SiRNA of targeted bone morphogenetic protein 2, modified siRNA and application of siRNA

Abstract

The invention discloses siRNA (small interfering Ribonucleic Acid) of targeted bone morphogenetic protein 2, modified siRNA and application of the siRNA. According to the invention, siRNA drug design is carried out by taking the BMP2 gene as a target gene to obtain a series of siRNAs, siRNAs capable of effectively silencing the mRNA expression level of the BMP2 gene are screened from the siRNAs, and part of siRNA sequences can even silence the mRNA level of the BMP2 gene to about 25%. The siRNA sequence is further modified, wherein phosphorylation or phosphorylation analogue modification, skeleton modification, sugar ring modification and basic group modification are carried out on the 5'terminal of the sequence, or cholesterol molecule modification is carried out on the end group of the siRNA. The siRNA sequence is further subjected to cholesterol modification to obtain a human-mouse homologous sequence of the targeted BMP2 gene, and the in-vivo silencing activity of the BMP2 target spot is further researched in a mouse experimental model subsequently.

Description

Technical Field

[0001] This invention relates to siRNA, and more particularly to siRNA targeting bone morphogenetic protein 2 (BMP2), modified siRNA obtained by modifying the siRNA, and its application in targeting and inhibiting BMP2 gene expression, belonging to the field of siRNA targeting bone morphogenetic protein 2 and its application. Background Technology

[0002] Bone morphogenetic proteins (BMPs) are multifunctional growth factors belonging to the transforming growth factor β (TGF-β) family. Among them, BMP2 was the first BMP to be characterized and thoroughly studied. BMP2 plays an important role in development and osteogenic processes, as well as in the homeostasis of tissues and organs. BMP2 is a major factor in the differentiation of bone marrow mesenchymal stem cells into osteoblasts. It binds to type I and type II serine / threonine kinase receptors on target cells, activating Smad and non-Smad signaling pathways, ultimately activating osteogenic genes such as Runt-associated T transcription factor 2 (RUNX2) and Osterix (Osx) (Halloran D, Durbano HW, Nohe A. Bone Morphogenetic Protein-2 in Development and Bone Homeostasis[J].J DevBiol.2020,8(3):19). In addition, BMP2 plays an important role in inducing and enhancing bone growth and formation, and is widely used in research in fields such as dental treatment, open tibial fractures, and spinal surgery.

[0003] In addition to its role in bone therapy, BMP2 is also widely involved in the regulation of various signaling molecules, including tumor growth, metastasis, and tumor angiogenesis. BMP2 can induce macrophages to differentiate into osteoclasts, accelerate osteolysis, and exacerbate bone metastasis of cancer cells. Bone marrow-derived mesenchymal stem cells are important precursors of tumor stromal cells, and BMP2 participates in the regulation of mesenchymal stem cells. For example, BMP2 signaling can promote bone metastasis in non-small cell lung cancer. In colorectal cancer, BMP2 induces cancer cell metastasis by regulating STAT3-mediated EMT and / or CSC marker expression. Similarly, BMP2 induces the mTORC1 pathway to promote the proliferation and invasion of nasopharyngeal carcinoma cells. Therefore, BMP2 has a strong regulatory role in cancer cell differentiation, proliferation, survival, and apoptosis, and is an effective target for cancer therapy (Li TT, Lai YW, Han X, Niu X, Zhang P X. BMP2 as a promising anticancer approach: functions and molecular mechanisms. Invest New Drugs. 2022, 40(6): 1322-1332).

[0004] BMP signaling also plays a crucial role in hair follicle morphogenesis and the regulation of hair follicle activity cycles. Hair follicle homeostasis and cyclical regeneration are regulated by balancing the quiescence and activation of hair follicle stem cells (HFSCs). The hair growth cycle consists of three phases: anagen (growth phase), catagen (transitional phase), and telogen (resting phase). During the anagen phase, hair follicles continuously grow hair; during the catagen phase, hair growth ceases and the lower part of the follicle shrinks; during the telogen phase, the hair rests for a period before eventually falling out, thus entering the next cycle. Under normal circumstances, most hair follicles are in the anagen phase. However, in pathological alopecia, the hair follicle cycle changes, resulting in contraction, a shortened anagen phase, and a prolonged telogen phase. Therefore, activating hair follicle stem cells to initiate a new hair growth cycle, allowing telogen follicles to re-enter the anagen phase and return to normal, is key to promoting hair regeneration. Studies have shown that BMP2 expression levels are low in hair follicles during the early anagen phase, gradually increasing and reaching a peak in the late anagen phase, which is maintained until the early telogen phase. However, when the hair follicle cycle enters the late resting phase, the expression level of BMP2 decreases again (Plikus MV, Mayer JA, de la Cruz D, et al. Cyclic dermal BMP signalling regulates stem cell activation during hair regeneration[J]. Nature. 2008, 451(7176):340-344). Furthermore, the upregulation of the BMP antagonist Noggin can promote the hair follicle to enter the anagen phase. Some studies have used drugs to upregulate Noggin, mask the activity of BMP4, and promote hair growth (Meephansan J, Pongcharoensuk T, Thummakriengkrai J, et al. Effect of tofacitinib on the expression of noggin / BMP-4 and hair growth stimulation in mice[J]. ArchDermatol Res. 2018, 310(10):843-848). Therefore, targeting and inhibiting BMP2 expression can effectively reduce the inhibitory effect of BMP2 on hair follicle growth and activate hair follicles, serving as a potential target for treating hair loss. Currently, there are only two drugs worldwide that are definitively effective for androgenetic alopecia with acceptable side effects (finasteride and minoxidil). However, both drugs also have problems such as numerous side effects, low efficacy, and easy inactivation. Finasteride is a 5α-reductase inhibitor with a high affinity for 5α-reductase, preventing 5α-reductase from converting free testosterone into dihydrotestosterone, thereby treating hair loss.However, a series of serious adverse side effects may occur and persist during and / or after finasteride treatment, such as persistent or irreversible sexual, neurological, physical, and psychological side effects, known as finasteride post-treatment syndrome. Minoxidil mainly exerts its hair-growth effect through pathways such as vasodilator, anti-inflammatory agent, Wnt / β-catenin signaling pathway inducer, and anti-androgen. However, oral minoxidil may cause hirsutism, orthostatic hypotension, and edema, while topical application of minoxidil may cause side effects such as scalp itching and hirsutism.

[0005] siRNA is a double-stranded RNA approximately 21-25 bp in length, typically composed of a 19+2mer structure. It achieves specific degradation of target mRNA through RNA interference (RNAi). Guided by the guide strand, the antisense strand binds efficiently and specifically to the target mRNA, causing it to break and thus downregulating the expression of the target gene. Screening for effective siRNAs targeting BMP2 can reduce BMP2 expression levels, thereby effectively treating various diseases caused by excessive BMP2 expression. Summary of the Invention

[0006] One of the objectives of this invention is to provide siRNA that targets bone morphogenetic protein 2 (BMP2).

[0007] A second objective of this invention is to provide a modified siRNA obtained by modifying the siRNA that targets bone morphogenetic protein 2 (BMP2).

[0008] A third objective of this invention is to provide a recombinant expression vector containing siRNA or modified siRNA that targets bone morphogenetic protein 2.

[0009] A fourth objective of this invention is to provide a host cell containing the recombinant expression vector.

[0010] The fifth objective of this invention is to apply the siRNA targeting bone morphogenetic protein 2, modified siRNA, or recombinant expression vector containing the siRNA or modified siRNA to target and inhibit the expression of the BMP2 gene or to prepare nucleic acid drugs for treating various diseases caused by excessive expression of bone morphogenetic protein 2.

[0011] To achieve the above objectives, the technical solution adopted by the present invention includes:

[0012] One aspect of the present invention provides a siRNA targeting bone morphogenetic protein 2 (BMP2), said siRNA being a double-stranded RNA consisting of a sense strand and an antisense strand complementary to said sense strand, said siRNA being selected from any of the following double-stranded RNAs (1)-(40):

[0013] (1) A double-stranded RNA consisting of a sense strand with the nucleotide sequence shown in SEQ ID No. 1 and an antisense strand with the nucleotide sequence shown in SEQ ID No. 2; (2) A double-stranded RNA consisting of a sense strand with the nucleotide sequence shown in SEQ ID No. 3 and an antisense strand with the nucleotide sequence shown in SEQ ID No. 4; (3) A double-stranded RNA consisting of a sense strand with the nucleotide sequence shown in SEQ ID No. 5 and an antisense strand with the nucleotide sequence shown in SEQ ID No. 6;

[0014] (4) A double-stranded RNA consisting of the positive strand of SEQ ID No. 7 and the antisense strand of SEQ ID No. 8; (5) A double-stranded RNA consisting of the positive strand of SEQ ID No. 9 and the antisense strand of SEQ ID No. 10; (6) A double-stranded RNA consisting of the positive strand of SEQ ID No. 11 and the antisense strand of SEQ ID No. 12; (7) A double-stranded RNA consisting of the positive strand of SEQ ID No. 13 and the antisense strand of SEQ ID No. 14; (8) A double-stranded RNA consisting of the positive strand of SEQ ID No. 15 and the antisense strand of SEQ ID No. 16; (9) A double-stranded RNA consisting of the positive strand of SEQ ID No. 17 and the antisense strand of SEQ ID No. 18; (10) A double-stranded RNA consisting of the positive strand of SEQ ID No. 19 and the antisense strand of SEQ ID No. 14. (11) A double-stranded RNA composed of the positive strand of SEQ ID No. 21 and the negative strand of SEQ ID No. 22; (12) A double-stranded RNA composed of the positive strand of SEQ ID No. 23 and the negative strand of SEQ ID No. 24; (13) A double-stranded RNA composed of the positive strand of SEQ ID No. 25 and the negative strand of SEQ ID No. 26; (14) A double-stranded RNA composed of the positive strand of SEQ ID No. 27 and the negative strand of SEQ ID No. 28; (15) A double-stranded RNA composed of the positive strand of SEQ ID No. 29 and the negative strand of SEQ ID No. 30; (16) A double-stranded RNA composed of the positive strand of SEQ ID No. 31 and the negative strand of SEQ ID No. 32; (17) A double-stranded RNA composed of the positive strand of SEQ ID No. 20 and the negative strand of SEQ ID No. 30; (18) A double-stranded RNA consisting of the positive strand and the antisense strand shown in SEQ ID No. 33; (19) A double-stranded RNA consisting of the positive strand and the antisense strand shown in SEQ ID No. 34; (10) A double-stranded RNA consisting of the positive strand and the antisense strand shown in SEQ ID No. 35; (11) A double-stranded RNA consisting of the positive strand and the antisense strand shown in SEQ ID No. 37.(20) A double-stranded RNA composed of the positive strand of SEQ ID No. 39 and the negative strand of SEQ ID No. 40; (21) A double-stranded RNA composed of the positive strand of SEQ ID No. 41 and the negative strand of SEQ ID No. 42; (22) A double-stranded RNA composed of the positive strand of SEQ ID No. 43 and the negative strand of SEQ ID No. 44; (23) A double-stranded RNA composed of the positive strand of SEQ ID No. 45 and the negative strand of SEQ ID No. 46; (24) A double-stranded RNA composed of the positive strand of SEQ ID No. 47 and the negative strand of SEQ ID No. 48; (25) A double-stranded RNA composed of the positive strand of SEQ ID No. 49 and the negative strand of SEQ ID No. 50; (26) A double-stranded RNA composed of the positive strand of SEQ ID No. 49 and the negative strand of SEQ ID No. 50; (27) A double-stranded RNA consisting of the positive strand and the antisense strand shown in SEQ ID No. 51; (28) A double-stranded RNA consisting of the positive strand and the antisense strand shown in SEQ ID No. 54; (29) A double-stranded RNA consisting of the positive strand and the antisense strand shown in SEQ ID No. 57; (20) A double-stranded RNA consisting of the positive strand and the antisense strand shown in SEQ ID No. 60; (31) A double-stranded RNA consisting of the positive strand and the antisense strand shown in SEQ ID No. 62; (32) A double-stranded RNA consisting of the positive strand and the antisense strand shown in SEQ ID No. 63. (33) A double-stranded RNA consisting of the sense strand with nucleotide sequence SEQ ID No. 65 and the antisense strand with nucleotide sequence SEQ ID No. 66; (34) A double-stranded RNA consisting of the sense strand with nucleotide sequence SEQ ID No. 67 and the antisense strand with nucleotide sequence SEQ ID No. 68; (35) A double-stranded RNA consisting of the sense strand with nucleotide sequence SEQ ID No. 69 and the antisense strand with nucleotide sequence SEQ ID No. 68.(70) A double-stranded RNA composed of the antisense strand shown in SEQ ID No. 71; (36) A double-stranded RNA composed of the sense strand with the nucleotide sequence shown in SEQ ID No. 71 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 72; (37) A double-stranded RNA composed of the sense strand with the nucleotide sequence shown in SEQ ID No. 73 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 74; (38) A double-stranded RNA composed of the sense strand with the nucleotide sequence shown in SEQ ID No. 75 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 76; (39) A double-stranded RNA composed of the sense strand with the nucleotide sequence shown in SEQ ID No. 77 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 78; (40) A double-stranded RNA composed of the sense strand with the nucleotide sequence shown in SEQ ID No. 79 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 80.

[0015] This invention, through screening the designed BMP2 siRNA sequences, found that siRNAs near regions 1113-1147, 743, 389, and 884-905 of the BMP2 gene coding region mRNA achieved good gene silencing effects. Ultimately, the following seven siRNA sequences were found to silence BMP2 mRNA levels to below 30%:

[0016] (1) BMP2-2: A double-stranded RNA consisting of the positive strand of SEQ ID No. 3 and the antisense strand of SEQ ID No. 4; (2) BMP2-5: A double-stranded RNA consisting of the positive strand of SEQ ID No. 9 and the antisense strand of SEQ ID No. 10; (3) BMP2-9: A double-stranded RNA consisting of the positive strand of SEQ ID No. 17 and the antisense strand of SEQ ID No. 18; (4) BMP2-11: A double-stranded RNA consisting of the positive strand of SEQ ID No. 21 and the antisense strand of SEQ ID No. 22; (5) BMP2-13: A double-stranded RNA consisting of the positive strand of SEQ ID No. 25 and the antisense strand of SEQ ID No. 26; (6) BMP2-26: A double-stranded RNA consisting of the positive strand of SEQ ID No. 51 and the antisense strand of SEQ ID No. 10. (7) BMP2-30: A double-stranded RNA consisting of the sense strand with nucleotide sequence SEQ ID No. 59 and the antisense strand with nucleotide sequence SEQ ID No. 60.

[0017] Most preferably, the following siRNA sequence can silence BMP2 mRNA levels to approximately 25%:

[0018] (1) BMP2-2: a double-stranded RNA consisting of the sense strand with nucleotide sequence SEQ ID No. 3 and the antisense strand with nucleotide sequence SEQ ID No. 4; (2) BMP2-5: a double-stranded RNA consisting of the sense strand with nucleotide sequence SEQ ID No. 9 and the antisense strand with nucleotide sequence SEQ ID No. 10; (3) BMP2-13: a double-stranded RNA consisting of the sense strand with nucleotide sequence SEQ ID No. 25 and the antisense strand with nucleotide sequence SEQ ID No. 26.

[0019] A second aspect of the present invention is to chemically modify the siRNA to obtain modified siRNA; in order to improve the chain selectivity and target gene silencing effect of siRNA, improve the stability of siRNA in vivo, or improve the uptake effect of siRNA by cells, the present invention provides modified siRNA obtained by chemically modifying the siRNA.

[0020] For reference, those skilled in the art can, as needed, use the following modification methods to phosphorylate or modify the 5′ end of the antisense strand of siRNA with phosphorylation or phosphorylation analogs to improve the strand selectivity of siRNA to the target gene and the target gene silencing effect:

[0021]

[0022] To improve the stability of siRNA in vivo, those skilled in the art can modify the siRNA as needed, including but not limited to the following types of modifications: modifying both ends of the sense and antisense RNA strands of the siRNA with several thiophosphates, or combining these modifications to change the nucleoside backbone to thiophosphate ester bonds, borane phosphate ester bonds, or methyl phosphate ester bonds, etc. Such modifications can enhance the stability of siRNA and reduce exonuclease degradation of siRNA; or modifying the 2′-OH of the siRNA, for example, by replacing the 2′-OH with methoxy, methylethoxy, or fluorine and / or by deoxygenating the 2′-OH; or modifying the siRNA to a peptide nucleic acid (PNA), locked nucleic acid (LNA), or unlocked nucleic acid (UNA) type; or modifying and substituting the 5-methylcytosine, 6-methyladenine, ribavirin, pseudouracil, and / or inosine bases on the nucleotides.

[0023] To improve the uptake of siRNA by cells, those skilled in the art can modify the terminal groups of siRNA with cholesterol molecules (Chol, the structural formula of which is shown below) as needed. This allows the siRNA to penetrate the cell membrane efficiently without the aid of a delivery medium, thereby increasing the efficiency of siRNA drugs entering cells and enhancing the therapeutic effect.

[0024] Chol:

[0025] In a preferred embodiment of the present invention, the three siRNA sequences capable of silencing BMP2 mRNA to approximately 20% were modified to obtain the modified siRNAs as described below:

[0026] (1) BMP2-2-M:

[0027] Chain of Justice: fG*mA*fAmUfGmAfAmAfAfGfGmUfUmGfUmAfUmUfA*T*T;

[0028] Antonym chain: (Phos)mU*fA*mAfUmAfCmAfAmCmCmUfUmUfUmCfAmUfUmC*T*T;

[0029] (2) BMP2-5-M:

[0030] Chain of Justice: fC*mG*fAmGfAmAfUmGfAfAfAmAfGmGfUmUfGmUfA*T*T;

[0031] Antonym chain: (Phos)mU*fAmCfAmAfCmCfUmUmUmUfCmAfUmUfCmUfCmG*T*T;

[0032] (3) BMP2-13-M:

[0033] Chain of Justice: fG*mG*fUmCfUmUfUmGfCfAfCmCfAmAfGmAfUmGfA*T*T;

[0034] Antonym chain: (Phos)mU*fC*mAfUmCfUmUfGmGmUmGfCmAfAmAfGmAfCmC*T*T;

[0035] Wherein, Phos represents 5′ phosphoric acid modification, m represents 2′-methoxy modification, * represents thiophosphoric acid modification, and f represents 2′-fluoro modification.

[0036] Furthermore, the present invention can also replace the two protruding unpaired bases TT at the 3' end of the sense or antisense strand of the siRNA or modified siRNA sequence with two other nucleoside or deoxynucleoside bases; as a preferred embodiment, the present invention provides a specific example of replacing the two protruding unpaired bases TT at the 3' end of the sense or antisense strand of the modified siRNA sequence (BMP2-13-M) with two other nucleoside or deoxynucleoside bases:

[0037] Chain of Justice: fG*mG*fUmCfUmUfUmGfCfAfCmCfAmAfGmAfUmGfA*mA*mC;

[0038] Antonym chain: (Phos)mU*fC*mAfUmCfUmUfGmGmUmGfCmAfAmAfGmAfCmC*mU*mG;

[0039] Wherein, Phos represents 5′ phosphoric acid modification, m represents 2′-methoxy modification, * represents thiophosphoric acid modification, and f represents 2′-fluoro modification.

[0040] A third aspect of the present invention provides an interference vector or expression vector containing the siRNA; wherein, those skilled in the art can construct the interference vector or expression vector, as well as sdRNA and shRNA based on the corresponding sequences of the siRNA and their recombinant expression vectors, according to conventional preparation methods in the art; preferably, the recombinant expression vector can be a prokaryotic recombinant expression vector or a eukaryotic recombinant expression vector, more preferably, the expression vector is a eukaryotic recombinant expression vector, and particularly preferably, the eukaryotic recombinant expression vector is a recombinant adenovirus expression vector, which can be used as a gene therapy drug to reduce the expression of the target bone morphogenetic protein 2 (BMP2) gene and thereby treat various diseases caused by excessive BMP2 gene expression.

[0041] A fourth aspect of the present invention provides a host cell containing the recombinant expression vector as described above, preferably a prokaryotic cell or a eukaryotic cell, more preferably a eukaryotic cell, and particularly preferably a mammalian cell.

[0042] A fifth aspect of the present invention is to provide a pharmaceutical composition for treating diseases caused by overexpression of the BMP2 gene, said pharmaceutical composition comprising a therapeutically effective amount of siRNA and a pharmaceutically acceptable carrier or excipient.

[0043] For example, the siRNA molecules of this invention can be delivered into cells in their natural structure using methods known in the art. Alternatively, the siRNA molecules of this invention can be expressed intracellularly from a eukaryotic promoter. Recombinant expression vectors capable of expressing siRNA molecules can be delivered and retained in target cells for expression. After expression, the siRNA molecules interact with the target mRNA and produce an RNA interference response. siRNA molecules produced in this manner are commonly referred to as shRNA (short hairpin RNA) because their sense and antisense strands are linked by a small nucleotide loop. Delivery of the vector expressing the siRNA molecules can be systemic, such as by intravenous or intramuscular administration, by administration to target cells explanted from a subject followed by reintroduction into the subject, or by any other means permitted for introduction into the desired target cells; for example, the siRNA molecules can comprise delivery vectors, including liposomes, for administration to a subject. The vector and diluent, and their salts, can be present in the pharmaceutical formulation. Nucleic acid molecules can be delivered to cells by a variety of methods known to those skilled in the art, including but not limited to: encapsulation in liposomes, iontophoresis, or binding to other carriers such as biodegradable polymers, hydrogels, microspheres, biodegradable nanocapsules and bioadhesive microspheres, or via protein carriers. Intracellular delivery components can also be viral components, including but not limited to fusion viral peptides that disrupt endosomes to allow nucleic acids to avoid lysosomal degradation, viral proteins that maintain expression, or viral components that interact with cell surface proteins. Suitable intracellular viral delivery components include, but are not limited to, retroviruses, herpes simplex virus, adenovirus, and preferably adenovirus-associated viruses.

[0044] The form of the pharmaceutical formulations of the present invention depends in part on the intended use or route of administration, such as oral, transdermal, or by injection. The invention also includes the preparation of compositions for storage or administration, comprising a desired amount of the pharmaceutically effective compound in a pharmaceutical carrier or diluent. Carriers or diluents suitable for therapeutic use are known in the pharmaceutical field. For example, preservatives, stabilizers, dyes, and flavoring agents may be provided. These include esters of sodium benzoate, sorbic acid, and p-hydroxybenzoic acid. Furthermore, antioxidants and suspending agents may be used.

[0045] The formulations or siRNAs of the present invention and described herein can be administered in unit doses containing conventional, non-toxic pharmaceutical carriers, adjuvants, and / or excipients. The formulations may be suitable for oral administration, and compositions for oral administration may be prepared according to any method known in the art for preparing pharmaceutical compositions, and such compositions may contain one or more such sweeteners, flavoring agents, coloring agents, or preservatives to provide a pharmaceutically sound and palatable formulation.

[0046] Unless otherwise stated, nucleic acid sequences mentioned herein are written in the 5' to 3' orientation. The term "nucleic acid" refers to DNA or RNA or a modified form thereof, containing purine or pyrimidine bases present in DNA (adenine "A", cytosine "C", guanine "G", thymine "T") or present in RNA (adenine "A", cytosine "C", guanine "G", uracil "U"). Interfering RNAs provided herein may contain "T" bases, for example at the 3' end, even if "T" bases are not naturally present in RNA. In some cases, these bases may appear as "dT" to distinguish deoxyribonucleotides present in the ribonucleotide chain.

[0047] The terms "interfering RNA," "RNAi," or "interfering RNA sequence" refer to double-stranded RNA (i.e., double-stranded RNA) that, when present in cells identical to the target gene, can reduce or inhibit the expression of the target gene (i.e., by regulating the degradation of mRNAs whose sequence is complementary to the interfering RNA). Therefore, interfering RNA refers to double-stranded RNA formed by two complementary strands or by a single, self-complementary strand. Interfering RNA can have near-complete or perfect identity with the target gene, or may include mismatched regions. The sequence of interfering RNA may be identical to the full-length target gene or its subsequence. Interfering RNA includes "small interfering RNA" or "siRNA," for example, about 15-60, 15-50, or 15-40 double-stranded nucleotides in length. Examples of siRNA in this invention include, but are not limited to, double-stranded polynucleotide molecules assembled from two single-stranded molecules, one strand being a sense strand and the other a complementary antisense strand; double-stranded polynucleotide molecules assembled from single-stranded molecules, wherein the sense and antisense regions are linked by a nucleic acid-based or non-nucleic acid-based linker; double-stranded polynucleotide molecules with hairpin secondary structures having self-complementary sense and antisense regions; and cyclic single-stranded polynucleotide molecules with two or more loop structures and stems having self-complementary sense and antisense regions, wherein the cyclic polynucleotides can be processed in vivo or in vitro to produce active double-stranded siRNA molecules.

[0048] In this invention, the “effective amount” or “therapeutic effective amount” of siRNA is an amount sufficient to produce a desirable effect, which is, for example, the inhibition of target sequence expression compared with the normal expression level detected in the absence of siRNA.

[0049] The siRNA sequences provided by this invention can effectively silence the BMP2 gene mRNA at the mRNA level, with some siRNA sequences even silencing the BMP2 gene mRNA at a level of approximately 20%. The IC50 of some siRNA sequences modified with backbones and nucleosides against the BMP2 gene can reach a maximum of 0.126 nM. This invention further modifies the siRNA sequences with cholesterol to obtain a human-mouse homologous sequence (BMP2-13-R) targeting the BMP2 gene, which will facilitate further investigation of the in vivo silencing activity of the BMP2 target in mouse experimental models. Attached Figure Description

[0050] Figure 1 The results show the inhibition of BMP2 mRNA expression by siRNA.

[0051] Figure 2 The silencing effects of siRNA sequence modification before and after, the replacement of the 3'TT in the BMP2-13-M sequence with two complementary bases to the mRNA, and the IC50 results of BMP2-2-M, BMP2-5-M, BMP2-13-M, and BMP2-13-R were compared.

[0052] Figure 3 This is a schematic diagram of the structure of cholesterol-modified BMP2-13-R and the results of in vivo silencing experiments of cholesterol-modified BMP2-13-R, showing the mRNA and target protein levels. Detailed Implementation

[0053] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0054] Experiment 1: Design, screening, modification, and performance determination of siRNA sequences targeting bone morphogenetic protein 2. Experiment 1: Design of siRNA and primers.

[0055] 1.1 Design of siRNA

[0056] siRNA sequences were designed based on the BMP2 gene sequence. The nucleotide sequences of the siRNAs used for BMP2 activity screening are shown in Table 1.

[0057] The designed siRNA's sense and antisense strands were synthesized separately using a solid-phase synthesizer. A universal solid-phase synthesizer for nucleoside phosphoramide chemistry and nucleic acid synthesis was used to synthesize the corresponding RNA according to the designed sequence. The RNA strands were obtained through solid-phase digestion, nucleoside deprotection, and subsequent purification. The purified sense and antisense RNAs were paired in a 1:1 ratio to prepare corresponding siRNAs for subsequent evaluation.

[0058] Table 1. Designed BMP2 siRNA sequences

[0059]

[0060]

[0061] 1.2 Primer Design

[0062] The designed primers have the following nucleotide sequences: hBMP2-Forward: ACCAGGTTGGTGAATCAGAA; hBMP2-Reverse: CAATGGCCTTATCTGTGACC; hGAPDH-Forward: CGACCACTTTGTCAAGCTCA; hGAPDH-Reverse: AGGGGTC TACATGGCAACTG; mBMP2-Forward: AAGCCAAACACAAACAGCGG; mBMP2-Reverse: CGATCCAGTCATTCCACCCC; mGAPDH-Forward: GGCAAATTCAACGG CACAGT; mGAPDH-Reverse: CGCTCCTGGAAGATGGTGAT; where h is human and m is mouse.

[0063] 2 Experimental Methods

[0064] 2.1 Cell Culture

[0065] Cell proliferation, passage and plating: Human skin fibroblasts (HSF) cells were revived and cultured at 25 cm⁻¹ 25 mL of DMEM medium (Gbcio, C11995500BT) containing 15% FBS (Gbcio, A5669701) and 1× mycoplasma scavenger (200×, Procell, P-CMR-001) was added to a permeable cell culture flask (Corning, 430639). The flask was then placed in a cell culture incubator with constant conditions of 37°C and 5% CO2 for proliferation. Cells were passaged when the cell density reached approximately 95%. The culture medium was discarded, and the cells were washed twice with 1×PBS (M&C, CC008) (approximately 2 mL each time). 1 mL of trypsin (0.25%, M&C, CC012) was added, and the cells were digested in the cell incubator until they became rounded and a small number floated (approximately 3 min). Then, 3 mL of DMEM medium containing 15% FBS and 1× mycoplasma scavenger was added to terminate the digestion. Gently pipette the cells from the bottom using a 1 mL pipette, being careful to avoid creating air bubbles. Transfer the cell suspension to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 min. Discard the supernatant and resuspend the cells in fresh DMEM medium containing 15% FBS and 1× mycoplasma scavenger. Add approximately half of the cell resuspended cells to 5 mL of the DMEM medium containing 15% FBS and 1× mycoplasma scavenger, mix well, and then add to a fresh 25 cm⁻¹ centrifuge tube. 2 The permeable cell culture flasks were used to continue proliferation in an incubator. Cells were counted using a cell counting chamber, and cell resuspension was prepared. 2 × 10⁶ cells were seeded per well in a 48-well plate. 4 After mixing the cells using the cross-hatching method, place them in a cell incubator and culture for 24 hours.

[0066] 2.2 Cell transfection

[0067] Cell transfection experiments were performed after culturing the cells in a 48-well plate cell incubator for 24 hours until the cell density reached approximately 70%. Commercially available transfection reagents were used to transfect nucleic acids. The steps of the transfection experiment were as follows: (1) Prepare Lipofectamine 3000... TM +Opti-MEM stock solution: 1 μL Lipofectamine 3000 mg / well in each well of a 48-well plate. TM (1) Add (Invitrogen, L3000015) to 25 μL of Opti-MEM (Gibco, 31985070) medium, mix with a pipette, and incubate at room temperature for 5 min. (2) Prepare nucleic acid transfection stock solution: siRNA sequence is 10 μM stock solution (1×PBS). siRNA is diluted to Opti-MEM medium according to the transfection concentration, 25 μL per well. Mix with a pipette and incubate at room temperature for 5 min. (3) Prepare transfection stock solution: Lipofectamine 3000 in step (1) after incubation. TMAdd an equal volume (25 μL per well) of Opti-MEM stock solution to the nucleic acid transfection stock solution in step (2), pipette and mix 10-20 times, and incubate at room temperature for 15 min. (4) siRNA transfection: Remove the DMEM medium from the 48-well plate and add 200 μL of DMEM medium to each well; add 50 μL of the transfection stock solution in step (3) to each well of the 48-well plate according to the experimental design and shake gently to mix. After completion, place the plate in a cell incubator and evaluate 48 h after the transfection start time.

[0068] 2.3 qPCR Quantitative Analysis

[0069] (1) Extract total RNA: Extract RNA according to the instructions of the total RNA extraction reagent (Vazyme, R401). Use NanoDrop2000 (ThermoFisher, ND-1000) to detect RNA concentration and absorption peak shape. After reaching the standard, proceed to the next step of reverse transcription.

[0070] (2) Total RNA reverse transcription: The Novozymes HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) was used. Following the instructions, the total RNA amount for reverse transcription was 500 ng.

[0071] (3) qPCR: Promega's was used. The qPCR Master Mix quantitative PCR kit was used, with SYBR Green as the fluorescence signal. Following the manufacturer's instructions, after reverse transcription, 80 μL of enzyme-free water was added to the total RNA first-strand cDNA. RT-PCR was performed using the qPCR Master Mix kit. Each 20 μL well contained 10 μL Master Mix, 2 μL primers (100 nM), 4 μL enzyme-free water, and 4 μL cDNA (20 ng). The tubes were thoroughly centrifuged to remove air bubbles. The RT-PCR program was as follows: 95℃ for 2 min, 1 cycle; 95℃ for 3 s, 60℃ for 30 s, 40 cycles; 95℃ for 1 min, 55℃ for 30 s, 95℃ for 30 s, 1 cycle. Two sample wells were used per sample. hGAPDH was used as an internal control, and relative quantification was performed. －ΔΔCt The data was analyzed as follows: ΔCt = Ct(hBMP2) - Ct(hGAPDH), ΔCt = ΔCt(tested sample) - ΔCt(Mock), Relative mRNA expression to Mock = 2 -ΔΔCt .

[0072] 3 Experimental Results

[0073] 3.1 Silent effect of siRNA sequence on BMP2

[0074] The silencing effect of siRNA sequences on BMP2 is shown in Table 2 and... Figure 1 .

[0075] Table 2. Experimental results of siRNA sequence silencing efficiency for BMP2.

[0076]

[0077]

[0078] Screening of designed BMP2 siRNA sequences revealed that siRNAs located near regions 1113-1147, 743, 389, and 884-905 of the BMP2 coding region mRNA achieved better gene silencing effects. Figure 1 Among them, sequences such as BMP2-2, BMP2-5, and BMP2-13 can silence the mRNA level of BMP2 to about 25%, and are effective siRNA sequences that can be further modified and evaluated.

[0079] The BMP2-2, BMP2-5, and BMP2-13 sequences with good results were selected for further modification to obtain BMP2-2-M, BMP2-5-M, and BMP2-13-M, respectively. The specific modification schemes are shown in Table 3 below:

[0080] Table 3 siRNA Modifications

[0081]

[0082] Note: * indicates thiophosphate modification, m indicates 2′-methoxy modification, f indicates 2′-fluoro modification, and Phos indicates 5′ phosphate modification; the BMP2-13-R sequence replaces the 3′-TT of BMP2-13-M with two complementary bases to the mRNA.

[0083] Both ends of the sense and antisense strands of siRNA have two thiophosphate modifications, primarily to enhance siRNA stability and reduce exonuclease degradation. Thiophosphate modification involves replacing the oxidizing agent in the DNA solid-phase synthesis apparatus with a thioating agent, converting a non-ester oxygen bond in the phosphodiester bond to sulfur. Methoxylation at 2′-OH mainly promotes the binding affinity of siRNA to the target sequence and enhances its enzymatic stability; fluorination also enhances siRNA's enzymatic stability. Since excessive methylation affects siRNA efficacy, fluorination and methoxylation are used alternately. F- and methoxylation modifications are achieved using commercially available fluorinated or methoxylated phosphorylamide monomers during nucleic acid synthesis in the solid-phase synthesis apparatus. Because siRNA exerts its effect through 5′ phosphorylation of the antisense strand nucleic acid within the cell, pre-modification is more beneficial for siRNA efficacy. The silencing effects of BMP2-2-M, BMP2-5-M, and BMP2-13-M on the BMP2 gene are comparable to those before modification. Figure 2 ).

[0084] BMP2-13-M from Table 3 was selected for sequence extension. The extension method involved adding two complementary bases to the mRNA sequence, followed by adding two protruding dangling bases to the 3′ ends of both the sense and antisense strands of the siRNA, resulting in BMP2-13-R (with the TT nucleotide removed from the original sequence; the specific modification scheme is shown in Table 3). Evaluation showed that this BMP2-13-R sequence extension method had a relatively small impact on the siRNA's silencing effect (silencing to 14.61±4.94%), and the gene silencing effect was comparable to that of the original BMP2-13-M sequence (silencing to 13.92±8.14%). Figure 2 ).

[0085] 3.2 IC50 Experiment

[0086] For the modified siRNA and the siRNA sequence after 3'TT substitution in Table 3, the gene silencing effect of siRNA at concentrations of 0.001, 0.01, 0.05, 0.1, 0.5, 1, 2.5, 5, 10, and 50 nM and 48 h after transfection was determined according to the experimental methods and conditions described above for siRNA screening. The IC50 value of the corresponding siRNA was calculated by fitting the silencing efficiency at different concentrations.

[0087] The experimental results are shown in Figure 2 According to Table 3, the IC50 values ​​of the four modified siRNA sequences are as follows: BMP2-2-M is 0.150 nM, BMP2-5-M is 0.126 nM, BMP2-13-M is 0.152 nM, and BMP3-13-R is 0.195 nM.

[0088] 3.3 Silencing effect of cholesterol-modified BMP2-13-R in mice

[0089] To improve cellular uptake of siRNA, the 3' end of the positive strand of the human-mouse homologous sequence BMP2-13-R was subjected to cholesterol molecule (Chol, the structural formula of which is shown below) analysis. Figure 3 The modification of siRNA allows it to penetrate the cell membrane efficiently without the aid of a delivery medium, thereby improving the efficiency of siRNA drugs entering cells and enhancing therapeutic effects.

[0090] Six- to eight-week-old C57BL / 6 mice were acclimatized for 3-5 days and then divided into groups of three. Two doses of cholesterol-modified BMP2-13-R were administered intradermally: 5 mg / kg and 25 mg / kg. BMP2 mRNA was detected 48 hours after administration (Table 4 and 1). Figure 3 ) and proteins (Table 4 and Figure 3 Expression levels, along with PBS, nonsense sequences (Ctrl, sense chain:) were measured.

[0091] fA*mC*fUmAfCmUfGmAfGfUfGmAfCmAfGmUfAmGfA*T*T-Chol; Antisense chain:

[0092] (Phos)mU*fC*mUfAmCfUmGfUmCmAmCfUmCfAmGfUmAfGmU*T*T) group control.

[0093] Table 4. Silencing effect of cholesterol-modified BMP2-13-R in mice.

[0094] mRNA level (%) Protein level (%) PBS 93.94 100.00 Ctrl 77.03 107.97 5mg / kg 44.50 51.00 25mg / kg 25.72 46.26

Claims

1. A siRNA targeting bone morphogenetic protein 2, characterized in that, The siRNA is selected from any one of the following double-stranded RNAs (1)-(40): (1) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 1 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 2; (2) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 3 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 4; (3) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 5 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 6; (4) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 7 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 8; (5) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 9 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 10; (6) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 11 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 12; (7) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 13 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 14; (8) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 15 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 16; (9) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 17 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 18; (10) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 19 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 20; (11) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 21 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 22; (12) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 23 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 24; (13) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 25 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 26; (14) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 27 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 28; (15) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 29 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 30; (16) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 31 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 32; (17) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 33 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 34; (18) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 35 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 36; (19) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 37 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 38; (20) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 39 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 40; (21) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 41 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 42; (22) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 43 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 44; (23) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 45 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 46; (24) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 47 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 48; (25) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 49 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 50; (26) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 51 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 52; (27) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 53 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 54; (28) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 55 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 56; (29) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 57 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 58; (30) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 59 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 60; (31) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 61 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 62; (32) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 63 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 64; (33) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 65 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 66; (34) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 67 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 68; (35) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 69 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 70; (36) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 71 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 72; (37) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 73 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 74; (38) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 75 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 76; (39) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 77 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 78; (40) A double-stranded RNA consisting of the sense strand with the nucleotide sequence shown in SEQ ID No. 79 and the antisense strand with the nucleotide sequence shown in SEQ ID No. 80; Preferably, the siRNA is selected from any one of the following (a)-(g) double-stranded RNAs: (a) A double-stranded RNA consisting of the sense strand with SEQ ID No. 3 and the antisense strand with SEQ ID No. 4; (b) A double-stranded RNA consisting of the sense strand with SEQ ID No. 9 and the antisense strand with SEQ ID No. 10; (c) A double-stranded RNA consisting of the sense strand with SEQ ID No. 17 and the antisense strand with SEQ ID No. 18; (d) A double-stranded RNA consisting of the sense strand with SEQ ID No. 21 and the antisense strand with SEQ ID No. 22; (e) A double-stranded RNA consisting of the sense strand with SEQ ID No. 25 and the antisense strand with SEQ ID No. 26; (f) A double-stranded RNA consisting of the sense strand with SEQ ID No. 51 and the antisense strand with SEQ ID No. 52; (g) A double-stranded RNA consisting of the sense strand with SEQ ID No. 59 and the antisense strand with SEQ ID No.

60. Most preferably, the siRNA is selected from any one of the following double-stranded RNAs (a)-(c): (a) A double-stranded RNA consisting of the sense strand with SEQ ID No. 3 and the antisense strand with SEQ ID No. 4; (b) A double-stranded RNA consisting of the sense strand with SEQ ID No. 9 and the antisense strand with SEQ ID No. 10; (c) A double-stranded RNA consisting of the sense strand with SEQ ID No. 25 and the antisense strand with SEQ ID No.

26.

2. A siRNA, characterized in that, The nucleotide sequence of the siRNA contains 15 or more consecutive nucleotide sequences identical to those in the siRNA sequence of claim 1.

3. A modified siRNA, characterized in that, The modified siRNA is a modified siRNA obtained by modifying the siRNA of claim 1 or 2 by any one of the following modifications: backbone modification, sugar ring modification, or base modification; or a modified siRNA obtained by any one of the following modifications: phosphorylation or phosphorylation analog modification of the 5′ end of the antisense strand of the siRNA; or a modified siRNA obtained by any one of the following modifications: cholesterol molecule modification of the terminal group of the siRNA. The method of phosphorylation or phosphorylation analog modification of the 5′ end of the antisense strand of siRNA includes the following structural formula: The backbone modification includes, but is not limited to, thio-modification and / or amino-modification of the phosphate backbone of the sense and antisense strands of siRNA. The sugar ring modification includes, but is not limited to: replacing the 2′-OH in the nucleotide with methoxy, methylethoxy, and / or fluorine; or deoxygenating the 2′-OH in the nucleotide; or modifying the nucleotide in the siRNA to a peptide nucleic acid type, a locked nucleic acid type, or an unlocked nucleic acid type. The base modification includes, but is not limited to, base modification or substitution of nucleoside bases such as 5-methylcytosine, 6-methyladenine, ribavirin, pseudouracil, and / or inosine; The structural formula of the cholesterol molecule is as follows:

4. The modified siRNA according to claim 3, characterized in that, The modified siRNA is selected from any one of the siRNAs described in (1)-(3): (1) siRNA composed of the following sense and antisense strands: Chain of Justice: fG*mA*fAmUfGmAfAmAfAfGfGmUfUmGfUmAfUmUfA*T*T; Antonym chain: (Phos)mU*fA*mAfUmAfCmAfAmCmCmUfUmUfUmCfAmUfUmC*T*T; (2) siRNA composed of the following sense and antisense strands: Chain of Justice: fC*mG*fAmGfAmAfUmGfAfAfAmAfGmGfUmUfGmUfA*T*T; Antonym chain: (Phos)mU*fAmCfAmAfCmCfUmUmUmUfCmAfUmUfCmUfCmG*T*T; (3) siRNA composed of the following sense and antisense strands: Chain of Justice: fG*mG*fUmCfUmUfUmGfCfAfCmCfAmAfGmAfUmGfA*T*T; Antonym chain: (Phos)mU*fC*mAfUmCfUmUfGmGmUmGfCmAfAmAfGmAfCmC*T*T; Wherein, Phos represents 5′ phosphoric acid modification; m represents 2′-methoxy modification; * represents thiophosphoric acid modification; and f represents 2′-fluoro modification.

5. The modified siRNA according to claim 4, characterized in that, The modified siRNA sequence is further modified, including removing the two TT bases at the 3′ end of the modified siRNA sequence and adding two protruding dangling bases. Preferably, the modified siRNA obtained after further modification consists of the following sense and antisense strands: Chain of Justice: fG*mG*fUmCfUmUfUmGfCfAfCmCfAmAfGmAfUmGfA*mA*mC; Antonym chain: (Phos)mU*fC*mAfUmCfUmUfGmGmUmGfCmAfAmAfGmAfCmC*mU*mG; Wherein, Phos represents 5′ phosphoric acid modification; m represents 2′-methoxy modification; * represents thiophosphoric acid modification; and f represents 2′-fluoro modification.

6. An shRNA or sdRNA, characterized in that, The nucleotide sequence of the shRNA contains 15 or more consecutive nucleotide sequences identical to those in the siRNA sequence of claim 1; the nucleotide sequence of the sdRNA contains 15 or more consecutive nucleotide sequences identical to those in the siRNA sequence of claim 1.

7. A recombinant expression vector expressing the siRNA of any one of claims 1-5, or a recombinant expression vector expressing the shRNA or sdRNA of claim 6; preferably, the recombinant expression vector is a eukaryotic recombinant expression vector, more preferably, the eukaryotic recombinant expression vector is a recombinant adenovirus expression vector.

8. A recombinant host cell containing the recombinant expression vector of claim 7.

9. Use of the siRNA of any one of claims 1-5, the shRNA or sdRNA of claim 6, the recombinant expression vector of claim 7, or the recombinant host cell of claim 8 in targeting and inhibiting BMP2 gene expression or in the preparation of nucleic acid drugs for treating diseases caused by excessive BMP2 gene expression.

10. A pharmaceutical composition for treating diseases caused by overexpression of the BMP2 gene, comprising a therapeutically effective amount of an active ingredient and a pharmaceutically acceptable carrier or excipient; characterized in that, The active ingredient is selected from the siRNA of any one of claims 1-5, the shRNA or sdRNA of claim 6, or the recombinant expression vector of claim 7.

Images