New method for improving fermentation yield of clavulanic acid

Abstract

The invention discloses application of a MarR family transcriptional regulation factor SCLAV2489 (GeneBank numbering EFG07562.1) or a phospholipase A2 gene SCLAV4219 (GeneBank numbering EFG09293.1) as a target in improving the fermentation yield of clavulanic acid, the MarR family transcriptional regulation factor SCLAV2489 or the phospholipase A2 gene SCLAV4219 in a streptomyces clavuliformis genome is inactivated or knocked out, so that the fermentation yield of clavulanic acid of a mutant strain can be remarkably improved, and the industrial application prospect is achieved.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to the use of MarR family transcriptional regulator SCLAV_2489 or phospholipase A2 gene SCLAV_4219 as targets to increase clavulanic acid fermentation yield. Background Technology

[0002] β-lactam antibiotics, encompassing penicillins and their derivatives, cephalosporins, and monoamide ring antibiotics, have garnered significant attention due to their widespread clinical application. However, prolonged use of β-lactam antibiotics may lead to antibiotic resistance in pathogens. To address this resistance issue, combining β-lactam antibiotics with β-lactamase inhibitors has become one effective solution.

[0003] Clavulanic acid is an irreversible β-lactamase inhibitor with significant pharmaceutical value. Since its discovery, continuous efforts have been made in developing industrial strains, improving fermentation processes, and researching finished drugs. However, in recent years, there have been few reports on modifying strains to increase clavulanic acid yield; the main approach has been to optimize fermentation processes. Further development of new strains to improve clavulanic acid fermentation levels has considerable economic value. For example, in patent publication CN117925669A, the inventors reported improving clavulanic acid fermentation yield by overexpressing a high-activity mutant of clavulanic acid synthase (GenBank accession number CP027858.1) in clavulanic acid-producing bacteria; in patent publication CN118006655A, they reported improving the fermentation level and reducing the yield of impurity G in clavulanic acid-producing bacteria by overexpressing the gene SCLAV_0472; in patent publication CN118995708A, they reported that regulating the expression of transcription factor claR using a promoter mutant could increase clavulanic acid fermentation yield; and in patent publication CN119799755A, they reported that knocking out the transcription regulator SCLAV_p0126 in the genome of Streptomyces rotaformes could also increase clavulanic acid fermentation yield. Summary of the Invention

[0004] In our ongoing research on the fermentation production of clavulanic acid by *Streptomyces cordata*, during comparative genomics studies of the screened mutant strain B021-01 (see patent document CN118995708A), we discovered two more genes that negatively regulate clavulanic acid biosynthesis. These two genes are labeled as MarR family transcription factor SCLAV_2489 (GeneBank number EFG07562.1, nucleotide sequence as shown in SEQ ID NO: 1, amino acid sequence as shown in SEQ ID NO: 2) and the phospholipase A2 (PLA2) gene SCLAV_4219 (GeneBank number EFG09293.1, nucleotide sequence as shown in SEQ ID NO: 3, encoding a protein containing 2075 amino acids, amino acid sequence as shown in SEQ ID NO: 4). In the mutant strain B021-01, the 268th base of the MarR family transcription factor SCLAV_2489 gene is mutated from G to C, resulting in the 90th amino acid being mutated from V to L. Further experiments confirmed that inactivating or reducing the expression of the MarR family transcription factor gene SCLAV_2489 in the modified *Streptomyces* strain B021-2 (see patent document CN118995708A) can increase clavulanic acid production. Similarly, in the mutant strain B021-01, the deletion of base A at 3272 of the phospholipase A2 gene SCLAV_4219 leads to a frameshift mutation, prematurely terminating the translation of phospholipase A2 and resulting in enzyme inactivation. Further experiments confirmed that knocking out the phospholipase A2 gene SCLAV_4219 in the modified *Streptomyces* strain B021-2 can also increase clavulanic acid production. Based on these new developments, the present invention provides the following technical solution.

[0005] The first aspect of this invention provides the application of MarR family transcriptional regulator SCLAV_2489 (GeneBank number EFG07562.1, nucleotide sequence as shown in SEQ ID NO: 1, amino acid sequence as shown in SEQ ID NO: 2) and phospholipase A2 (PLA2) gene SCLAV_4219 (GeneBank number EFG09293.1, nucleotide sequence as shown in SEQ ID NO: 3, amino acid sequence as shown in SEQ ID NO: 4) as targets for improving clavulanic acid fermentation yield.

[0006] In one embodiment, the above application is a method for increasing the fermentation yield of clavulanic acid by a strain, comprising the following steps: downregulating, inactivating, weakening or knocking out the expression of gene SCLAV_2489 (GeneBank number EFG07562.1) or gene SCLAV_4219 (GeneBank number EFG09293.1) in the genome of clavulanic acid producing bacteria.

[0007] Preferably, the clavulanic acid producing bacterium is *Streptomyces clavuligerus*, more preferably *Streptomyces clavuligerus* ATCC 27064 and its derivative strains, such as the mutant strains reported in patent documents with publication numbers CN117925669A, CN118006655A, CN118995708A and CN119799755A.

[0008] Optionally, in the above applications, the genes SCLAV_2489 (GeneBank number EFG07562.1) and SCLAV_4219 (GeneBank number EFG09293.1) can be used as modification targets simultaneously, or one can be used as a modification target alone.

[0009] Preferably, the genes SCLAV_2489 (GeneBank number EFG07562.1) and / or SCLAV_4219 (GeneBank number EFG09293.1) are used as targets for modification, which basically does not change the original biological characteristics of the clavulanic acid producing bacteria, including cell morphology and habits, growth period, proliferation rate, fermentation density and other original characteristics.

[0010] In one embodiment, the downregulation, inactivation, functional attenuation, or knockout of the SCLAV_2489 or SCLAV_4219 gene is implemented in the following manner:

[0011] (1) Knock out the SCLAV_2489 gene or the SCLAV_4219 gene from the chromosome of the starting strain;

[0012] (2) Downregulate or interfere with the expression of the SCLAV_2489 gene or the SCLAV_4219 gene in the chromosome of the starting strain;

[0013] (3) Replace the SCLAV_2489 gene or SCLAV_4219 gene in the chromosome of the starting strain with a SCLAV_2489 gene or a SCLAV_4219 gene mutant whose coding function is lost or downregulated.

[0014] Furthermore, the above method (2) can be selected from the following group:

[0015] (2-1) Mutations in the promoter region and / or coding region of the SCLAV_2489 or SCLAV_4219 gene lead to downregulation of the expression level of the SCLAV_2489 or SCLAV_4219 gene;

[0016] (2-2) Mutations in the upstream regulators of the SCLAV_2489 or SCLAV_4219 genes lead to downregulation of the expression levels of the SCLAV_2489 or SCLAV_4219 genes; or

[0017] (2-3) Introduce the interacting proteins of SCLAV_2489 or SCLAV_4219 into wild-type strains to alter the function of the SCLAV_2489 or SCLAV_4219 genes.

[0018] (2-4) Silencing the SCLAV_2489 or SCLAV_4219 gene using siRNA or dsRNA via RNAi technology.

[0019] Optionally, further, the mutation in the coding region described in the above method (2-1) is a frameshift mutation, which causes SCLAV_2489 or SCLAV_4219 to become inactive or lose its function.

[0020] In one implementation, the above methods (1), (2), (3) and / or (4) are implemented through gene editing technology, antisense nucleic acid, and transcriptional regulation.

[0021] The gene editing technologies mentioned above can be selected from the following group: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, MuGENT (multiplex genome editing by natural transformation), and CRISPRi.

[0022] A second aspect of the present invention provides an engineered strain of Streptomyces rod-shaped bacteria, wherein the expression of the SCLAV_2489 gene (GeneBank number EFG07562.1) and / or the SCLAV_4219 gene (GeneBank number EFG09293.1) is downregulated, inactivated, weakened or knocked out in its genome.

[0023] A third aspect of the invention provides the use of engineered *Streptomyces fasciatus* strains in the fermentation production of clavulanic acid.

[0024] This invention is the first to discover that the MarR family transcription factor SCLAV_2489 (GeneBank ID EFG07562.1) and the phospholipase A2 (PLA2) gene SCLAV_4219 (GeneBank ID EFG09293.1) derived from *Streptomyces coccidioides* negatively regulate clavulanate biosynthesis. Shake-flask experiments showed that the mutant strain B021-05 obtained by knocking out the SCLAV_2489 gene in the *Streptomyces coccidioides* modified strain B021-2 exhibited... Clavulanic acid fermentation yield increased by 21.6%; the clavulanic acid fermentation yield of mutant strain B021-06, obtained by downregulating the SCLAV_2489 gene regulatory function of B021-2 (i.e., changing amino acid V to L at position 90), increased by 25.5%; and the clavulanic acid fermentation yield of mutant strain B021-07, obtained by knocking out the SCLAV_4219 gene in B021-2, increased by 30.7%, suggesting that these two genes can be used as targets to construct clavulanic acid production strains with industrial application value. Attached Figure Description

[0025] Figure 1 The sequencing results of the SCLAV_2489 gene knockout genetically engineered strain B21-05 from the modified Streptomyces b021-2 are shown.

[0026] Figure 2 The sequencing results of the genetically engineered strain B21-06, whose gene SCLAV_2489 has undergone a mutation at amino acid position 90, where V is changed to L, are shown.

[0027] Figure 3 A bar chart comparing the yields of clavulanic acid from shake-flask fermentation of genetically engineered strains B21-05, B21-06, and the original strain B021-2 is shown.

[0028] Figure 4 The sequencing results of engineered strain B021-07 from the modified Streptomyces bronchiolitis strain B021-2, which resulted in gene knockout due to the deletion of base A at position 3272 of the SCLAV_4219 gene, are shown.

[0029] Figure 5 A bar chart comparing the yields of clavulanic acid from shake-flask fermentation of engineered strain B021-07 and the original strain B021-2 is shown. Detailed Implementation

[0030] Based on comparative genomics research, we discovered two genes from the previously reported mutant strain B021-01: the MarR family transcription factor SCLAV_2489 and the phospholipase A2 gene SCLAV_4219, which both have a negative regulatory effect on clavulanic acid biosynthesis.

[0031] Transcription factors play a crucial role in the regulation of secondary metabolites in *Streptomyces corynebacterium*, influencing metabolic pathway activity through gene expression regulation. As an important industrial microorganism, *Streptomyces corynebacterium* can synthesize various bioactive molecules, such as antibiotics, and the synthesis of these secondary metabolites is typically significantly regulated by specific transcription factors. Multiple studies have shown that MarR family transcription factors can regulate antibiotic biosynthesis.

[0032] Phospholipase A2 is a class of enzymes that hydrolyzes the second ester bond of glycerophospholipids to generate free fatty acids and lysophospholipids, and it has important applications in the degumming and refining of vegetable oils. However, few studies have shown that phospholipase A2 is related to the biosynthesis of antibiotics.

[0033] Our research indicates that MarR family transcriptional regulators, such as the SCLAV_2489 gene and / or the phospholipase A2 gene SCLAV_4219, hold promise as genetic resources for improving the fermentation capacity of existing clavulanic acid-producing bacteria and constructing genetically engineered strains that produce high and stable clavulanic acid.

[0034] As used herein, the terms “increased (clavulanic acid fermentation yield),” “enhanced” or “strengthened” can mean an increase of at least 10% relative to a reference level (e.g., the starting strain / wild fungus), such as an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any increase between 10% and 100%, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times relative to a reference level.

[0035] In this article, the terms "(Streptomyces rotaformis) genetically engineered bacteria", "engineered bacteria (strain)" and "mutant (strain)" have the same meaning and can be used interchangeably.

[0036] Correspondingly, for ease of description, the starting strain, such as B021-2, whose genes SCLAV_2489 and / or SCLAV_4219 have not been knocked out, can be referred to as the "starting strain" or "wild-type strain".

[0037] In the description of the technical solutions of this invention, the terms "and / or" and "and / or" used in phrases such as "A and / or B" and "A and / or B" are intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B and / or C" is intended to cover each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0038] In this document, for the sake of simplicity, the name of a protein, such as the MarR family transcription factor SCLAV_2489, and its encoding gene (DNA) are sometimes used interchangeably. Those skilled in the art should understand that they represent different substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, when describing the function or class of a transcription regulatory protein, MarR family transcription factor SCLAV_2489 refers to the protein; when describing it as a gene, it refers to the gene encoding that protein.

[0039] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0040] Example

[0041] The embodiments in this article involve the addition amount, content and concentration of various substances. Unless otherwise specified, the percentage content mentioned refers to the mass percentage content.

[0042] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).

[0043] For experimental methods where specific conditions are not specified in the examples, follow the standard conditions or the manufacturer's recommended conditions.

[0044] Materials and methods

[0045] In the following examples, the modified Streptomyces rod-shaped strain B021-2 used is described in patent document CN118995708A.

[0046] The primer synthesis and sequencing involved were all completed by Shanghai Qingke Biotechnology Co., Ltd.

[0047] The molecular biology experiments in the examples included plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation, etc., mainly referring to "Molecular Cloning: A Laboratory Manual" (4th Edition), edited by M.R. Green and J. Sambrook (USA), translated by He Fuchu, Science Press, Beijing, 2017. Specific experimental conditions can be determined through simple experiments if necessary.

[0048] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0049] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2 (solid medium with an additional 20 g / L agar powder).

[0050] 2× Spore pre-germination medium: yeast extract 10 g / L, casein amino acids 10 g / L, calcium chloride 0.01 M, sterilized at 121℃ for 20 min, used for spore germination culture in conjugation transfer experiments.

[0051] TES (0.05 M, pH 8.0) solution: Add 1.15 g N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid to 100 mL of pure water and adjust the pH to 8.0. Sterilize at 121 °C for 20 min. Used for conjugation transfer of Streptomyces spore germination.

[0052] Tryptone soybean broth (TSB) culture: 3% TSB for Streptomyces coccidioides culture.

[0053] MS medium: 20 g / L soybean meal extract, 20 g / L mannitol, 20 g / L agar powder, used for conjugation transfer of Streptomyces rod-shaped culture.

[0054] Seed culture medium: 24 g / L soybean ultrafine powder, 10 g / L corn starch, 5 g / L yeast autolysate, 0.8 g / L dipotassium hydrogen phosphate, adjusted to pH 6.9-7.1. Dispense into 250 mL shake flasks, each containing 50 mL of the medium. Add 0.5 mL of triglyceride to each flask. Sterilize at 121°C for 20 min for shake flask seed culture.

[0055] Shake flask culture medium: 36 g / L soybean ultrafine powder, 10 g / L corn starch, 12 g / L soybean protein extract, 1.95 g / L dipotassium hydrogen phosphate, 1.5 g / L potassium chloride, 1.0 g / L magnesium chloride hexahydrate, 0.38 g / L calcium chloride dihydrate, 0.18 g / L sodium chloride, 0.08 g / L ferric chloride hexahydrate, 0.02 g / L copper chloride, 0.01 g / L zinc chloride, and 200 mL / L MOPS solution, adjusted to pH 6.9–7.1. Dispense into 250 mL shake flasks, each containing 50 mL of the medium. Add 0.8 mL of triglyceride to each flask. Sterilize at 121°C for 20 min for shake flask fermentation. MOPS solution: 42 g MOPS added to 50 mL purified water, then 88.5 mL of 1 M sodium hydroxide solution, bringing the volume to 200 mL and adjusting the pH to 7.1–7.3.

[0056] HPLC detection conditions for clavulanic acid content: Agilent 1260 liquid chromatograph, column C18 (4.6×250mm, 5μm), mobile phase: mobile phase A (10mmol tetrabutylammonium hydrogen sulfate, 11.5% acetonitrile, pH=6.0): mobile phase C (acetonitrile) = 90:10 (V / V), detection wavelength: 210nm, column temperature: 33℃, flow rate: 1ml / min, injection volume: 20µl.

[0057] The knockout plasmid pJTU1278 backbone used in the examples has been described in the SCI database article "Bu, XL; He, BB; Weng, JY; Jiang, CC; Zhao, YL; Li, SM; Xu, J.; Xu, MJ Constructing microbial hosts for the production of benzoheterocyclic derivatives. ACS Synth. Biol. 2020, 9 (9), 2282−2290".

[0058] In the embodiments, Streptomyces rod-shaped B021-2, the constructed SCLAV_2489 and SCLAV_4219 gene knockout plasmids pB021-05 and pB021-07, and the mutant gene SCLAV_2489 plasmid pB021-06 were preserved by Shanghai Banglin Biotechnology Co., Ltd. Any unit or individual may obtain these plasmids for verification of the present invention, but they may not be used for other purposes, including development and utilization, scientific research and teaching, without the permission of Shanghai Banglin Biotechnology Co., Ltd.

[0059] Example 1: Knockout and downregulation of the SCLAV_2489 gene in strain B021-2

[0060] In this embodiment, mutant strain B021-05 with the SCLAV_2489 gene knocked out and engineered strain B021-06 with the transcriptional regulatory function of the SCLAV_2489 gene downregulated (i.e., amino acid V at position 90 was mutated to L) were prepared. The specific steps are as follows.

[0061] Step 1: Constructing the SCLAV_2489 knockout plasmid pB021-05: Using genomic DNA from the modified Streptomyces b021-2 strain as a template, the upstream homologous arm S1 of SCLAV_2489 was amplified using primers up5-F / up5-R, and the downstream homologous arm S2 of SCLAV_2489 was amplified using primers down5-F / down5-R. The plasmid was then cloned into the multiple cloning site of plasmid pJTU1278 using a one-step cloning method to obtain the knockout plasmid pB021-05.

[0062] Step 2: Constructing the mutant plasmid pB021-06, which downregulates the function of SCLAV_2489 (i.e., the 90th amino acid V is mutated to L): Using B021-2 genomic DNA as a template, the SCLAV_2489 fragment S3 was amplified using primers up6-F / up6-R, and the homologous arm S4 of the SCLAV_2489 fragment was amplified using primers down-F / down-R. The fragment was then cloned into the site of plasmid pJTU1278 using a one-step cloning method to obtain plasmid pB021-06.

[0063] The primer sequences used in steps one and two include:

[0064] Primer name Base sequence up5-F ggagctccaccgcggtggcggccgctctagaGTGCCGCCGAACCCGGTCACCGCAC up5-R GTCGCGGTGGTGGGGTTCCAGGCGGCCCTTGGGCGTACATGCGGTTGAGG down5-F CCGCCTGGAACCCCACCACCGCGAC down5-R ccccctcgaggtcgacggtatcgataagcttGAGTGCGGTGGAGAAGGGTTCCCG up6-F ggagctccaccgcggtggcggccgctctagaAACGTCCCCGGGAACATCCGGGATC up6-R TGCCAGTCGGCGAGGGCGCGGTGGAGCGGCCCGGTCGCGCGCCCGGCCGC down6-F TCCACCGCGCCCTCGCCGACTGGCA down6-R ccctcgaggtcgacggtatcgataagcttCATTCGGACGAGTAGCCGGAGGCAC

[0065] The PCR system and conditions used for gene fragment preparation in steps one and two are as follows:

[0066] PCR reaction system: DNA template 30 ng, primer 20 pmol, 50% DMSO 4 μL, PrimerSTAR max, add pure water to make up to 50 μL;

[0067] PCR conditions: 95°C for 5 min; 95°C for 15 s; 60°C for 15 s; 72°C for 30 s; 30 cycles; 72°C for 10 min.

[0068] Step 3: The knockout plasmid pB021-05 and the mutant downregulation plasmid pB021-06 constructed in Step 1 were respectively introduced into the recipient *Streptomyces cordata* modified strain B021-2 via conjugation transfer for homologous recombination. Correct conjugates were screened by antibiotic resistance, PCR, and sequencing verification, resulting in the SCLAV_2489 gene knockout mutant strain B21-05 and the SCLAV_2489 mutant strain B21-06, where the 90th amino acid was changed from V to L, leading to downregulated transcriptional function. The specific steps include:

[0069] Recombinant plasmids pB021-05 and pB021-06 were each transformed into *Escherichia coli* ET12567 (pUZ8002) to obtain donor strains. The inoculated donor strains were cultured in LB medium containing 50 μg / mL ampicillin, 50 μg / mL kanamycin, and 25 μg / mL chloramphenicol at 37°C with shaking for 20 hours. Subsequently, the bacterial cells were washed with fresh LB solution to remove residual antibiotics. Fresh spores of B021-2 were collected from the plates, centrifuged at 4000 rpm for 5 minutes, the supernatant was discarded, and the spores were resuspended in 5 mL of 0.05 M TES solution (pH 8.0). The centrifuge tubes were heat-shocked in a 50°C water bath for 10 minutes, and then cooled to room temperature with tap water. 5 mL of 2× spore pre-germination medium was added, and the mixture was incubated at 37°C and 200 rpm for 3 hours. After incubation, centrifuge at 4000 rpm for 10 minutes, discard the supernatant, and rinse the spores with fresh LB solution.

[0070] The treated spores were mixed with the donor strain at a ratio of approximately 1:10 and evenly spread on MS solid medium containing 10 mM MgCl2, and incubated at 37°C for 20 hours. Then, thiostreptin (final concentration 12.5 μg / mL) and nalidixin (final concentration 40 μg / mL) were mixed in 1 mL of sterile water and spread on the surface of the MS solid medium. After the medium dried, it was transferred to a 30°C incubator and inverted for further incubation. Conjugates typically appeared on the plates after 3 to 5 days. These conjugates were then transferred to MS solid medium containing the same concentrations of thiostreptin and nalidixin for further incubation. Single-exchange strains were obtained through mycelial PCR verification and screening. The obtained single-exchange strains were spread on antibiotic-free MS plates and incubated at 30°C for 10 days. Collect spores from the plate, dilute them a certain factor, spread them on antibiotic-free MS solid medium, and continue culturing at 30°C for 4 days to obtain single colonies. Identify them using PCR with the identification primers check-F / check-R, and then sequence them. Figure 1 and Figure 2As shown, the mutant strain B021-05 with the SCLAV_2489 gene knocked out and the mutant strain B021-06 with the 90th amino acid of SCLAV_2489 changed from V to L were confirmed.

[0071] The PCR system and conditions used in the third step to verify and screen mutant strains are as follows:

[0072] PCR system: DNA template 10~100 ng, primer 10 pmol, 50% DMSO 2 μL, 2×Mix buffer 10 μL, add pure water to make up to 20 μL;

[0073] PCR conditions: 95°C for 10 min; 9°C for 15 s; 60°C for 15 s; 72°C for 30 s; 30 cycles; 72°C for 10 min.

[0074] The primer sequences used in the third step are:

[0075] Primer name Base sequence check-F GATCACCGGCCTGCCCACCAC check-R TGTAGGTGGAGCCAGCGAGG

[0076] Example 2: Shake-flask fermentation of engineered bacteria B021-05 and B021-06

[0077] This embodiment uses shake-flask fermentation to investigate the clavulanic acid fermentation capacity of mutant strains B021-05 and B021-06. The specific steps are as follows: Mutant strains B021-05 and B021-06, as well as the starting strain B021-2 (used as a control), were respectively plated on solid MS medium for activation. After culturing at 30°C for 14 days, half-plates of spores were scraped and inoculated into seed culture medium. The culture was carried out at 25°C and 200-250 rpm for 48 hours. The inoculum was then transferred to fermentation medium at a rate of 10%, and fermented at 25°C and 200-250 rpm for 120 hours. The fermentation broth was collected for clavulanic acid detection.

[0078] Take 1 mL of fermentation broth from each shake flask, centrifuge at 12000 rpm for 10 min, collect the supernatant, dilute appropriately, filter through a membrane, and analyze using liquid chromatography. See results below. Figure 3 .

[0079] Compared to the original strain B021-2, the clavulanic acid fermentation capacity of mutant strain B021-05 increased by 21.6%; while the clavulanic acid fermentation capacity of mutant strain B021-06 increased by 25.5%.

[0080] Example 3: Knockout of the SCLAV_4219 gene in strain B021-2

[0081] In this embodiment, a frameshift mutation was introduced by deleting base A at 3272 in the SCLAV_4219 gene in B021-2, causing premature termination of translation and inactivation of the enzyme SCLAV_4219, resulting in the mutant strain B021-07. The specific process is described below.

[0082] Step 1: Constructing the knockout plasmid pB021-07: Using B021-2 genomic DNA as a template, the upstream homologous arm S5 of SCLAV_4219 was amplified using primers up7-F / up7-R, and the downstream homologous arm S6 of SCLAV_4219 was amplified using primers down7-F / down7-R. The plasmid was then cloned into the site of plasmid pJTU1278 using a one-step cloning method to obtain plasmid pB021-07.

[0083] The primer sequences used in the first step are as follows:

[0084] Primer name Base sequence up7-F ggagctccaccgcggtggcggccgctctagaCAGCACACCCTCACCACGCAGACCC up7-R CTTCAGCGCGGGGGTGATCCGGGGGCCCACGTCTGGCGGAGACGGCCGTC down7-F CCCCCGGATCACCCCCGCGCTGAAG down7-R ccctcgaggtcgacggtatcgataagcttGTGGTGGTGGTCAGGCCCTCGTCGG

[0085] The PCR system and conditions used in the first step of gene fragment preparation are as follows:

[0086] PCR reaction system: DNA template 30 ng, primer 20 pmol, 50% DMSO 4 μL, PrimerSTAR max, add pure water to make up to 50 μL;

[0087] PCR conditions: 95°C for 5 min; 95°C for 15 s; 60°C for 15 s; 72°C for 30 s; 30 cycles; 72°C for 10 min.

[0088] Step 2: The knockout plasmid pB021-07 obtained in Step 1 was introduced into the recipient bacterium B021-2 via conjugation transfer for homologous recombination. Correct conjugates were screened using antibiotic resistance, PCR, and sequencing to obtain the mutant strain B21-07 with the deletion of base A at nucleotide 3272 of SCLAV_4219. The specific steps include:

[0089] The recombinant plasmid pB021-07 was transformed into *Escherichia coli* ET12567 (pUZ8002) to obtain the donor strain. The inoculated donor strain was cultured in LB medium containing 50 μg / mL ampicillin, 50 μg / mL kanamycin, and 25 μg / mL chloramphenicol at 37°C with shaking for 20 hours. Subsequently, the bacterial cells were washed with fresh LB solution to remove residual antibiotics. Fresh spores of B021-2 were collected from the plates, centrifuged at 4000 rpm for 5 minutes, the supernatant was discarded, and the spores were resuspended in 5 mL of TES solution (0.05 M, pH 8.0). The centrifuge tubes were heat-shocked in a 50°C water bath for 10 minutes, and then cooled to room temperature with tap water. 5 mL of 2× spore pre-germination medium was added, and the mixture was incubated at 37°C and 200 rpm for 3 hours. After incubation, centrifuge at 4000 rpm for 10 minutes, discard the supernatant, and rinse the spores with fresh LB solution.

[0090] The treated spores were mixed with the donor strain at a ratio of approximately 1:10 and evenly spread on MS solid medium containing 10 mM MgCl2, and incubated at 37°C for 20 hours. Then, thiostreptin (final concentration 12.5 μg / mL) and nalidixin (final concentration 40 μg / mL) were mixed in 1 mL of sterile water and spread on the surface of the MS solid medium. After the medium dried, it was transferred to a 30°C incubator and inverted for further incubation. Conjugates typically appeared on the plates after 3 to 5 days. These conjugates were then transferred to MS solid medium containing the same concentrations of thiostreptin and nalidixin for further incubation. Single-exchange strains were obtained through mycelial PCR verification and screening. The obtained single-exchange strains were spread on antibiotic-free MS plates and incubated at 30°C for 10 days. Collect spores from the plate, dilute them a certain factor, spread them on antibiotic-free MS solid medium, and continue culturing at 30°C for 4 days to obtain single colonies. Identify them by PCR using the identification primers check-F / check-R, and then sequence them. See [link to relevant documentation]. Figure 4 We have confirmed that strain B021-07 of SCLAV_4219 with a deletion of base A at number 3272 has been obtained.

[0091] The PCR system and conditions used in the second step to verify and screen mutant strains are as follows:

[0092] PCR system: DNA template 10~100 ng, primer 10 pmol, 50% DMSO 2 μL, 2×Mix buffer 10 μL, add pure water to make up to 20 μL;

[0093] PCR conditions: 95°C for 10 min; 9°C for 15 s; 60°C for 15 s; 72°C for 30 s; 30 cycles; 72°C for 10 min.

[0094] The primer sequences used in the second step are:

[0095] Primer name Base sequence check7-F GGTCTCCACGGTCACCACCC check7-R GACCTCGTCGGCGGGGAAGA

[0096] Example 4: Shake-flask fermentation of engineered strain B021-07

[0097] This embodiment uses shake-flask fermentation to investigate the clavulanic acid fermentation capacity of mutant strain B021-07. The specific steps are as follows: mutant strain B021-07 and its control strain B021-2 were plated on solid MS medium for activation. After culturing at 30°C for 14 days, half a plate of spores were scraped and inoculated into seed culture medium. The culture was carried out at 25°C and 200-250 rpm for 48 hours. The inoculum was then transferred to fermentation medium at a rate of 10%, and fermented at 25°C and 200-250 rpm for 120 hours. The fermentation broth was collected for clavulanic acid detection.

[0098] Take 1 mL of fermentation broth from each shake flask, centrifuge at 12000 rpm for 10 min, collect the supernatant, dilute appropriately, filter through a membrane, and analyze using liquid chromatography. See results below. Figure 5 .

[0099] Compared to the original strain B021-2, the clavulanic acid fermentation capacity of the mutant strain B021-07 was increased by 30.7%.

[0100] The specific embodiments of the present invention have been described above, but the scope of protection of the present invention is not limited to the specific embodiments described above. Those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the substantive content of the present invention.

Claims

1. Application of MarR family transcriptional regulator SCLAV_2489 (GeneBank ID EFG07562.1) and phospholipase A2 (PLA2) gene SCLAV_4219 (GeneBank ID EFG09293.1) as targets for improving clavulanic acid fermentation yield.

2. The application as described in claim 1, which is a method for increasing the fermentation yield of clavulanic acid by a bacterial strain, characterized in that, The process includes the following steps: downregulating, inactivating, weakening, or knocking out the expression of the gene SCLAV_2489 (GeneBank ID EFG07562.1) or the gene SCLAV_4219 (GeneBank ID EFG09293.1) in the genome of clavulanic acid-producing bacteria.

3. The application as described in claim 2, characterized in that, The clavulanic acid producing bacterium is *Streptomyces clavuligerus*, preferably *Streptomyces clavuligerus* ATCC 27064 and its derivative strains, wherein the derivative strains are mutant strains reported in patent documents with publication numbers CN117925669A, CN118006655A, CN118995708A and CN119799755A.

4. The application as described in claim 2, characterized in that, Genes SCLAV_2489 (GeneBank ID EFG07562.1) and SCLAV_4219 (GeneBank ID EFG09293.1) can be used as modification targets simultaneously, or one can be chosen as a modification target alone.

5. The application as described in claim 2, characterized in that, Downregulation, inactivation, weakened function, or knockout of the SCLAV_2489 or SCLAV_4219 genes are performed in the following ways: (1) Knock out the SCLAV_2489 gene or the SCLAV_4219 gene from the chromosome of the starting strain; (2) Downregulate or interfere with the expression of the SCLAV_2489 gene or the SCLAV_4219 gene in the chromosome of the starting strain; (3) Replace the SCLAV_2489 gene or SCLAV_4219 gene in the chromosome of the starting strain with a SCLAV_2489 gene or a SCLAV_4219 gene mutant whose coding function is lost or downregulated.

6. The application as described in claim 5, characterized in that, Method (2) is selected from the following group: (2-1) Mutations in the promoter region and / or coding region of the SCLAV_2489 or SCLAV_4219 gene lead to downregulation of the expression level of the SCLAV_2489 or SCLAV_4219 gene; (2-2) Mutations in the upstream regulators of the SCLAV_2489 or SCLAV_4219 genes lead to downregulation of the expression levels of the SCLAV_2489 or SCLAV_4219 genes; or (2-3) Introduce SCLAV_2489 or SCLAV_4219 interacting proteins into wild-type strains to alter the function of the SCLAV_2489 or SCLAV_4219 genes. (2-4) Silencing the SCLAV_2489 or SCLAV_4219 gene using siRNA or dsRNA via RNAi technology.

7. The application as described in claim 6, characterized in that, The mutation in the coding region described in method (2-1) is a frameshift mutation, which leads to the inactivation or loss of function of SCLAV_2489 or SCLAV_4219.

8. The application as described in claim 5, characterized in that, The methods (1), (2), (3) and / or (4) are implemented through gene editing technology, antisense nucleic acid, and transcriptional regulation.

9. A rod-shaped engineered Streptomyces strain, characterized in that, Downregulation, inactivation, weakened function, or knockout of the SCLAV_2489 gene (GeneBank ID EFG07562.1) or the SCLAV_4219 gene (GeneBank ID EFG09293.1) in the genome.

10. The use of the engineered Streptomyces rotaforme strain as described in claim 9 in the fermentation production of clavulanic acid.

Images