-release lipid nanoparticles based on dialkyl imidazole biomimetic lipids listed in Table 1 also possess relatively complete spherical vesicle morphology, consistent with... Figure 2 resemblance.

[0100] (2) Particle size distribution

[0101] The average particle size of the lipid nanoparticles prepared in Examples 1-3 and Comparative Examples 1-3 was characterized by nanoflow cytometry (NanoFCM), and the characterization results are shown in Table 1.

[0102] In Example 1, the average particle size of the lipid nanoparticles loaded with PTX ranged from 127.2 to 139.4 nm, which was generally smaller than the average particle size of PTX@MC3 / DPPC / Chol. in Comparative Example 1 (183.1 nm). In Example 2, the average particle size of the lipid nanoparticles loaded with TM-601 ranged from 129.8 to 143.5 nm, which was generally smaller than the average particle size of TM-601@MC3 / DSPC / Chol. in Comparative Example 2 (187.9 nm). In Example 3, the average particle size of the lipid nanoparticles loaded with miR-329 ranged from 127.6 to 145.5 nm, which was also generally smaller than the average particle size of miR-329@MC3 / DSPC / Chol. in Comparative Example 3 (174.9 nm).

[0103] Among them, the drug-loaded lipid nanoparticles PTX@A0-PA / A0 / DPPC / Chol., TM-601@A18-PS / A18 / DSPC / Chol., and miR-329@A18-PS / A18 / DSPC / Chol. have average particle sizes of 129.9 nm, 141.3 nm, and 143.1 nm, respectively, and their particle size distributions are as follows: Figure 3 As shown.

[0104] (3) Surface potential

[0105] Meanwhile, the surface potential of the lipid nanoparticles prepared in Examples 1-3 and Comparative Examples 1-3 was characterized using a Zeta potential analyzer (ZetaPALS), and the characterization results are shown in Table 1.

[0106] The median zeta potential of the lipid nanoparticles in Example 1 ranged from 28.4 to 30.2 mV, slightly higher than the median zeta potential of PTX@MC3 / DPPC / Chol. in Comparative Example 1 (25.0 mV); the median zeta potential of the lipid nanoparticles in Example 2 ranged from 21.2 to 26.4 mV, generally slightly higher than the median zeta potential of TM-601@MC3 / DSPC / Chol. in Comparative Example 2 (21.6 mV); the median zeta potential of the lipid nanoparticles in Example 3 ranged from 24.1 to 26.6 mV, generally higher than the median zeta potential of miR-329@MC3 / DSPC / Chol. in Comparative Example 3 (17.1 mV).

[0107] In summary, the enzyme-responsive brain-targeting sustained-release lipid nanoparticles based on dialkylimidazolium biomimetic lipids in Examples 1-3 all exhibited relatively intact spherical vesicle morphology, with average particle sizes generally smaller than the drug-loaded lipid nanoparticles based on Dlin-MC3-DMA (MC3) in Comparative Examples 1-3. Specifically, the median Zeta potential of the small molecule enzyme-responsive brain-targeting sustained-release lipid nanoparticles in Example 1 and the peptide-based enzyme-responsive brain-targeting sustained-release lipid nanoparticles in Example 2 were generally slightly higher than those of the MC3-based drug-loaded lipid nanoparticles in Comparative Examples 1 and 2, respectively. However, the median Zeta potential of the small nuclease-responsive brain-targeting sustained-release lipid nanoparticles in Example 3 was generally higher than that of the MC3-based drug-loaded lipid nanoparticles in Comparative Example 3. The physicochemical properties of Examples 1-3 facilitate crossing the blood-brain barrier and being taken up by glioma cells.

[0108] Example 6: In vitro delivery efficiency of enzyme-responsive brain-targeting sustained-release lipid nanoparticles based on dialkyl imidazole biomimetic lipids

[0109] (1) Fluorescent labeling of enzyme-responsive brain-targeted sustained-release lipid nanoparticles

[0110] Following the preparation method in Example 1, the fluorescent probe (Alexa Fluor 660, AF660) was dissolved in PBS buffer preheated to 45°C to prepare a 50 μM AF660 PBS buffer. Under the same conditions, AF660-labeled PTX@A0-PA / A0 / DPPC / Chol. was prepared, denoted as PTX / AF660@A0-PA / A0 / DPPC / Chol.

[0111] Following the preparation method in Example 3, AF660 was dissolved in the aqueous phase of the drug to prepare a 25 μM citrate buffer (pH 4.0) for AF660. Under the same conditions, AF660-labeled miR-329@A18-PS / A18 / DSPC / Chol. was prepared, denoted as miR-329 / AF660@A18-PS / A18 / DSPC / Chol.

[0112] (2) In vitro delivery efficiency

[0113] An in vitro blood-brain barrier-glioma co-culture model (in vitro blood-brain barrier model) consisting of HCMEC / D3 cells and U-118MG cells was constructed to evaluate the delivery efficiency of two fluorescently labeled drug-loaded lipid nanoparticles, PTX / AF660@A0-PA / A0 / DPPC / Chol. and miR-329 / AF660@A18-PS / A18 / DSPC / Chol., prepared in (1) across the in vitro blood-brain barrier model.

[0114] HCMEC / D3 cells were first cultured in ECM medium containing 5% fetal bovine serum and then seeded at a density of 50,000 cells / well in Transwell chambers. TM Collagen-coated polycarbonate membrane (0.4 µm pore size and 0.33 cm² growth area) in No. 3413 Costar. 2 Replace the medium with fresh ECM medium containing 5% fetal bovine serum and continue culturing for 2-3 days. Then replace the medium with DMEM / F12 serum-free medium containing 550 nM hydrocortisone and continue culturing for two more days at 5% CO2 and 37°C until the HCMEC / D3 cell monolayers fuse to form a barrier model.

[0115] The transmembrane resistance (TEER) of the HCMEC / D3 cell barrier formed above was measured using a CellZscope II real-time cell dynamics analyzer (nanoAnalytic, Germany). The test module and serum-free DMEM / F12 medium containing 550 nM hydrocortisone were preheated at 5% CO2 and 37°C for 1 h. 1.2 mL of DMEM / F12 serum-free medium was added to each metal chamber of the test module. After transferring the transwell chambers to the metal chambers of the test module, the TEER in each transwell chamber was measured at a rate of one chamber / min under 5% CO2 and 37°C. The results showed that the TEER of each chamber was greater than 300 Ω·cm. 2 This indicates that the fused HCMEC / D3 cell monolayer possesses barrier function, and the in vitro blood-brain barrier model has been successfully constructed, which can be used for experiments evaluating the in vitro delivery efficiency of drug-loaded lipid nanoparticles.

[0116] U-118MG cells were cultured in DMEM medium containing 10% fetal bovine serum and seeded at a density of 15,000 cells / well in 24-well plates for 24 h. Transwell chambers containing an in vitro blood-brain barrier model constructed from HCMEC / D3 cells were then transferred to the wells of the 24-well plates. Drug-loaded lipid nanoparticles PTX / AF660@A0-PA / A0 / DPPC / Chol. (100 nmol PTX) were added to each Transwell chamber, and the plates were cultured for another 24 h at 5% CO2 and 37°C. Two parallel experiments were set up, with untreated U-118MG cells as a control. The survival rate of U-118MG cells at 4, 8, 12, 18, and 24 h was calculated using the MTT assay. The results are shown below. Figure 4 As shown in Figure A; another group was characterized by flow cytometry of the fluorescence signal intensity of AF660 in U-118 MG cells at 4, 8, and 12 h, and the results are as follows. Figure 4As shown in B.

[0117] The survival rates of U-118MG cells at 4, 8, 12, 18, and 24 h after adding miR-329 / AF660@A18-PS / A18 / DSPC / Chol. (22 nmol) to each Transwell chamber were calculated using the same method described above. The results are as follows: Figure 5 As shown in Figure A; another group was characterized by flow cytometry of the fluorescence signal intensity of AF660 in U-118 MG cells at 4, 8, and 12 h, and the results are as follows. Figure 5 As shown in B.

[0118] Depend on Figure 4 As shown in Figure A, after adding PTX / AF660@A0-PA / A0 / DPPC / Chol. (100 nmol PTX), the average survival rate of U-118MG cells decreased over time, reaching only 15.2% at 24 h, demonstrating that the drug-loaded lipid nanoparticles PTX / AF660@A0-PA / A0 / DPPC / Chol. can cross the blood-brain barrier to deliver PTX to glioma cells. Figure 4 In sample B, the fluorescence signal intensity of AF660 in U-118MG cells gradually increased over time (AF660 showed no signal after quenching under encapsulation conditions), reaching 205.5, 249.4, and 1597.8 at 4, 8, and 12 h, respectively. This indicates that after PTX / AF660@A0-PA / A0 / DPPC / Chol. crosses the blood-brain barrier and is taken up by U-118MG cells, AF660 is slowly released from PTX / AF660@A0-PA / A0 / DPPC / Chol. (Reference) Figure 4 In A, the mean survival rates of U-118MG cells at 4, 8 and 12 h were 91.9%, 84.5% and 55.9%, respectively, which proves that PTX and AF660 are released simultaneously.

[0119] Depend on Figure 5 As can be seen from A, after adding miR-329 / AF660@A18-PS / A18 / DSPC / Chol. (22 nmol), it is similar to... Figure 4 Similar results were observed in A, with the mean survival rate of U-118MG cells decreasing over time, reaching only 10.5% at 24 h, demonstrating that the drug-loaded lipid nanoparticles miR-329 / AF660@A18-PS / A18 / DSPC / Chol. can cross the blood-brain barrier to deliver the small nucleic acid miR-329 to glioma cells. Figure 5In sample B, the fluorescence signal intensity of AF660 in U-118 MG cells was also found to gradually increase over time, reaching 365.9, 566.4, and 4043.9 at 4, 8, and 12 h, respectively. This indicates that after miR-329 / AF660@A18-PS / A18 / DSPC / Chol. crosses the blood-brain barrier and is taken up by U-118 MG cells, AF660 is slowly released from miR-329 / AF660@A18-PS / A18 / DSPC / Chol. (Reference) Figure 5 In A, the mean survival rates of U-118MG cells at 4, 8 and 12 h were 95.8%, 72.1% and 45.5%, respectively, which proves that miR-329 and AF660 are released simultaneously.

[0120] Example 7: Brain delivery effect of a small molecule enzyme-responsive brain-targeting sustained-release formulation based on dialkyl imidazolium biomimetic lipids in vivo.

[0121] Based on the above results, we further evaluated the brain delivery efficacy of the PTX enzyme-responsive brain-targeted sustained-release formulation containing PTX@A0-PA / A0 / DPPC / Chol. at the in vivo level.

[0122] U-118MG cell suspension (1×10⁻⁶) was implanted into the brains of immunodeficient female nude mice with an average weight of approximately 25 g at 4-8 weeks of age. 6 (cells / mL), after 1-2 weeks of growth, a tumor volume of approximately 100-150 mm was obtained. 3 An immunodeficient mouse model was established. These mice were randomly divided into three groups of three. PTX enzyme-responsive brain-targeted sustained-release formulation containing PTX@A0-PA / A0 / DPPC / Chol. and PTX@MC3 / DPPC / Chol. (Comparative Example 1) were administered via tail vein injection (dose 10 mg / kg for both), with an injection volume of 200 μL. The control group received an equal volume of physiological saline. Brain tissue was harvested at 4, 8, 12, 18, and 24 h post-injection. The free PTX content in brain tissue and the total PTX content in plasma were quantitatively determined by LC-MS / MS at each time point. The brain tissue-to-plasma concentration ratio (B / P) was calculated for each group. The results are shown below. Figure 6 As shown in Figure A. The above experiment was repeated, except that brain tissue from the mice was removed one week after injection, and the tumor weight of each group was compared. The results are shown in Figure A. Figure 6 As shown in B.

[0123] Depend on Figure 6As shown in Figure A, after tail vein injection of a brain-targeting formulation containing PTX@A0-PA / A0 / DPPC / Chol. into a mouse model, the average B / P ratios at 4, 8, 12, 18, and 24 h were approximately 0.50, 1.22, 1.69, 1.81, and 1.88, respectively. In contrast, after tail vein injection of PTX@MC3 / DPPC / Chol. in Comparative Example 1, the average B / P ratios at each time point were approximately 0.05, 0.08, 0.12, 0.15, and 0.15, respectively, all below 1.0 and significantly lower than that of PTX@A0-PA / A0 / DPPC / Chol. This indicates that the PTX enzyme-responsive brain-targeting sustained-release formulation containing PTX@A0-PA / A0 / DPPC / Chol. can cross the blood-brain barrier, significantly improving the blood-brain barrier permeability of PTX and the brain tissue distribution in the mouse model, with a brain-targeting delivery effect far superior to Comparative Example 1. The first occurrence of a mean B / P ratio greater than 1 (B / P = 1.22) at 8 h indicates the presence of an optimal delivery window across the blood-brain barrier around 8 h. Furthermore, after injection of the brain-targeting agent containing PTX@A0-PA / A0 / DPPC / Chol., the mean B / P ratio increased significantly over time from 4 to 12 h, possibly related to the opening of the optimal delivery window across the blood-brain barrier; the mean B / P ratio continued to increase slowly from 12 to 24 h, referencing... Figure 4 The lipid nanoparticles PTX / AF660@A0-PA / A0 / DPPC / Chol. in component B clearly triggered an enzyme-responsive release mechanism 12 h after delivery, demonstrating that the PTX enzyme-responsive brain-targeted sustained-release formulation containing PTX@A0-PA / A0 / DPPC / Chol. can achieve sustained release of PTX.

[0124] Figure 6 In Case B, one week after tail vein injection of a brain-targeting formulation containing PTX@A0-PA / A0 / DPPC / Chol., the average tumor weight was 0.6 g, while the average tumor weight after injection of PTX@MC3 / DPPC / Chol. in Comparative Example 1 was 2.2 g. Simultaneously, the average tumor weight of the blank group (saline group) one week after injection was 2.1 g. Therefore, at the same PTX dosage, one week after injection of PTX@A0-PA / A0 / DPPC / Chol., the average tumor weight decreased by approximately 71%, while one week after injection of PTX@MC3 / DPPC / Chol. in Comparative Example 1, the average tumor weight did not decrease. This indicates that the PTX enzyme-responsive brain-targeting sustained-release formulation containing drug-loaded lipid nanoparticles PTX@A0-PA / A0 / DPPC / Chol. has a better brain delivery effect than PTX@MC3 / DPPC / Chol. in Comparative Example 1. Figure 6 The results shown in A are consistent.

[0125] Example 8: In vivo brain delivery effect of a polypeptide enzyme-responsive brain-targeting sustained-release formulation based on dialkyl imidazole biomimetic lipids.

[0126] The B / P ratios of the TM-601 enzyme-responsive brain-targeted sustained-release formulation containing TM-601@A18-PS / A18 / DSPC / Chol. and TM-601@MC3 / DSPC / Chol. in Comparative Example 2 were compared at 4, 8, 12, 18, and 24 h post-injection using the experimental method described in Example 7. Figure 7 A) and changes in tumor weight one week after injection ( Figure 7 B).

[0127] U-118MG cell suspension (1×10⁻⁶) was implanted into the brains of immunodeficient female nude mice with an average weight of approximately 25 g at 4-8 weeks of age. 6 (cells / mL), after 1-2 weeks of growth, a tumor volume of approximately 100-150 mm was obtained. 3 An immunodeficient mouse model was established. These mice were randomly divided into three groups of three. The TM-601 enzyme-responsive brain-targeted sustained-release formulation containing TM-601@A18-PS / A18 / DSPC / Chol. and the TM-601@MC3 / DSPC / Chol. formulation from Comparative Example 2 were administered via tail vein injection (dose 5 mg / kg for both), with an injection volume of 200 μL. The control group received an equal volume of physiological saline. Brain tissue was harvested at 4, 8, 12, 18, and 24 h post-injection. The free TM-601 content in brain tissue and the total TM-601 content in plasma were quantitatively determined by LC-MS / MS at each time point. The brain tissue-to-plasma concentration ratio (B / P) was calculated for each group. The results are shown below. Figure 7 As shown in Figure A. The above experiment was repeated, except that brain tissue from the mice was removed one week after injection, and the tumor weight of each group was compared. The results are shown in Figure A. Figure 7 As shown in B.

[0128] Depend on Figure 7 As shown in Figure A, after tail vein injection of a brain-targeting agent containing TM-601@A18-PS / A18 / DSPC / Chol. into a mouse model, the mean B / P ratios at 4, 8, 12, 18, and 24 h were approximately 0.41, 1.04, 1.59, 1.70, and 1.78, respectively. In contrast, after tail vein injection of TM-601@MC3 / DSPC / Chol. in Comparative Example 2, the mean B / P ratios at each time point were approximately 0.01, 0.02, 0.02, 0.05, and 0.12, respectively, all below 1.0 and significantly lower than those of TM-601@A18-PS / A18 / DSPC / Chol. Figure 6The results shown in A are similar, indicating that the TM-601 enzyme-responsive brain-targeted sustained-release formulation containing TM-601@A18-PS / A18 / DSPC / Chol. can cross the blood-brain barrier, significantly improving the blood-brain barrier permeability of TM-601 and the brain tissue distribution in mouse models. The brain-targeted delivery effect is far superior to Comparative Example 2. Specifically, the average B / P ratio was first greater than 1 at 8 h (B / P = 1.04), and the average B / P ratio was 1.59 at 12 h, indicating an optimal delivery window for crossing the blood-brain barrier between 8 and 12 h. Furthermore, after injection of the brain-targeted formulation containing TM-601@A18-PS / A18 / DSPC / Chol., the average B / P ratio increased significantly over time from 4 to 12 h, possibly related to the opening of the optimal delivery window across the blood-brain barrier; the average B / P ratio continued to increase slowly from 12 to 24 h, referencing... Figure 5 miR-329 / AF660@A18-PS / A18 / DSPC / Chol., which has the same type of carrier as B, began to clearly trigger the enzyme response release mechanism 12 h after delivery, demonstrating that the TM-601 enzyme-responsive brain-targeted sustained-release formulation containing TM-601@A18-PS / A18 / DSPC / Chol. can achieve sustained release of TM-601.

[0129] Figure 6 In Case B, one week after tail vein injection of a brain-targeting formulation containing TM-601@A18-PS / A18 / DSPC / Chol., the average tumor weight was 1.2 g, while after injection of TM-601@MC3 / DSPC / Chol. in Comparative Example 2, the average tumor weight was 2.1 g. The average tumor weight of the blank group (saline group) one week after injection was also measured to be 2.1 g. Therefore, at the same TM-601 dosage, one week after injection of TM-601@A18-PS / A18 / DSPC / Chol., the average tumor weight decreased by approximately 43%, while one week after injection of TM-601@MC3 / DSPC / Chol. in Comparative Example 2, the average tumor weight did not decrease. This indicates that the TM-601 enzyme-responsive brain-targeting sustained-release formulation containing TM-601@A18-PS / A18 / DSPC / Chol. has a better brain delivery effect than TM-601@MC3 / DSPC / Chol. in Comparative Example 2. Figure 7 The results shown in A are consistent.

[0130] Example 9: Brain delivery effect of a small nuclease-responsive brain-targeting sustained-release formulation based on dialkyl imidazole biomimetic lipids in vivo.

[0131] The B / P ratios of the miR-329 enzyme-responsive brain-targeted sustained-release formulation containing miR-329@A18-PS / A18 / DSPC / Chol. and the miR-329@MC3 / DSPC / Chol. in Comparative Example 3 were compared at 4, 8, 12, 18, and 24 hours after injection using the experimental method described in Example 7. Figure 8 A) and changes in tumor weight one week after injection ( Figure 8 B).

[0132] U-118MG cell suspension (1×10⁻⁶) was implanted into the brains of immunodeficient female nude mice with an average weight of approximately 25 g at 4-8 weeks of age. 6 (cells / mL), after 1-2 weeks of growth, a tumor volume of approximately 100-150 mm was obtained. 3 An immunodeficient mouse model was established. These mice were randomly divided into three groups of three. The miR-329 enzyme-responsive brain-targeted sustained-release formulation containing miR-329@A18-PS / A18 / DSPC / Chol. and the miR-329@MC3 / DSPC / Chol. formulation from Comparative Example 3 were administered via tail vein injection (dose 21 nmol for both), with an injection volume of 200 μL. The control group received an equal volume of physiological saline. Brain tissue was harvested at 4, 8, 12, 18, and 24 h post-injection, and total RNA was extracted. The miR-329 content in brain tissue and total miR-329 content in plasma were quantitatively determined using q-PCR at each time point. The brain tissue-to-plasma concentration ratio (B / P) was calculated for each group. The results are shown below. Figure 8 As shown in Figure A. The above experiment was repeated, except that brain tissue from the mice was removed one week after injection, and the tumor weight of each group was compared. The results are shown in Figure A. Figure 8 As shown in B.

[0133] Depend on Figure 8As shown in Figure A, after tail vein injection of a brain-targeting agent containing miR-329@A18-PS / A18 / DSPC / Chol. into a mouse model, the mean B / P ratios at 4, 8, 12, 18, and 24 h were approximately 0.72, 1.36, 1.79, 1.85, and 1.94, respectively. In contrast, after tail vein injection of miR-329@MC3 / DSPC / Chol. in Comparative Example 3, the mean B / P ratios at each time point were approximately 0.04, 0.12, 0.26, 0.33, and 0.39, respectively, all below 1.0 and significantly lower than miR-329@A18-PS / A18 / DSPC / Chol. This indicates that the miR-329 enzyme-responsive brain-targeting sustained-release formulation containing miR-329@A18-PS / A18 / DSPC / Chol. can cross the blood-brain barrier, significantly improving miR-329's blood-brain barrier permeability and brain tissue distribution in mouse models, with a brain-targeting delivery effect far superior to Comparative Example 3. Specifically, the average B / P ratio exceeding 1 (B / P = 1.36) first appeared at 8 h, indicating an optimal delivery window for crossing the blood-brain barrier around 8 h. Furthermore, compared with... Figure 6 Similar to the results shown in A / 7A, after injection of a brain-targeting agent containing miR-329@A18-PS / A18 / DSPC / Chol., the mean B / P ratio increased significantly over time from 4 to 12 hours, possibly related to the optimal opening of the blood-brain barrier delivery window; the mean B / P ratio continued to increase slowly from 12 to 24 hours, as referenced. Figure 5 In sample B, miR-329 / AF660@A18-PS / A18 / DSPC / Chol. clearly triggered the enzyme-responsive release mechanism 12 h after delivery, demonstrating that the miR-329 enzyme-responsive brain-targeted sustained-release formulation containing miR-329@A18-PS / A18 / DSPC / Chol. can achieve sustained release of miR-329.

[0134] Figure 8In B, one week after tail vein injection of a brain-targeting agent containing miR-329@A18-PS / A18 / DSPC / Chol., the average tumor weight was 0.3 g, while after injection of miR-329@MC3 / DSPC / Chol. in Comparative Example 3, the average tumor weight was 1.6 g, and the average tumor weight of the blank group (saline group) one week after injection was 2.1 g. Therefore, at the same miR-329 dosage, one week after injection of miR-329@A18-PS / A18 / DSPC / Chol., the average tumor weight decreased by approximately 86%, while one week after injection of miR-329@MC3 / DSPC / Chol. in Comparative Example 3, the average tumor weight decreased by approximately 24%. This indicates that the brain delivery effect of the miR-329 enzyme-responsive brain-targeted sustained-release formulation containing miR-329@A18-PS / A18 / DSPC / Chol. is superior to that of miR-329@MC3 / DSPC / Chol. in Comparative Example 3. Figure 8 The results shown in A are consistent.

[0135] In summary, the enzyme-responsive brain-targeting sustained-release formulations based on dialkyl imidazole biomimetic lipids, including PTX@A0-PA / A0 / DPPC / Chol., TM-601@A18-PS / A18 / DSPC / Chol., and miR-329@A18-PS / A18 / DSPC / Chol., can effectively cross the blood-brain barrier, enhance the brain tissue distribution of small molecule drugs, peptide drugs, and small nucleic acid drugs, and achieve sustained release of the loaded drugs in the glioma microenvironment via an enzyme-responsive mechanism. They significantly inhibit glioma growth, and the in vivo brain delivery effect is far superior to the drug-loaded lipid nanoparticles based on the ionizable cationic lipid Dlin-MC3-DMA in the comparative example.

[0136] The embodiments of the present invention have been described in detail above, but the content described is only a preferred embodiment of the present invention and should not be considered as limiting the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the patent coverage of the present invention.

Claims

1. An enzyme-responsive, brain-targeted, sustained-release drug-loaded lipid nanoparticle based on dialkyl imidazole biomimetic lipids, characterized in that: It contains dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugates, dialkylimidazolium biomimetic lipids, natural phospholipids, cholesterol, and therapeutic drugs; the molar ratio of the dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugates to the dialkylimidazolium biomimetic lipids, natural phospholipids, and cholesterol is 40~75:50~75:10~40:20~35; The phospholipid in the dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugate is phosphatidic acid or phosphatidylserine; the phosphatidic acid is dihexanoylphosphatidic acid, diheptanoylphosphatidic acid, or didecanoylphosphatidic acid; the phosphatidylserine is dihexanoylphosphatidylserine, diheptanoylphosphatidylserine, or didecanoylphosphatidylserine; the natural phospholipid is one or more of distearylphosphatidylcholine, dipalmitoylphosphatidylcholine, and dimyristoylphosphatidylcholine; the therapeutic drug is a small nucleic acid drug, a polypeptide drug, or a small molecule drug. The structure of the dialkyl imidazolium biomimetic lipid is shown in general formula 1; General Formula 1; Where R' and R'' are C 14 ~C 18 Straight-chain alkyl or monoalkenyl, R' and R'' are the same or different groups; n is an integer from 3 to 9; X - It is an anionic group, specifically I - ,Br - Cl - BF4 - or PF6 - .

2. The method for preparing enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles based on dialkyl imidazole biomimetic lipids as described in claim 1, characterized in that: Includes the following steps: Step S01: Dissolve dialkylimidazolium biomimetic lipids and phospholipids in an organic solvent, add a coupling agent, and form a dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugate; Step S02: The dialkylimidazolium biomimetic lipid-phospholipid binary lipid conjugate obtained in step S01 is mixed with dialkylimidazolium biomimetic lipid, natural phospholipid, cholesterol and therapeutic drug to prepare lipid nanoparticles in which the therapeutic drug is loaded. Step S03: The lipid nanoparticles obtained in step S02 are sterilized by passing them through a filter membrane to obtain enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles.

3. The method for preparing enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles based on dialkyl imidazole biomimetic lipids according to claim 2, characterized in that: In step S01, the coupling aid includes an activator and a catalyst; the activator is carbodiimide and / or imidazole; the catalyst is an organic base.

4. An enzyme-responsive brain-targeted sustained-release formulation comprising the enzyme-responsive brain-targeted sustained-release drug-loaded lipid nanoparticles based on dialkylimidazolium biomimetic lipids as described in claim 1.

5. The application of the products prepared by the preparation method of the enzyme-responsive brain-targeting sustained-release drug-loaded lipid nanoparticles based on dialkylimidazolium biomimetic lipids according to claim 1, the enzyme-responsive brain-targeting sustained-release formulation according to claim 4, and the enzyme-responsive brain-targeting sustained-release drug-loaded lipid nanoparticles based on dialkylimidazolium biomimetic lipids according to claim 2 or 3 in the preparation of drugs for treating glioma.

Images