CYP392E1 gene targeting gRNA composition for preventing and treating tetranychus urticae and application thereof

Abstract

The invention relates to the technical field of gene editing, in particular to a gRNA composition of a targeted CYP392E1 gene for preventing and treating tetranychus urticae and application of the gRNA composition. The CYP392E1 gene of which the nucleotide sequence is shown as SEQ ID NO.1 and any one of the following applications of gRNA of which the nucleotide sequence is shown as SEQ ID NO.2: 1) preventing and treating tetranychus urticae, and / or preparing a medicine for preventing and treating tetranychus urticae; and 2) reducing the resistance of the tetranychus urticae to the acaricide, and / or preparing a drug for reducing the resistance of the tetranychus urticae to the acaricide. The gRNA is designed by applying a gene knockout technology, especially aiming at a detoxification enzyme gene for regulating detoxification metabolism in a pest mite body, a compound consisting of the gRNA composition and cas9 protein is delivered into a tetranychus urticae body by utilizing a microinjection technology, and the gRNA composition loses the function of a target gene, reduces the detoxification metabolism capability of a medicament, and can be used for treating the pest mite body. The resistance reversion of the two-spotted spider mites is promoted, so that the aim of preventing and treating the two-spotted spider mites is

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, and in particular to gRNA compositions targeting the CYP392E1 gene for the control of two-spotted spider mites and their applications. Background Technology

[0002] The two-spotted spider mite (Tetranychus urticae) belongs to the genus Tetranychus in the family Tetranychidae of the order Acari in the class Arachnida. It is extremely harmful to agriculture, with a very wide host range, parasitizing over 1100 plant species, including 150 crops. The two-spotted spider mite mainly congregates on the underside of leaves, distributed along both sides of the veins. It feeds using its piercing-sucking mouthparts, causing damage to the host plant. White spots first appear on the leaves near the midrib on both sides of the petiole. As the infestation worsens, the leaves turn dark brown and scorch, eventually drying out and falling off. In high infestation densities, numerous individuals create webs, easily spreading the mite through these webs.

[0003] Common control measures for two-spotted spider mites include biological control, physical control, and chemical control, with chemical control being the primary method. Biological control mainly utilizes natural enemies, including predatory and parasitic natural enemies. Physical control methods primarily involve agricultural measures, such as clearing away dead branches, fallen leaves, and weeds before overwintering adult females emerge, and then burning or burying them deeply to eliminate overwintering mite sources. Chemical control is currently the most important and rapid effective means of controlling two-spotted spider mite infestations. However, due to the long-term, singular, and irrational use of chemical acaricides, two-spotted spider mites have developed severe resistance to many commonly used agents, leading to decreased control effectiveness, increased control costs, and problems such as environmental pollution and pesticide residues in agricultural products.

[0004] CRISPR / Cas9 gene editing technology consists of the Cas9 nuclease and two RNA molecules. The mature crRNA (CRISPR RNA) forms a special double-stranded RNA structure with the trans-activating RNA (tracrRNA) through base complementarity pairing, which guides the Cas9 protein to perform double-strand cutting on the target DNA, thereby achieving precise and efficient site-specific gene modification, ultimately leading to changes in gene function.

[0005] Our aim is to effectively address the problems caused by traditional chemical pesticides in the control of two-spotted spider mites, such as environmental pollution, increased pesticide resistance in mites, and threats to the safety of non-target organisms. Therefore, we propose the gRNA composition for reversing pesticide resistance in two-spotted spider mites and its application, which is used to achieve the goal of reversing resistance in two-spotted spider mites and thus controlling them. Summary of the Invention

[0006] The purpose of this invention is to provide a gRNA composition for reversing drug resistance in Tetranychus spp. and its application. The CYP392E1 gene in the Tetranychus spp. detoxification enzyme P405 is used as the target gene. A gRNA composition is designed and synthesized targeting the target gene, and a complex is formed with Cas9 protein and delivered into Tetranychus spp. via microinjection to obtain a gene-edited Tetranychus spp. population. The resistance reversal effect of this population is detected by bioassay, thereby achieving the goal of reversing resistance in Tetranychus spp. and controlling the disease.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: Any of the following applications of the CYP392E1 gene with a nucleotide sequence as shown in SEQ ID NO.1: 1) Controlling two-spotted spider mites, and / or preparing drugs for controlling two-spotted spider mites; 2) Reduce the resistance of two-spotted spider mites to acaricides, and / or, prepare drugs that reduce the resistance of two-spotted spider mites to acaricides.

[0008] The application method is as follows: knock out two adenosine nucleotides at 347bp and 348bp of the CYP392E1 gene.

[0009] Any of the following applications of gRNA with a nucleotide sequence as shown in SEQ ID NO.2: 1) Controlling two-spotted spider mites, and / or preparing drugs for controlling two-spotted spider mites; 2) Reduce the resistance of two-spotted spider mites to acaricides, and / or, prepare drugs that reduce the resistance of two-spotted spider mites to acaricides.

[0010] A method for preparing gRNA with the nucleotide sequence shown in SEQ ID NO.2 includes the following steps: S1. Using the CYP392E1 nucleotide sequence as the target, primer sequence pairs containing the T7 promoter sequence were designed, and DNA templates were obtained by PCR amplification. S2. Using the DNA from step S1 as a template, transcribe and synthesize gRNA; S3. Purify the gRNA synthesized in step S2.

[0011] The primer sequence pairs are: gRNA-F: TAATACGACTCACTATAGGATGGAGCATCAATCA gRNA-R:TTCTAGCTCTAAAACGAAGTGATTGATGCTCCAT.

[0012] A composition for controlling two-spotted spider mites, the composition comprising gRNA with a nucleotide sequence as shown in SEQ ID NO.2.

[0013] The composition also includes Cas9 protein.

[0014] This invention has at least the following beneficial effects: This invention provides a more environmentally friendly, efficient and specific method for controlling harmful mites by using gene knockout technology, especially by designing and synthesizing gRNAs targeting detoxification enzyme genes that regulate detoxification metabolism in harmful mites. This invention synthesizes a gRNA composition for the control of two-spotted spider mites by targeting a gene. This gRNA composition can target and edit the gene. Using microinjection technology, a complex of the gRNA composition and Cas9 protein is delivered into the two-spotted spider mite. This gRNA composition causes the target gene to lose function, reduces its ability to detoxify and metabolize pesticides, and promotes the reversal of resistance in the two-spotted spider mite, thereby achieving the purpose of controlling the two-spotted spider mite. Attached Figure Description

[0015] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the following description of the embodiments will be briefly introduced. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 A schematic diagram of the population purification process for the two-spotted spider mite; Figure 2 This is a schematic diagram of the gene identification results. Detailed Implementation

[0017] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0018] Example 1: This example discloses a detoxification enzyme gene in the genome of the two-spotted spider mite that has an important influence on the detoxification metabolism of the two-spotted spider mite, as a target gene for the prevention and control of the two-spotted spider mite.

[0019] Specifically, the target gene is selected from the CYP392E1 gene in the two-spotted spider mite detoxification enzyme P450; the target gene number, gene nucleotide sequence, gRNA sequence, and gRNA primer nucleotide sequence are listed below.

[0020] Gene ID: tetur03g05540 Gene nucleotide sequence: The underlined nucleotides are those deleted after gene editing (adenosine nucleotides at 347bp and 348bp). SEQ ID NO.1: ATGCCTGCGCTAGTTTTGTTGGGTTATAGACTTGAACTCAACTCAAGCTCAATCAATTTATTGTTAACTTGTGTTGCTCTTTTCCTGGTTACTTGTTTCATTAATTTGATTCAAAGACTTCGTAAACTTCCACCCGGTCCATGGGGCCTTCCAATTGTGGGATATTTACCATTTATAAAGCAGGATGCTCACCTTCAATTTTATGAATTTACCAAGCGATATGGACCAATATGCAGCTTTGCTTGTGGACAATTTGACGTCATTTTAATCAATGAATGGAAGTCAATCAAAAAAGCATTAGCAAGTGATGATTTACTCGCTCGTCCTGATCAGGTTTTCCTGCCAG AA gRNA sequence: SEQ ID NO.2:GATGGAGCATCAATCACTTC gRNA primer nucleotide sequence: Underlined portion is the T7 promoter. gRNA-F: TAATACGACTCACTATAG GATGGAGCATCAATCA gRNA-R:TTCTAGCTCTAAAACGAAGTGATTGATGCTCCAT Example 2, this example uses the above-described method for preparing gRNA.

[0021] 1. DNA template synthesis of gRNA (1) Dilute the mixture of upstream and downstream primers to 0.3 μM. (2) GeneArt was used to synthesize gRNA. TM Precision gRNA Synthesis Kit (Thermo Fisher Scientific), reaction volume 25 μL, specific proportions are shown in the table below:

[0022] (3) Centrifugation-oscillation-centrifugation (4) The PCR reaction procedure is as follows:

[0023] (5) Run the product on electrophoresis (take 5 μL, which should be a single bright band) and store at 4 °C for later use.

[0024] 2. Transcription and synthesis of gRNA gRNA was purified using a gRNA purification kit (Thermo Fisher Scientific). Detailed operating procedures are as follows: (1) Configuration of transcription reaction system

[0025] (2) Centrifugation-oscillation-centrifugation; (3) Incubate at 37°C for 2 hours (the culture time can be extended to 4 hours to increase gRNA production) 3. Purification of gRNA (1) Add 1 μL of DNase I to the gRNA and incubate it at 37°C for 15 min (afterwards, take 0.5 μL and run electrophoresis to check the quality of the unpurified gRNA, which should be a bright single band). (2) Add enzyme-free water to bring the volume of the system to 200 μL; (3) Add 100 μL of Binding Buffer and then mix with a pipette. (4) Add 300 μL of anhydrous ethanol and mix well with a pipette. (5) Transfer the solution into a purification column, centrifuge (14000xg, 1min), and discard the waste liquid; (6) Add 700 μL Wash Buffer 1 to the purification column, centrifuge (14000 x g, 1 min), and discard the waste liquid; (7) Add 700 μL Wash Buffer 2 to the purification column, centrifuge (14000 x g, 1 min), and discard the waste liquid; (8) Repeat step 7; (9) Centrifuge the empty purification column again (14000xg, 2min), then open the cap and let it stand for 2min; (10) Transfer the purification column to a new 1.5 mL collection tube; (11) Add 10 μL of enzyme-free water vertically suspended in the purification column and centrifuge (14000xg, centrifuge for 1 min). (12) Add the liquid in the collection tube back into the purification column and let stand for 1 min. Centrifuge (14000xg, centrifuge for 1 min). The liquid in the collection tube is the final product. (13) Measure the concentration, run electrophoresis, test its quality, and store the product at -80℃ for later use.

[0026] 4. Purification and Culture of Two-spotted Tetranychus Microinjection and Gene Editing Populations The Cas9 protein (Thermo) and gRNA were mixed to a final concentration of 10 μM for the Cas9 protein and 30 μM for the sgRNA. The gRNA-Cas9 complex was then injected via microinjection into unmated female adult two-spotted spider mites, as follows: (1) Use a brush to fix 1- to 2-day-old unmated female adult two-spotted spider mites on 3% agar gel with their abdomen facing upward and at a 45-degree angle to the horizontal plane. (2) Using a microinjector, gRNA-Cas9 complex was injected into the lateral abdomen of Tetranychus tinctoria to the maximum tolerable volume of Tetranychus tinctoria. (3) After injection, female adult mites were transferred to fresh leaves with a paintbrush for rearing, with 10 female adult two-spotted spider mites per leaf. (4) After laying eggs on the leaves, the female adult mites are removed from the leaf discs 48 hours later. The eggs hatch into the F1 generation. (5) Mating the F1 generation with unmated female adult mites in the original population to lay eggs, and waiting for the F2 generation to hatch and mature, identifying the paternal parent of the F2 generation, i.e. the F1 genotype, and retaining the F2 generation whose paternal parent is a mutant. (6) F2 generation produces males from parthenogenetic offspring to obtain F3 generation. F3 generation is backcrossed with F2 generation to produce eggs to obtain F4 generation. The genotype of F3 generation is identified, and F4 generation is retained as the mutant F3 generation. (7) F4 generation produces males from parthenogenetic offspring to obtain F5 generation. F5 generation is backcrossed with F4 generation to produce eggs to obtain F6 generation. The genotype of F4 generation is identified, and F6 generation, which is a mutant of F4 generation, is retained. (8) Finally, the F6 generation genotype is obtained as a homozygous mutant gene. The F6 generation can then be cultured and expanded. The population purification process is as follows: Figure 1 As shown.

[0027] 4. Extraction and gene identification of genomic DNA from the two-spotted spider mite The genomic DNA of the uniceta mite was extracted for molecular identification. The specific steps are as follows: 1. Pick a single mite and place it in a 1.5 mL centrifuge tube. Add 18 μL of LTE Buffer to completely soak the mite. Add 2 μL of proteinase K and grind thoroughly with a sterile grinding stick. 2. Centrifuge at 13000 rpm for 5 min at room temperature; 3. Place in a metal bath and heat at 37°C for 30 minutes (to allow proteinase K to degrade other proteins); then at 98°C for 10 minutes (to inactivate proteinase K); then centrifuge at 13,000 rpm for 2 minutes (to collect water vapor from the centrifuge tube cap), and store at 4°C for later use.

[0028] 4. The CYP392E1 gene was amplified using ApexHF HS DNA polymerase premix-FS. The specific application system is as follows:

[0029] Upstream primer: GCAGGATGCTCACCTTCAAT Downstream primer: CATCTCTTCGAGGAAACCAT The PCR procedure is as follows:

[0030] 5. Run the gel electrophoresis, add 8 μL of sample, and send the sample with bands for gene identification. 6. The gene identification results are imported into DNAMAN and compared with standard gene sequences. Snapgene is used to view peak changes. The identification results are as follows: Figure 2As shown, the identification results indicate that after gene editing, two adenosine nucleotides (AAs) were deleted at 347bp and 348bp in the nucleotide sequence, resulting in changes in the translated amino acid sequence, altered gene function, and inability to properly metabolize the acaricide. 6. Virulence determination of gene-edited populations of the two-spotted spider mite (1) Preparation of leaf discs: Cut a sponge of appropriate size and place it in a petri dish. Add water to make the sponge fully absorb water. Place filter paper on the sponge to keep it moist and prevent mites from escaping. (2) Select fresh cowpea seedling leaves of uniform size and flatness, cut them into 2cm x 2cm pieces, place them on sponge filter paper with the back side facing up, and put three leaves in each petri dish; (3) Select healthy 3-5 day old female adult mites and place them on the leaves, 30 mites per leaf; (4) Toxicity determination by spraying: The agent was sprayed sequentially from low to high concentration. 1 mL of agent was sprayed onto each petri dish, ensuring the surface of each leaf was moist. After spraying, the dishes were incubated for 24 hours at a temperature of 25±3℃, humidity of 30-60% RH, and a photoperiod of 14L:10D. The mortality rate after 24 hours was observed and recorded, and the LC50 was calculated. 50 Comparing the KO knockout population with the CK control population (LC) 50 The degree of resistance reversal was analyzed. The results are shown in Table 1 below. Table 1. Toxicity determination of benzimidazole in KO knockout and CK control populations

[0031] Note: (a): χ² chi-square value, df degrees of freedom, and p-value represent the goodness-of-fit test. When p-value < 0.05, there is a significant difference compared with the Probit model. (b): RR resistance ratio = CK control population LC 50 / KO Knockout Population LC 50 *: Indicates the LC ratio of the CK control population to the KO knockout population. 50 Significant differences exist. LC50 of KO knockout population and CK control population to the same agent benzimidazole 50 The concentrations were 539.35 mg / L and 77.244 mg / L, respectively. The resistance of the KO knockout population was reduced to seven times that of the original population. Gene editing significantly reversed the resistance of the two-spotted spider mite to benzimidazole.

[0032] In summary, this invention primarily addresses the problems of environmental pollution, increased pesticide resistance in pests, and the impact on non-target organisms encountered by traditional chemical pesticides in the control of two-spotted spider mites. This invention utilizes gene knockout technology, specifically targeting genes related to growth, development, and metabolism within the pest, to design and synthesize gRNA compositions.

[0033] This invention designs and synthesizes a gRNA composition for the control of two-spotted spider mites by targeting specific genes. This gRNA composition can knock out two adenosine nucleotides (AA) in the CYP392E1 gene. Using microinjection, the complex of the gRNA composition and Cas9 protein is delivered into the two-spotted spider mite, resulting in the loss of the two AA nucleotides in the target gene. This leads to gene dysfunction, reduced detoxification and metabolism of pesticides, and promotes the reversal of resistance in the two-spotted spider mite, thereby achieving the goal of controlling the mite. This method can reverse drug resistance in the two-spotted spider mite; it is convenient, efficient, and effective, showing great promise for application.

[0034] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention. The scope of protection claimed by the appended claims and their equivalents is defined.

Claims

1. Any of the following applications of the CYP392E1 gene with the nucleotide sequence shown in SEQ ID NO.1: 1) Controlling two-spotted spider mites, and / or preparing drugs for controlling two-spotted spider mites; 2) Reduce the resistance of two-spotted spider mites to acaricides, and / or, prepare drugs that reduce the resistance of two-spotted spider mites to acaricides.

2. The application according to claim 1, characterized in that, The application method is as follows: knock out two adenosine nucleotides at 347bp and 348bp of the CYP392E1 gene.

3. Any of the following applications of gRNA with a nucleotide sequence as shown in SEQ ID NO.2: 1) Controlling two-spotted spider mites, and / or preparing drugs for controlling two-spotted spider mites; 2) Reduce the resistance of two-spotted spider mites to acaricides, and / or, prepare drugs that reduce the resistance of two-spotted spider mites to acaricides.

4. A method for preparing gRNA with the nucleotide sequence shown in SEQ ID NO.2, characterized in that, Includes the following steps: S1. Using the CYP392E1 nucleotide sequence as the target, primer sequence pairs containing the T7 promoter sequence were designed, and DNA templates were obtained by PCR amplification. S2. Using the DNA from step S1 as a template, transcribe and synthesize gRNA; S3. Purify the gRNA synthesized in step S2.

5. The preparation method according to claim 4, characterized in that, The primer sequence pairs are: gRNA-F: TAATACGACTCACTATAGGATGGAGCATCAATCA gRNA-R:TTCTAGCTCTAAAACGAAGTGATTGATGCTCCAT.

6. A composition for controlling two-spotted spider mites, characterized in that, The composition comprises gRNA with a nucleotide sequence as shown in SEQ ID NO.

2.

7. The composition according to claim 6, characterized in that, The composition also includes Cas9 protein.

Images