Agrobacterium tumefaciens-mediated sainfoin genetic transformation method
By using Agrobacterium-mediated transformation, the hypocotyl of *Lysimachia foenum-graecum* was optimized as an explant, and the culture medium and infection conditions were optimized to solve the problem of weak regeneration ability of *Lysimachia foenum-graecum*, achieving efficient genetic transformation and regeneration, and obtaining transgenic plants.
Patent Information
- Application Number
- CN202511629925.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-08
- Publication Date
- 2026-02-06
AI Technical Summary
Red clover has a weak regeneration ability during genetic transformation, especially the root system is difficult to induce, resulting in a low regeneration rate after infection and making it difficult to obtain mature transgenic plants.
Using Agrobacterium-mediated transformation, hypocotyls of sterile *Ormosia henryi* seedlings were used as explants. By optimizing the culture medium formula and infection conditions, callus formation was induced. After pre-culture, *Agrobacterium* was infecting the callus, and co-culture was carried out to restore regeneration. The callus was then cultured under light on a regeneration screening medium to obtain rooted regenerated plants, which were then subjected to molecular detection.
A stable genetic transformation system for red clover was established, which improved the transformation efficiency and regeneration rate, and transgenic plants were obtained in a short period of time, filling the gap in the genetic transformation of red clover.
Smart Images
Figure CN121472320A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of plant genetic transformation, in particular to a method for Agrobacterium-mediated genetic transformation of Onobrychis viciaefolia. BACKGROUND
[0002] Onobrychis viciaefolia, also known as horse food bean and horse food grass, is a kind of excellent perennial leguminous forage. It has high yield, hollow stem, rich in protein and other nutrients, and its nutritional value can be comparable to that of alfalfa. In addition, Onobrychis viciaefolia has the characteristics of nitrogen fixation, cold tolerance, drought tolerance, disease resistance and fast growth, and can be used for green feed, grazing, making silage, drying green grass, processing grass powder and compound feed, etc. In addition, it also has the advantages of soil and water conservation, rich honey source, etc., and has both production value and ecological value.
[0003] At present, there are certain studies on the physiological and biochemical characteristics, cultivation and planting techniques of Onobrychis viciaefolia, but its regeneration ability is weak, especially the root system induction is difficult, which limits its research in transgenic and genetic transformation. Due to the lack of Onobrychis viciaefolia germplasm resources at present, it seriously restricts the in-depth research. Therefore, it is urgent to genetically improve Onobrychis viciaefolia by biotechnology to obtain more Onobrychis viciaefolia germplasm resources.
[0004] There are experimental methods for obtaining regenerated plants by using Onobrychis viciaefolia hypocotyl explants in the prior art, but further genetic transformation is lacking. When the genetic transformation of Onobrychis viciaefolia callus is carried out, the regeneration rate after infection decreases, the infection efficiency is low, and it is difficult to obtain mature transgenic Onobrychis viciaefolia plants. SUMMARY
[0005] In order to overcome the shortcomings and deficiencies of the prior art, the purpose of the present application is to provide an Agrobacterium-mediated genetic transformation method of Onobrychis viciaefolia.
[0006] The technical scheme provided by the present application is as follows: An Agrobacterium-mediated genetic transformation method of Onobrychis viciaefolia, the method comprising the following steps: (1) Preparation of Onobrychis viciaefolia sterile seedlings: after disinfection treatment of Onobrychis viciaefolia seeds, the seeds are placed in 1 / 2 MS solid medium to obtain the required Onobrychis viciaefolia sterile seedlings; (2) Preparation of explants: 5-8 cm hypocotyls are obtained from the Onobrychis viciaefolia sterile seedlings, and the hypocotyls are cut into 5 mm small pieces to obtain the required Onobrychis viciaefolia explants; (3) Induction culture: the Onobrychis viciaefolia explants are placed in an induction culture medium and cultured at 25±1℃ in the dark for 7 days to obtain Onobrychis viciaefolia callus; (4) Pre-culture: the Onobrychis viciaefolia callus is transferred to a pre-culture medium and cultured at 25±1℃ in the dark for 2-3 days to obtain pre-cultured callus; (5) Infection and co-culture: the explant is immersed in the Agrobacterium infection solution, the surface water of the explant is absorbed after the infection is completed, and the explant is placed in a co-culture medium and cultured at 25±1°C in the dark for 3 days to obtain a co-cultured callus; (6) Regeneration recovery culture: the co-cultured explant is transferred to a regeneration recovery medium and cultured at 25±1°C in the dark for 7 days to obtain a recovery cultured callus; (7) Regeneration screening culture: the recovery cultured explant is transferred to a regeneration screening medium and cultured at 25±1°C under illumination for 4-8 weeks to obtain a regenerated adventitious bud; (8) Rooting culture: the adventitious bud is transferred to a rooting medium and cultured at 25±1°C under illumination for 4-8 weeks until the plant height is greater than or equal to 5 cm to obtain a rooted regenerated Adenocaulon himalaicum plant; (9) Molecular detection: part of the leaf tissue of the regenerated plant is taken, DNA is extracted, and specific primers are used for PCR detection to obtain a transgenic Adenocaulon himalaicum positive plant.
[0007] Preferably, in step (1), the components of the 1 / 2 MS solid medium are: 2.22 g / L MS+30 g / L sucrose+3.5 g / L plant gel, and the pH is adjusted to 5.8.
[0008] Preferably, in step (3), the components of the induction medium are: 4.43 g / L MS+30 g / L sucrose+3.5 g / L plant gel+1.5 mg / L 2,4-D+0.4 mg / L 6-BA, and the pH is adjusted to 5.8.
[0009] Preferably, in step (4), the components of the pre-culture medium are: 4.43 g / L MS+30 g / L sucrose+3.5 g / L plant gel+1.5 mg / L 2,4-D+0.4 mg / L 6-BA+100-200 µM / L acetosyringone, and the pH is adjusted to 5.8.
[0010] Preferably, in step (5), the components of the infection solution are: 4.43 g / L MS+30 g / L sucrose+1.5 mg / L 2,4-D+0.4 mg / L 6-BA+100-200 µM / L acetosyringone, and the pH is adjusted to 5.8; The components of the co-culture medium are: 4.43 g / L MS+30 g / L sucrose+3.5 g / L plant gel+1.5 mg / L 2,4-D+0.4 mg / L 6-BA+100-200 µM / L acetosyringone, and the pH is adjusted to 5.8.
[0011] Preferably, in step (5), the Agrobacterium is EHA105; the conditions for infecting with Agrobacterium infection solution are as follows: place the callus in the infection solution, vacuum for 10 minutes at 0.08 MPa, gently shake in a shaker at 120 rpm for 30 minutes, wash three times with sterile water, air dry, and place in a co-culture medium.
[0012] Preferably, in step (6), the regeneration and recovery culture medium consists of: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1 mg / L ZT + 0.5 mg / L 6-BA + 200 mg / L cephalosporin + 200 mg / L termethin, with the pH adjusted to 6.4.
[0013] Preferably, in step (7), the regeneration screening medium consists of: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1 mg / L ZT + 0.5 mg / L 6-BA + 200 mg / L cephalosporin + 200 mg / L termethin + 10 mg / L hygromycin (resistance gene carried by the vector), with the pH adjusted to 6.4.
[0014] Preferably, in step (8), the rooting medium consists of: 2.3 g / L WPM + 20 g / L sucrose + 4 g / L plant gel, with the pH adjusted to 6.4.
[0015] This invention further discloses a method for cultivating transgenic red bean grass, wherein the transgenic red bean grass is prepared according to the above-mentioned genetic transformation method.
[0016] This invention overcomes the shortcomings of the prior art and provides an Agrobacterium-mediated genetic transformation method for red clover. The method uses the hypocotyl of sterile red clover seedlings as explants to induce callus production. After pre-culture, Agrobacterium infection is performed, followed by co-culture and dark recovery regeneration culture. Then, the plant is transferred to a regeneration selection medium for light culture to induce the regeneration of adventitious shoots. After rooting culture, rooted red clover regenerated plants are obtained. Molecular detection reveals transgenic red clover plants infused with the target gene.
[0017] In this invention, hypocotyls are used as explants to induce callus tissue for transformation. The culture medium formula and infection conditions are optimized to ensure that the explants produce callus quickly and with a high callus rate. After infection and recovery culture, the callus tissue differentiates quickly and in large quantities, and the transformation efficiency is high. This provides important technical support for the precise improvement and germplasm innovation of *Gynostemma pentaphyllum*.
[0018] The beneficial effects of this invention after adopting the above technical solution are as follows: (1) This invention explores and optimizes the treatment methods and culture conditions in the transformation process through experiments, and successfully establishes a stable Agrobacterium-mediated genetic transformation system for red bean grass callus, filling the gap in the genetic transformation system of red bean grass; (2) The genetic transformation method of the present invention has high transformation efficiency and short transformation cycle, and transgenic plants can be obtained in as little as 120 days. Attached Figure Description
[0019] Figure 1 This refers to the callus tissue of *Hedyotis diffusa* obtained after induction with an induction medium. Figure 2 The callus tissue of *Corydalis yanhusuo* in the infection solution; Figure 3 The red bean grass callus tissue after two weeks of regeneration and screening following infection; Figure 4 These are red bean grass resistant shoots obtained after screening using a screening medium; Figure 5 The rooted regenerated plants of *Eriocaulon buergerianum* obtained after culturing on a rooting medium; Figure 6 These are transgenic red bean grass plants that were transplanted into nutrient soil after hardening off; Figure 7 To detect GFP fluorescence in transgenic red bean grass plants; Figure 8 To perform PCR molecular detection on root-regenerated plants of *Eriocaulon buergerianum*. Detailed Implementation
[0020] The technical solution of the present invention will be further described in detail below with reference to specific embodiments, but this does not constitute any limitation on the present invention.
[0021] As used in this article, “MS” refers to the culture medium developed by Murashige & Skoog, purchased from PhytoTech Labs®, catalog number M519; “1 / 2MS” refers to the culture medium obtained by reducing all components of MS medium to half their original amount. As used in this article, “WPM medium” is the abbreviation for Lloyd & McCown woody plant culture medium, purchased from PhytoTech Labs®, catalog number L449.
[0022] Example 1: High-efficiency genetic transformation of red bean grass 1. Construction of genetic transformation expression vectors Using pGWB505 as a template, product A (EGFP) was amplified using primer F1+R1 (as shown below), and its nucleotide sequence is shown in SEQ ID NO:1 below: GGAGAGAACACGGGGGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGGGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGGGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAAAAAAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGGACATCTTTTACCCATACG。
[0023] The vector pGWB514 was double-digested with the restriction enzymes XbaI and PacI and ligated with Product A to obtain a genetic transformation expression vector (i.e., the target gene vector, which contains the HygB resistance gene); F1: 5’-GGAGAGAACACGGGGGACATGGTGAGCAAGGGCGAG-3’ (SEQ ID NO:2); R1: 5’-CGTATGGGTAAAAGATGTCCTTGTACAGCTCGTCCATGCC-3’ (SEQ ID NO:3).
[0024] 2. Agrobacterium-mediated transformation This experiment was used to construct Agrobacterium containing a target gene vector and a marker gene (HygB resistance gene), and specifically included the following operations: Transformation of Agrobacterium tumefaciens EHA105 with the target gene vector: Remove EHA105 competent cells (Sangon®, Cat: B528432) from the -80℃ freezer and thaw them on ice; add 100 ng of the target gene vector (obtained in step 1 above) to 100 µL of EHA105 competent cells, place on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37℃ water bath for 5 minutes, and then place on ice for 5 minutes; add 500 µL of antibiotic-free liquid LB medium, and incubate at 28℃ for 2 hours at 200 rpm in a shaker; spread 50 µL of the bacterial culture onto LB solid medium containing spectinomycin (100 mg / L) and rifampin (20 mg / L), and incubate upside down at 28℃ for 2 days. After the colonies have grown, select a single positive clone and place it into liquid LB medium containing spectinomycin (100 mg / L) and rifampin (20 mg / L). Incubate at 28°C and 180 rpm for 16 h. The resulting bacterial culture is Agrobacterium culture transformed by the target gene vector. It can be stored in a -80°C freezer using 50% glycerol at a 1:1 volume ratio.
[0025] 3. Specific operational steps of genetic transformation 3.1 Preparation of aseptic seedlings of *Corydalis yanhusuo* Place the red bean grass seeds in a 50ml centrifuge tube and sterilize with 20ml of 75% ethanol for 3 minutes, inverting the tube several times during the process. Wash the seeds 2-3 times with sterile water. Then, soak the seeds in 20ml of 2% sodium hypochlorite for 5 minutes, inverting the tube several times during the process. Wash the seeds 3 times with sterile water. After sterilization, soak the seeds in 30ml of sterile water for 30 minutes to allow them to fully absorb water and swell. After soaking, continue to wash the seeds with sterile water 1-2 times. Place the seeds on sterilized filter paper and air dry the surface moisture.
[0026] The dried seeds were inoculated onto 1 / 2 MS solid plate medium (medium composition: 2.22 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel, pH adjusted to 5.8) and cultured in the dark at 25°C for 2-3 days. After germination, the seeds were transferred to 1 / 2 MS solid medium in tissue culture flasks and cultured in the dark at 25°C for 4-6 days until a 5-7 cm hypocotyl was formed.
[0027] 3.2 Explant Preparation The hypocotyls of the aseptic seedlings of *Corydalis yanhusuo* obtained in step 3.1 were cut into 5mm segments to be used as explants.
[0028] 3.3 Induction Culture The *Gynostemma pentaphyllum* explants obtained in step 3.2 were placed in an induction medium (medium composition: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA, pH adjusted to 5.8) and cultured in the dark at 25°C for 7 days to obtain *Gynostemma pentaphyllum* callus tissue. Figure 1 As shown.
[0029] 3.4 Pre-culture The *Eriocaulon buergerianum* callus obtained in step 3.3 was transferred to a pre-culture medium (medium composition: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA + 100~200 µM / L acetylsyringone, pH adjusted to 5.8) and cultured in the dark at 25°C for 2 days to obtain pre-cultured callus.
[0030] 3.5 Infection and Co-culture The *Agrobacterium tumefaciens* precultured callus obtained in step 3.4 was co-cultured after being infected with *Agrobacterium tumefaciens* infection solution, wherein the *Agrobacterium tumefaciens* infection solution was *Agrobacterium tumefaciens* transformed in step 2 (containing the target gene vector and marker gene HygB). The solution was shaken vigorously in 100 ml to OD. 600 = 0.3, after collecting the bacteria, resuspend and mix them in an infection solution containing 200 µM / L acetylsylgenone (components: 4.43 g / L MS + 30 g / L sucrose + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA + 200 µM / L acetylsylgenone, pH adjusted to 5.8). Place the callus tissue in the Agrobacterium infection solution, as... Figure 2 As shown. After vacuuming at 0.08 MPa for 10 minutes, the tissue was gently shaken at 120 rpm for 30 minutes. After infection, the callus tissue was placed on sterilized filter paper and the surface moisture was dried. Then, it was transferred to co-culture medium (medium composition: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA + 100~200 µM / L acetylsyleugenone, pH adjusted to 5.8) and cultured in the dark at 25°C for 3 days to obtain co-cultured callus tissue.
[0031] 3.6 Regeneration and Recovery Culture The co-cultured callus tissue obtained in step 3.5 was transferred to regeneration and recovery medium (medium composition: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1 mg / L ZT + 0.4 mg / L 6-BA + 200 mg / L cephalosporin + 200 mg / L termethin, pH adjusted to 6.4) and cultured in the dark at 25°C for 7 days to obtain the recovered callus tissue.
[0032] 3.7 Regeneration Screening Culture The *Ormosia rubescens* callus tissue obtained in step 3.6 was transferred to regeneration screening medium (medium composition: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1 mg / L ZT + 0.5 mg / L 6-BA + 200 mg / L cephalosporin + 200 mg / L termethin + 10 mg / L hygromycin, pH adjusted to 6.4) and cultured at 25°C under light until adventitious shoots reached 1-3 cm. The medium was changed after 4 weeks, removing any dead callus tissue during the change. Figure 3 As shown, the surviving callus tissue was transferred to a new regeneration selection medium and cultured for another 4–8 weeks. Figure 4 As shown.
[0033] 3.8 Rooting Culture The regenerated adventitious shoots of *Lysimachia foenum-graecum* obtained in step 3.7 were transferred to a rooting medium (medium composition: 2.3 g / L WPM + 20 g / L sucrose + 4 g / L plant gel, pH adjusted to 6.4) and cultured at 25°C under light for 4–8 weeks to obtain rooted regenerated *Lysimachia foenum-graecum* plants. Figure 5 As shown.
[0034] 3.9. Seedling hardening The root-regenerated *Corydalis yanhusuo* plants obtained in step 3.8 were hardened off in a regular greenhouse for 7 days. The culture medium was then washed off, and the plants were transplanted into nutrient soil. Figure 6 As shown.
[0035] 4. Identification of transgenic positive plants 4.1 PCR Identification This step uses Novizan's 2×Rapid Taq Master Mix (Cat: P222-03) for conventional PCR amplification to verify whether the *Alopecurus aequalis* root-regenerated plants obtained in step 3 above are indeed *Alopecurus aequalis* root-regenerated plants transfected with the target gene vector. Specifically, PCR amplification is performed on DNA samples extracted from *Alopecurus aequalis* root-regenerated plants using the primers shown below (EGFP-F and HA-R) (reaction conditions: 95℃ 5 min, (95℃ 30 s, 55℃ 1 min, 72℃ 30 s) × 30 cycles, 72℃ 5 min). If a 766 bp sequence (EGFP-HA) can be amplified, then the *Alopecurus aequalis* root-regenerated plant is a positive transgenic *Alopecurus aequalis* plant whose genome contains the target gene vector.
[0036] EGFP-F: 5'-ATGGTGAGCAAGGGCGAG-3' (SEQ ID NO: 4); HA-R: 5'-CATAGGGATAGCCCGCATAGTC-3' (SEQ ID NO: 5).
[0037] The test results showed that in this embodiment, the regeneration rate of the 274 hypocotyls involved in the infection reached 24.81%, and a total of 64 regenerated plants of red clover were obtained. Finally, 12 positive transgenic red clover plants were identified. Therefore, the transformation efficiency of this embodiment was approximately 18.75%.
[0038] 4.2 GFP fluorescence identification Leaves of transgenic red clover (OE-GFP) from step 4.1 that showed the target band were examined under a laser confocal microscope. Using untransformed wild-type (WT) as a control, the fluorescence intensity at 488 nm was observed. Figure 7 As shown. Further confirmation revealed that the identified plants were positive for transgenic red clover.
[0039] Example 2 Example 2 follows the same procedure as Example 1, except that in the step "1. Construction of the genetic transformation expression vector" in Example 1, the nucleotide sequence SEQ ID NO:6 (GCaMP6s) is synthesized into the vector pENTR, and its nucleotide sequence is shown in SEQ ID NO:6 below:
[0040] Using the Gateway LR reaction, the target gene was constructed into the final vector pGWB514, resulting in the genetic transformation expression vector pGWB514-GCaMP6s (i.e., the target gene vector, which contains the HygB resistance gene).
[0041] In step 4, "Identification of Transgenic Positive Plants," of Example 1, the DNA sample extracted from the root-regenerated *Alopecurus aequalis* plant was specifically subjected to PCR amplification using the primers shown below (GCaMP6s-F and HA-R) (reaction conditions: 95℃ for 5 min, (95℃ for 30 s, 55℃ for 1 min, 72℃ for 30 s) × 30 cycles, 72℃ for 5 min). If a sequence with a fragment size of 1454 bp (GCaMP6s-HA) could be amplified, then the root-regenerated *Alopecurus aequalis* plant was a positive transgenic *Alopecurus aequalis* plant whose genome contained the target gene vector. Figure 8 As shown.
[0042] GCaMP6s-F: 5'-GGCTAGCATGACTGGTGGAC-3' (SEQ ID NO:7) HA-R: 5'-CATAGGGATAGCCCGCATGTC-3' (SEQ ID NO: 5) The test results showed that, with 53 regenerated plants of red clover participating in the identification, 27 positive transgenic red clover plants were finally identified. Therefore, the transformation efficiency of this example was approximately 50.94%.
[0043] Comparative Examples 1-4 Comparative Example 1 followed the same procedure as Example 1, except that the explants obtained in step 3.2 of "3. Specific Operational Steps for Genetic Transformation" in Example 1 were directly subjected to the pre-culture treatment in step 3.4, followed by the infection and co-culture treatment in step 3.5, and the recovery culture in step 3.6 was extended to 14 days. The results showed that direct infection of the explants significantly affected the callus rate and regeneration rate of the hypocotyls of *Alopecurus aequalis*. Identification revealed that the regeneration rate of *Alopecurus aequalis* treated in this manner was only 9.34%, and the genetic transformation efficiency was only 10.34%.
[0044] Comparative Example 2 followed the same procedure as Example 1, except that in step 3.5 of "3. Specific steps of genetic transformation" in Example 1, the explants were vacuumed for 10 minutes at 0.08 MPa and then left to stand at room temperature for 1 hour. The results showed that prolonging the co-culture time of the explants with the Agrobacterium infection solution affected the genetic transformation efficiency to some extent, reducing it to only 12.5%.
[0045] Comparative Example 3 followed the same procedure as Example 1, except that in Example 1, after co-culturing in step 3.5 of "3. Specific Operational Steps for Genetic Transformation," the callus tissue was washed with 400 mg / L cephalosporin solution, dried, and then transferred to step 3.6 for recovery culture. The results showed that the cephalosporin solution washing treatment reduced the genetic transformation efficiency of *Gynostemma pentaphyllum* by 11.86%.
[0046] Comparative Example 4 follows the same procedure as Example 1, except that the concentration of the Agrobacterium infection solution in step 3.5 of "3. Specific Operation Steps for Genetic Transformation" in Example 1 is adjusted to OD. 600 = 0.6. The results showed that during the subsequent three days of co-culture, Agrobacterium severely contaminated the callus tissue, and no regenerated shoots were produced.
[0047] Comparative Examples 1-4 represent attempts to modify the infection conditions of *Gynostemma pentaphyllum* callus. The results show that these modifications reduced the infection efficiency to some extent, thus demonstrating the advantages of the optimized infection conditions of this invention (see Example 1).
[0048] Comparative Examples 5-6 Comparative Example 5 follows the same procedure as Example 1, except that the composition of the regeneration medium in step 3.7 of “3. Specific steps of genetic transformation” in Example 1 is adjusted to: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1 mg / L Kinetin + 0.5 mg / L 6-BA + 1 mM AMP + 200 mg / L cephalosporin + 200 mg / L termethin + 10 mg / L hygromycin, and the pH is adjusted to 5.8.
[0049] Comparative Example 6 follows the same procedure as Example 1, except that the composition of the regeneration medium in step 3.7 of “3. Specific steps of genetic transformation” in Example 1 is adjusted to: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1 mg / L ZT + 0.5 mg / L 6-BA + 200 mg / L cephalosporin + 200 mg / L termethin + 10 mg / L hygromycin, and the pH is adjusted to 5.8.
[0050] Comparative Examples 5 and 6 represent attempts to assess the regeneration conditions of *Gnaphalium affine* callus. The results showed that when any of the regeneration media in Comparative Examples 5 and 6 was used to induce callus regeneration, fewer adventitious shoots differentiated, and the differentiation was slower. To further analyze the reasons, this invention tested whether the pH value of the regeneration medium affected the regeneration efficiency of *Gnaphalium affine*. *Gnaphalium affine* callus in the same state was transferred to regeneration media with different pH values but the same composition (4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1 mg / L ZT + 0.5 mg / L 6-BA). After one month, at pH=5.8, the regeneration efficiency was only 25% (33 / 132), while at pH=6.4, the regeneration efficiency reached 82.58% (109 / 132). This indicates that *Gnaphalium affine* is more suitable for regeneration in a medium with pH=6.4, further demonstrating the high efficiency of the regeneration medium used in this genetic transformation system.
[0051] Comparative Examples 7-10
[0052] Comparative Example 7 follows the same procedure as Example 1, except that the composition of the rooting medium in step 3.8 of “3. Specific steps of genetic transformation” in Example 1 is adjusted to: 2.22 g / L MS + 20 g / L sucrose + 4 g / L plant gel, and the pH is adjusted to 5.8.
[0053] Comparative Example 8 follows the same procedure as Example 1, except that the composition of the rooting medium in step 3.8 of “3. Specific steps of genetic transformation” in Example 1 is adjusted to: 2.22 g / L MS + 20 g / L sucrose + 4 g / L plant gel, and the pH is adjusted to 6.4.
[0054] Comparative Example 9 follows the same procedure as Example 1, except that the composition of the rooting medium in step 3.8 of “3. Specific steps of genetic transformation” in Example 1 is adjusted to: 4.33 g / L MS + 20 g / L sucrose + 4 g / L plant gel + 0.1 mg / L indole butyric acid, and the pH is adjusted to 5.8.
[0055] Comparative Example 10 follows the same procedure as Example 1, except that the composition of the rooting medium in step 3.8 of “3. Specific steps of genetic transformation” in Example 1 is adjusted to: 2.3 g / L WPM + 20 g / L sucrose + 4 g / L plant gel, and the pH is adjusted to 5.8.
[0056] Comparative Examples 7-10 represent attempts to assess the rooting conditions of regenerated adventitious shoots of *Hedysarum heterotropoides*. The results showed that when any of the rooting media in Comparative Examples 7-10 were used to induce rooting of the regenerated adventitious shoots, root differentiation was either absent or extremely slow (3-4 months). In contrast, the rooting media in Example 1 enabled rooting to be completed within 3 weeks, thus more effectively promoting the rapid rooting of adventitious shoots of *Hedysarum heterotropoides*.
[0057] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. An Agrobacterium-mediated genetic transformation method for red clover, characterized in that, The method includes the following steps: (1) Preparation of sterile seedlings of red bean grass: After disinfection, red bean grass seeds were placed in 1 / 2 MS solid medium to obtain the required sterile seedlings of red bean grass; (2) Explant preparation: Obtain 5-8 cm hypocotyls from the sterile seedlings of the red clover and cut them into 5 mm segments to obtain the required red clover explants; (3) Induction culture: The explants of *Hedyotis diffusa* were placed in an induction culture medium and cultured at 25±1℃ in the dark for 7 days to obtain *Hedyotis diffusa* callus tissue; (4) Pre-culture: The red bean grass callus was transferred to a pre-culture medium and cultured at 25±1℃ in the dark for 2-3 days to obtain pre-cultured callus; (5) Infection and co-culture: The explants were infected with Agrobacterium infection solution. After infection, the surface moisture of the explants was dried and placed in co-culture medium. The explants were cultured at 25±1℃ in the dark for 3 days to obtain co-cultured callus tissue. (6) Regeneration and recovery culture: The co-cultured explants were transferred to regeneration and recovery culture medium and cultured at 25±1℃ in the dark for 7 days to obtain the recovered callus tissue; (7) Regeneration and screening culture: The restored culture explants were transferred to the regeneration and screening culture medium and cultured at 25±1℃ under light conditions for 4 to 8 weeks to obtain regenerated adventitious shoots; (8) Rooting culture: The adventitious buds are transferred to the rooting culture medium and cultured at 25±1℃ and under light conditions for 4 to 8 weeks until the plant height is ≥5cm, thus obtaining the rooted regenerated plants of red bean grass; (9) Molecular detection: Take some leaf tissue from the regenerated plant, extract DNA, and perform PCR detection with specific primers to obtain transgenic red bean grass positive plants.
2. The method as described in claim 1, characterized in that, In step (1), the composition of the 1 / 2 MS solid culture medium is: 2.22 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel, and the pH is adjusted to 5.
8.
3. The method as described in claim 1, characterized in that, In step (3), the induction medium consists of: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA, with the pH adjusted to 5.
8.
4. The method as described in claim 1, characterized in that, In step (4), the pre-culture medium consists of: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA + 100~200µM / L acetylsuccinone, with the pH adjusted to 5.
8.
5. The method as described in claim 1, characterized in that, In step (5), the composition of the infiltration solution is: 4.43 g / L MS + 30 g / L sucrose + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA + 100~200 µM / L acetylsuccinone, and the pH is adjusted to 5.8; The co-culture medium consisted of: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA + 100~200 µM / L acetylsylgenone, with the pH adjusted to 5.
8.
6. The method as described in claim 5, characterized in that, In step (5), the Agrobacterium is EHA105; the conditions for infecting with Agrobacterium infection solution are as follows: place the callus in the infection solution, vacuum at 0.08 MPa for 10 minutes, gently shake at 120 rpm for 30 minutes, wash three times with sterile water, air dry, and place in co-culture medium.
7. The method as described in claim 1, characterized in that, In step (6), the regeneration and recovery culture medium consists of: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1 mg / L ZT + 0.5 mg / L 6-BA + 200 mg / L cephalosporin + 200 mg / L termethin, with the pH adjusted to 6.
4.
8. The method as described in claim 1, characterized in that, In step (7), the regeneration screening medium consists of: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 1 mg / L ZT + 0.5 mg / L 6-BA + 200 mg / L cephalosporin + 200 mg / L termethin + 10 mg / L hygromycin, with the pH adjusted to 6.
4.
9. The method as described in claim 1, characterized in that, In step (8), the rooting medium consists of 2.3 g / L WPM + 20 g / L sucrose + 4 g / L plant gel, with the pH adjusted to 6.
4.
10. A method for cultivating transgenic red clover, characterized in that, The method described herein is to prepare transgenic red bean grass according to the genetic transformation method described in any one of claims 1 to 9.