Molecular marker combination related to indica-japonica rice cross fertility and application of molecular marker combination

Abstract

The invention relates to the technical field of plant breeding, in particular to a molecular marker combination related to indica-japonica rice cross fertility and application of the molecular marker combination. The molecular marker combination comprises the following components: SaM-1235, SaF-6434K, Sc-1847, HSA1a-7551, F5-1005, DPL2-1347, Duyao-F2, Duyao-F60T, Jiyao-F2, Jiyao-I33L, Jiyao-K115E, Jiyao-K115Q, Jiyao-N114S, Jiyao-T474K, S5-9611, and S7-7581, and is characterized in that the molecular marker combination comprises the following components: Sc-1235, SaF-6434K, Sc-1847, HSA1a-7551, F5-1005, DPL2-1347, Duyao-F2 The molecular marker combination provided by the invention can be used for comprehensively and systematically detecting the type, quantity and combination of indica-japonica hybrid fertility genes carried by existing rice varieties and resources, and further can be applied to directional improvement of the hybrid fertility of the indica-japonica rice varieties.

Description

Technical Field

[0001] This invention relates to the field of plant breeding technology, and in particular to a molecular marker combination related to the fertility of indica-japonica rice and its application. Background Technology

[0002] Rice is one of the most important staple foods today. Improving the production potential of rice varieties through modern molecular breeding techniques is an effective way to cultivate high-quality, high-yield rice. High-quality germplasm resources are the foundation and prerequisite for achieving breakthroughs in high-quality, high-yield breeding potential. Strong heterosis exists between indica and japonica subspecies, and directly or indirectly utilizing this heterosis is one of the important methods in super hybrid rice breeding. However, the F1 generation of hybrids between indica and japonica subspecies usually exhibits partial sterility, thus limiting the effective utilization of their strong heterosis in production. Currently, the indica-japonica hybrid rice varieties widely used in production, such as the Yongyou series, Chunyou series, and Jiayou Zhongke series, are typical indica-japonica hybrid varieties, containing many beneficial genes such as the wide-compatibility gene S5-n, the ideal plant type gene IPA1, the semi-dwarf gene Sd1, and the Wxb gene, which can be utilized. Among them, the wide-compatibility gene S5-n is widely used in the utilization of heterosis in indica-japonica rice.

[0003] As the range of breeding parents expands, researchers have discovered that some hybrid combinations, even with one parent being a widely compatible variety carrying the S5-n gene, still exhibit semi-sterility in their F1 hybrids. Therefore, relying solely on the widely compatible S5-n gene cannot completely solve the problem of semi-sterility in hybrids between indica and japonica subspecies. Using indica-japonica hybrid rice as the base material can expand the genetic basis of breeding materials and is an effective way to create new germplasm resources. This is of great significance for improving the utilization efficiency of hybrids and promoting rice breeding. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a combination of molecular markers related to the fertility of indica and japonica rice and their applications.

[0005] In a first aspect, the present invention provides a molecular marker combination comprising: SaM-1235, SaF-6434K, Sc-1847, HSA1a-7551, F5-1005, DPL2-1347, Duyao-F2, Duyao-F60T, Jieyao-F2, Jieyao-I33L, Jieyao-K115E, Jieyao-K115Q, Jieyao-N114S, Jieyao-T474K, S5-9611, and S7-7581; based on genomic version IRGSP1.0, The SaM-1235 includes: the C / A genotype at position 22381235 on chromosome 1; The SaF-6434K includes: the C / T genotype at position 22376434 on chromosome 1; The Sc-1847 includes: the A / G genotype at position 7791847 on chromosome 3; The HSA1a-7551 includes the G / T genotype at position 24647551 on chromosome 12; The F5-1005 includes the T / G genotype at position 1451005 on chromosome 5; The DPL2-1347 includes the C / T genotype at position 4201347 on chromosome 1; The Duyao-F2 includes: the presence or absence of the Duyao gene; The Duyao-F60T includes the TT / AC genotype of the first and second nucleotides of codon 60 in the coding region of the Duyao gene; The Jieyao-F2 includes: the presence or absence of the Jieyao gene; The Jieyao-I33L includes: the A / C genotype of the first nucleotide of codon 33 in the coding region of the Jieyao gene; The Jieyao-K115E includes: the A / G genotype of the first nucleotide of codon 115 in the coding region of the Jieyao gene; The Jieyao-K115Q includes: the A / C genotype of the first nucleotide of codon 115 in the coding region of the Jieyao gene; The Jieyao-N114S includes: the AA / TC genotype of the first and second nucleotides of codon 114 in the coding region of the Jieyao gene; The Jieyao-T474K includes the AA / CG genotype of the second and third nucleotides of codon 474 in the coding region of the Jieyao gene; The S5-9611 includes: an Indel mutation at position 5759611 on chromosome 5, with an allele of TCGCTCCTACGAATCCTGCCCCTGAGTAACAATGACTGACTTTTAATTTGTTTGCAGCTAGGGTGGGGATCGAGATGGTGATCTTGGAGCAGCCACAGCTGCTCCTTCTTCTTCTTCTTCTTCTTCTTGTAGCAGCTGCAGCTGCAA or TTAAT; The S7-7581 includes the C / T genotype at position 15787581 on chromosome 7.

[0006] Secondly, the present invention provides a primer combination for amplifying the aforementioned molecular marker combination. Preferably, the primer combination comprises the nucleotide sequence shown in SEQ ID NO.1-50.

[0007] For SaM-1235, SaF-6434K, Sc-1847, HSA1a-7551, F5-1005, DPL2-1347, Duyao-F2, Duyao-F60T, Jieyao-F2 , Jieyao-I33L, Jieyao-K115E, Jieyao-K115Q, Jieyao-N114S, Jieyao-T474K, S5-9611 and S7-7581, using SEQ in order ID No.1-3, SEQ ID No.4-6, SEQ ID No.7-9, SEQ ID No.10-12, SEQ ID No.13-15, SEQ ID No.16-18, SEQ ID No.19-22, SEQ ID No.23-25, SEQ ID No.26-29, SEQ ID No.30-32, SEQ ID No.33-35, SEQ Amplification was performed using primer pairs shown in SEQ ID No. 36-38, SEQ ID No. 39-41, SEQ ID No. 42-44, SEQ ID No. 45-47, and SEQ ID No. 48-50.

[0008] Furthermore, in each primer combination, the two forward primers carry different fluorescent tags, such as FAM or HEX.

[0009] Thirdly, the present invention provides a kit comprising the aforementioned molecular marker combination or the aforementioned primer combination.

[0010] Fourthly, the present invention provides the application of the aforementioned molecular marker combination as a target in any of the following: (1) Genotyping of indica-japonica rice fertility genes; (2) Detection of allelic functional variations of rice indica-japonica hybridization genes; (3) Predicting the fertility of indica-japonica rice; (4) Improve the fertility of indica and japonica rice; (5) Molecular marker-assisted breeding of rice; (6) Improvement of rice germplasm resources.

[0011] Fifthly, the present invention provides the use of the aforementioned primer combinations or the aforementioned kit in any of the following: (1) Genotyping of indica-japonica rice fertility genes; (2) Detection of allelic functional variations of rice indica-japonica hybridization genes; (3) Predicting the fertility of indica-japonica rice; (4) Improve the fertility of indica and japonica rice; (5) Molecular marker-assisted breeding of rice; (6) Improvement of rice germplasm resources.

[0012] Sixthly, the present invention provides a method for identifying the fertility of indica-japonica hybrid rice, comprising: For the rice to be tested, the genotype of the aforementioned molecular marker combination is detected, and the indica-japonica hybridization fertility of the rice to be tested is determined based on the detection results.

[0013] Furthermore, the detection method includes one or more of the following: gene sequencing, PCR amplification, molecular probe, liquid phase capture, or mass spectrometry.

[0014] Furthermore, the PCR detection is performed using the primer combination described in claim 2.

[0015] In some specific embodiments of the present invention, the PCR detection adopts the following procedure: Premix 50-150 mM primers in a ratio of Fam:Hex:Com = (1-3):(1-3):(2-6), and then add primer mixture to KASP master mix in a ratio of primer mixture:KASP master mix = 1:(24-48) to prepare KASP reaction mixture.

[0016] PCR amplification was performed in a water bath thermal cycler under the following conditions: pre-denaturation at 92-96℃ for 10-20 minutes; first amplification reaction: denaturation at 92-96℃ for 15-30 seconds, annealing and extension at 65-57℃ for 45-120 seconds, for 8-15 cycles, with the annealing and extension temperature decreasing by 0.6-1℃ per cycle; second amplification reaction: denaturation at 92-96℃ for 15-30 seconds, annealing and extension at 55-62℃ for 45-120 seconds, for 24-30 cycles.

[0017] Furthermore, determining the indica-japonica hybridization fertility of the rice variety based on the test results includes: For SaM-1235, genotype C represents the indica type, and genotype A represents the japonica type; For SaF-6434K, genotype C represents the japonica type, and genotype T represents the indica type; For Sc-1847, genotype A represents the indica type, and genotype G represents the japonica type; For HSA1a-7551, genotype G represents the indica type and genotype T represents the japonica type; For F5-1005, genotype T represents wide affinity and genotype G represents non-wide affinity; For DPL2-1347, genotype C represents the japonica type, and genotype T represents the indica type; For Duyao-F2, gene deletion means the absence of the DUYAO-JIEYAO system, while the absence of gene deletion means the presence of the DUYAO-JIEYAO system. For Duyao-F60T, genotype AC represents other types, and genotype TT represents the DUYAO-JIEYAO type. For Jieyao-F2, gene deletion means the absence of the DUYAO-JIEYAO system, while the absence of gene deletion means the presence of the DUYAO-JIEYAO system. For Jieyao-I33L, genotype A represents the DUYAO-JIEYAO type, and C represents other types; For Jieyao-K115E, genotype G represents other types, and genotype A represents the DUYAO-JIEYAO type. For Jieyao-K115Q, genotype A represents the DUYAO-JIEYAO type, and genotype C represents other types. For Jieyao-N114S, genotype AA represents the DUYAO-JIEYAO type, and genotype TC represents other types; For Jieyao-T474K, genotype GG represents the DUYAO-JIEYAO type, and genotype AA represents other types; For S5-9611, the genotype TCGCTCCTACGAATCCTGCCCCTGAGTAACAATGACTGACTTTTAATTTGTTTGCAGCTAGGGTGGGGATCGAGATGGTGATCTTGGAGCAGCCACAGCTGCTCCTTCTTCTTCTTCTTCTTGTAGCAGCTGCAGCTGCAGCTGCAA represents a non-widely compatible genotype, while the genotype TTAAT represents a widely compatible genotype. For S7-7581, C represents non-wide affinity and genotype T represents wide affinity.

[0018] Furthermore, when the marker results of SaM-1235, SaF-6434K, Sc-1847, HSA1a-7551 and DPL2-1347 are determined to be japonica or indica, it indicates that the material to be tested is japonica or indica at the corresponding gene locus, which can guide the selection of parental mating. When the test results of F5-1005, S5-9611 or S7-7581 are broadly compatible, it indicates that the material under test has indica-japonica affinity, which helps to improve the hybrid seed setting rate. When both Duyao-F2 and Jieyao-F2 are of the "not missing" type, it indicates that the material to be tested contains the DUYAO-JIEYAO system; Provided the test material possesses the DUYAO-JIEYAO system, if Duyao-F60T, Jieyao-I33L, Jieyao-K115E, Jieyao-K115Q, Jieyao-N114S, and Jieyao-T474K are all of the DUYAO-JIEYAO type, the test material is determined to be of the DUYAO-JIEYAO type; otherwise, it is of another type. If both parents are of the DUYAO-JIEYAO type, they can produce seeds normally; if one parent is of the DUYAO-JIEYAO type and the other is of another type, the hybrid offspring will exhibit hybrid sterility.

[0019] This invention provides 16 molecular markers and clarifies the role and division of labor of each marker in the identification of fertility in indica and japonica rice, forming an application system with systematic characteristics, mainly reflected in the following three aspects: Indica-Japonica type identification markers (5): such as SaM-1235, SaF-6434K, Sc-1847, HSA1a-7551, DPL2-1347, can determine whether the tested material is indica or japonica at a specific site, which is helpful for the design of parent pairing and indica-japonica combination schemes; Affinity type determination markers (3): F5-1005, S5-9611, S7-7581 can identify whether the test material has a wide affinity genotype, and thus be used to predict the seed setting rate of hybrid offspring. Wide affinity combinations are suitable for breaking the indica-japonica sterility barrier. DUYAO-JIEYAO system identification markers (8): Duyao-F2 and Jieyao-F2 are used to determine whether the system exists. If it exists, it is further determined whether it is the DUYAO-JIEYAO type by combining Jieyao-I33L, Jieyao-K115E, K115Q, N114S, T474K, and Duyao-F60T. This type can achieve hybridization between parents and identify this system. It is beneficial to screen functional parents that can be used for hybridization.

[0020] The present invention has the following beneficial effects: This invention provides a molecular marker combination and a corresponding KASP primer combination, which can rapidly detect the genotype of indica-japonica fertility genes in rice germplasm, thereby reflecting the indica-japonica fertility of rice. This invention further integrates the functions of molecular markers from multiple key indica-japonica fertility-related gene loci, constructing a marker combination system with practical breeding guidance value. The molecular marker combination provided by this invention can be used to construct and screen optimal locus combinations for different breeding objectives, such as indica-japonica type inference, broad compatibility identification, and DUYAO-JIEYAO system determination, improving the applicability and efficiency of molecular markers in breeding practice. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0022] Figure 1 This is the SaM-1235 marker classification diagram provided in Embodiment 2 of the present invention.

[0023] Figure 2 This is the SaF-6434K marker classification diagram provided in Embodiment 2 of the present invention.

[0024] Figure 3 This is the Sc-1847 marker classification diagram provided in Embodiment 2 of the present invention.

[0025] Figure 4 This is the HSA1a-7551 marker classification diagram provided in Embodiment 2 of the present invention.

[0026] Figure 5 This is the F5-1005 marking classification diagram provided in Embodiment 2 of the present invention.

[0027] Figure 6 This is the DPL2-1347 marker classification diagram provided in Embodiment 2 of the present invention.

[0028] Figure 7 This is the Duyao-F2 marker classification diagram provided in Embodiment 2 of the present invention.

[0029] Figure 8 This is the Duyao-F60T marker classification diagram provided in Embodiment 2 of the present invention.

[0030] Figure 9 This is the Jieyao-F2 marker classification diagram provided in Embodiment 2 of the present invention.

[0031] Figure 10This is the Jieyao-I33L marker classification diagram provided in Embodiment 2 of the present invention.

[0032] Figure 11 This is the Jieyao-K115E marker classification diagram provided in Embodiment 2 of the present invention.

[0033] Figure 12 This is the Jieyao-K115Q marker classification diagram provided in Embodiment 2 of the present invention.

[0034] Figure 13 This is the Jieyao-N114S marker classification diagram provided in Embodiment 2 of the present invention.

[0035] Figure 14 This is the Jieyao-T474K marker classification diagram provided in Embodiment 2 of the present invention.

[0036] Figure 15 This is the S5-9611 marker classification diagram provided in Embodiment 2 of the present invention.

[0037] Figure 16 This is the S7-7581 marker classification diagram provided in Embodiment 2 of the present invention. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0039] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0040] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0041] Example 1: Development and Validation of Important Indica-Japonica Rice Fertility Gene Markers This embodiment provides a method for developing molecular markers to determine key genes for fertility in indica-japonica rice hybridization. The specific steps are as follows: Step 1: Candidate gene information collection and mutation site mining.

[0042] 1.1 A comprehensive literature review was conducted on the reported and located or cloned indica-japonica hybrid fertility-related genes to extract their known functional variation sites.

[0043] 1.2 If the functional site is not clearly defined in the literature, locate the physical location of the gene on the reference genome (IRGSP-1.0).

[0044] 1.3 For cloned genes, locate them in the database and perform association analysis to screen for specific variant sites (such as SNPs or InDels) within the gene region.

[0045] 1.4 Using a database of 3,000 rice resequencing samples, the frequency of variant alleles was statistically analyzed, and variant sites with extremely low (or almost no) frequency of functional alleles or rare types were preferentially selected as candidate marker sites.

[0046] Step 2: Development of regional markers for nonfunctional variant genes.

[0047] 2.1 For localized genes with missing functional variants, whole-genome resequencing was performed using known donor materials to obtain high-quality SNP and InDel data.

[0048] 2.2 Extend approximately 50 kb upstream and downstream from the target gene and extract the variant sites within this interval.

[0049] 2.3 Jointly analyze the distribution frequency of the variants in this region and the corresponding sites in the 3000 rice resource bank, and screen variant sites with donor specificity or representative haplotypes as candidate markers.

[0050] Step 3: Validation and screening of molecular markers.

[0051] 3.1 For the candidate variant sites obtained through screening, primers were designed for PCR amplification.

[0052] 3.2 Using Sanger sequencing, donor materials were compared with control materials that did not contain the target gene to analyze allele types and assess the degree of co-segregation and distinguishing ability between the marker and the target gene.

[0053] 3.3 For the validated markers, after confirming their stability and representativeness, they are determined as functional or co-segregating markers that can be used to determine the fertility of indica and japonica rice, and subsequent KASP primer design is carried out.

[0054] Step 4: KASP primer design.

[0055] 4.1 For each identified marker site, approximately 100 bp of genomic sequence upstream and downstream of it is selected as a primer design template.

[0056] 4.2 Based on the principles of KASP (Kompetitive Allele Specific PCR) technology, design corresponding allele-specific primers and universal primers to ensure primer specificity and amplification efficiency.

[0057] 4.3 After the primer sequences are designed through an online design platform or manually, they are synthesized and preliminarily verified.

[0058] 4.4 Each site eventually forms a set of KASP primers for high-throughput genotyping of rice materials.

[0059] Finally, through the above process, 16 representative molecular markers of functional genes or regions related to rice indica-japonica crossbreeding were obtained. The physical location information of the markers is detailed in Table 1 below, all based on the Nipponbare genome version IRGSP-1.0 annotation. The primer information is detailed in Table 2.

[0060] Table 1. Molecular marker loci information of 16 functional genes for fertility in indica-japonica hybridization serial number Gene name chromosome Tag Name physical location Alleles 1 SaM 1 SaM-1235 22381235 C (Indica type) / A (Japonica type) 2 SaF 1 SaF-6434K 22376434 C (Japonica type) / T (Indica type) 3 Sc 3 Sc-1847 7791847 A (Indica type) / G (Japonica type) 4 HSA1a 12 HSA1a-7551 24647551 G (Indica type) / T (Japonica type) 5 F5 5 F5-1005 1451005 T (wide affinity) / G (non-wide affinity) 6 DPL2 1 DPL2-1347 4201347 C (Japonica type) / T (Indica type) 7 Pf12 12 Duyao-F2 / Identify whether or not 8 Pf12 12 Duyao-F60T The first two bases of the codon for amino acid number 60 in the coding region TT (DUYAO-JIEYAO type) / AC (other types) 9 Pf12 12 Jieyao-F2 / Identify whether or not 10 Pf12 12 Jieyao-I33L The first base of the 33rd amino acid codon in the coding region A (DUYAO-JIEYAO type) / C (other types) 11 Pf12 12 Jieyao-K115E amino acid codon number 115 in the coding region G (Other Types) / A (DUYAO-JIEYAO Type) 12 Pf12 12 Jieyao-K115Q The first base of the codon for amino acid number 115 in the coding region A (DUYAO-JIEYAO type) / C (other types) 13 Pf12 12 Jieyao-N114S The first two bases of codon 114 of the coding region AA (DUYAO-JIEYAO type) / TC (other types) 14 Pf12 12 Jieyao-T474K The second and third bases of the codon for amino acid number 474 in the coding region CG (DUYAO-JIEYAO type) / AA (other types) 15 S5 5 S5-9611 5759611 tcgctcctacgaatcctgcccctgagtaacaatgactgacttttaatttgtttgcagctagggtggggatcgagatggtgatcttggagcagccacagctgctccttcttcttcttcttcttcttgtagcagctgcagctgcagctgcagcaa (non-wide affinity) / TTAAT (wide affinity) 16 S7 7 S7-7581 15787581 C (non-wide affinity) / T (wide affinity) Table 2-1 Primer Information-1

[0061] Table 2-2 Primer Information-2

[0062] Table 2-3 Primer Information-3

[0063] Table 2-4 Primer Information-4

[0064] Example 2: Application of the major indica-japonica rice fertility gene marker system in the identification of breeding parents and resources. This embodiment discloses the identification and application of 16 KASP molecular markers developed based on the present invention in rice breeding parents and germplasm resources, aiming to verify the universality and polymorphism of the marker system in actual breeding materials.

[0065] 1. Sample DNA extraction.

[0066] Fresh leaves were selected from 64 rice samples, and genomic DNA was extracted using a modified CTAB method. The extracted DNA concentration was adjusted to 20–50 ng / μL and stored at -20℃ for subsequent use.

[0067] 2. Construction and detection of KASP molecular marker system.

[0068] This experiment used 16 KASP molecular markers provided by this invention, which are closely related to the fertility of indica-japonica rice, to detect single-marker KASP reactions in 64 breeding materials or germplasm resource samples. The material names and genotyping results are shown in Tables 3 and 4.

[0069] 3. KASP response and genotyping.

[0070] Genotyping was performed offline on the LGC IntelliQube platform. Each well contained 0.8 μL DNA + 0.8 μL KASP reaction mixture. KASP primers were premixed at a ratio of FAM:HEX:Com = 1:1:(2~3) and then mixed with primer mixture at a ratio of 1:36.

[0071] The PCR program was as follows: pre-denaturation at 94℃ for 3-5 minutes; first step amplification (annealing temperature decreasing) for 10 cycles: 95℃ for 20 seconds, annealing / extension at 65℃~57℃ for 45 seconds, decreasing by 0.8℃ per cycle; second step amplification for 26 cycles: 94℃ for 20 seconds, annealing / extension at 57℃ for 45 seconds; after amplification, the reaction plate was returned to IntelliQube for fluorescence signal detection and genotyping interpretation.

[0072] 4. Analysis of genotyping results.

[0073] The molecular marker system of this invention exhibited good genotyping effect and polymorphism in 64 tested materials. The results showed that: All 16 KASP markers related to fertility in indica and japonica rice showed significant polymorphism in the test materials, exhibiting different allelic genotypes, demonstrating their wide applicability in breeding parents and germplasm resources.

[0074] For detailed genotyping diagrams of each marker site across the 64 materials, please refer to [link to relevant documentation]. Figures 1 to 16 Each corresponds to the genotype distribution of each KASP marker in the tested sample.

[0075] All samples yielded clear genotype results at most loci, with high genotyping accuracy and good detection stability.

[0076] This labeling system enables effective identification of the indica and japonica rice types, prediction of affinity, and identification of the DUYAO-JIEYAO system for the tested materials.

[0077] 5. The method of discrimination based on genotyping results is as follows: When the marker results for SaM-1235, SaF-6434K, Sc-1847, HSA1a-7551, and DPL2-1347 are determined to be japonica or indica type, it indicates that the tested material is japonica or indica type at the corresponding gene locus, which can guide parental selection; and / or, When the test results for F5-1005, S5-9611, or S7-7581 are broadly compatible, it indicates that the tested material has indica-japonica affinity, which helps to improve the hybrid seed setting rate; and / or, When both Duyao-F2 and Jieyao-F2 are "not missing", it indicates that the test material contains the DUYAO-JIEYAO system; and / or, Provided the test material possesses the DUYAO-JIEYAO system, if Duyao-F60T, Jieyao-I33L, Jieyao-K115E, Jieyao-K115Q, Jieyao-N114S, and Jieyao-T474K are all of the DUYAO-JIEYAO type, the test material is determined to be of the DUYAO-JIEYAO type; otherwise, it is of another type. If both parents are of the DUYAO-JIEYAO type, they can produce seeds normally; if one parent is of the DUYAO-JIEYAO type and the other is of another type, the hybrid offspring will exhibit hybrid sterility.

[0078] Based on the above discrimination method, for the 64 materials SaM , SaF , Sc , HSA1a and DPL2 Determining the type of indica or japonica rice based on genes; f5 , S5 as well as S7 Gene affinity prediction and Pf12 The accuracy of genotype identification is 100%.

[0079] Detailed genotyping results for each marker site in the 64 materials are shown in Tables 3 and 4.

[0080] Table 3 Genotyping results of breeding materials Sample Name SaM-1235 SaF-6434K Sc-1847 HSA1a-7551 F5-1005 DPL2-1347 S5-9611 S7-7581 R2836-97 - - - - - - - - Hang 2-2 - - - - + - - - First restore 207 - - - - - - - - Hua Hui 2289-1006 - - - - - - - - Hua Hui 2254-792 - - - + - - - - Hua Hui 3207-1 - - - - - - - - Yongxian 69 - - - - - - - - Hua Hui 2855-1135 - - - - - - - - Hua Hui 792 - - - + - - - - Hua Hui 75 - - - - - - - - R210 - - - - - - - - Zhejiang Agricultural University 998 - - - - - - - - Jiang Hui 364 - - - - - - - - Qianhexiang No. 1 - - - - - - - - Yuejing Silk Seedling - - - - - - - - Radiation recovery 838 - - - + - - - - 4217-455 - - - - - - - - Hua Hui 3059-113 - - - - - + - - Hua Hui 2790-1182 - - - - - - - - Hua Hui 2293-3 - - - + - - - - Enhui 58 - - - - - - - - soft and sticky + + - - - - - - China Airlines No. 1 - - - - - - - - 9311 - - - - - - - - Hua Hui 272-421 - - - - - - - - R117 - - - - - - - - Fujian Hui 3310 - - - - - - - - Hua Hui 451-7-2 - - - - - + - - R1025 - - - + - - - - Hua Hui 3509-2① - - - - - + - - Zhonghui 8006 - - - - - - - - Mianhui 725 - - - - - - - - XK02 - - - - - - - - Dwarf Chinese Silkworm - - - - - - - - Anhui 1128 - - - - - - - - Basmati 1121 - - - + - - - - Ba Yin 5015 - - - - - - - - Beixiang No. 1 - - - - - - - - C4114 + + - - - - - - Cheng Hui 177 - - - + - - - - Cheng Hui 178 - - - + - - - - Cheng Hui 19 - - - - - - - - Cheng Hui 3203 - - - + - - - - Cheng Hui 727 - - - + - - - - Orange Glutinous Rice Soft Pastry - - - - - - - - Chu Geng 28 + + + + + + - - Chu Geng 29 + + + + + + - - Sichuan University Grain - - - + - - - - Chuanhui 88 - - - - - - - - Dongye No. 1 + + - + + + - - Multi-series No. 2 - - - - - - - - Efeng Silk Miao + + - + + + - - Feng Hua Zhan + + - - + - - - Fengtai Zhan - - - - - - - - Fengxinzhan + + - + + + - - Fengxin Silk Miao - - - - - - - - Fudao 88 - - - - + - - - Ganzhou Evening Indica 923 - - - - - - - - Gu Mei No. 4 - - - - - - - + Guguang Oil - - - - - - - - Solid metal - - - + - - - - Guanghui 128 - - - - - - - - Guangyan No. 1 - - - - - - - - Guangdong-Taiwan B - - - - - - + - Table 4-1 Genotyping Results of Breeding Materials - 1

[0081] Table 4-2 Genotyping Results of Breeding Materials - 2

[0082] Table 4-3 Genotyping Results of Breeding Materials - 3

[0083] Note: In the table, '+' represents japonica type or compatible type, and '-' represents indica type or incompatible type.

[0084] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A combination of molecular markers, characterized in that, including: SaM-1235, SaF-6434K, Sc-1847, HSA1a-7551, F5-1005, DPL2-1347, Duyao-F2, Duyao-F60T, Jieyao-F2, Jieyao-I33L, Jieyao-K115E, Jieyao-K115Q, Jieyao-N114S, Jieyao-T474K, S5-9611 and S7-7581; based on the genome version IRGSP1.0, the SaM-1235 includes: C / A genotype at position 22381235 of chromosome 1; the SaF-6434K includes: C / T genotype at position 22376434 of chromosome 1; the Sc-1847 includes: A / G genotype at position 7791847 of chromosome 3; the HSA1a-7551 includes: G / T genotype at position 24647551 of chromosome 12; the F5-1005 includes: T / G genotype at position 1451005 of chromosome 5; the DPL2-1347 includes: C / T genotype at position 4201347 of chromosome 1; the Duyao-F2 includes: presence / absence of Duyao gene; the Duyao-F60T includes: TT / AC genotype of the 1st and 2nd nucleotides of the 60th codon in the coding region of Duyao gene; the Jieyao-F2 includes: presence / absence of Jieyao gene; the Jieyao-I33L includes: A / C genotype of the 1st nucleotide of the 33rd codon in the coding region of Jieyao gene; the Jieyao-K115E includes: A / G genotype of the 1st nucleotide of the 115th codon in the coding region of Jieyao gene; the Jieyao-K115Q includes: A / C genotype of the 1st nucleotide of the 115th codon in the coding region of Jieyao gene; the Jieyao-N114S includes: AA / TC genotype of the 1st and 2nd nucleotides of the 114th codon in the coding region of Jieyao gene; the Jieyao-T474K includes: AA / CG genotype of the 2nd and 3rd nucleotides of the 474th codon in the coding region of Jieyao gene; the S5-9611 includes: Indel mutation at position 5759611 of chromosome 5, allele genotype is TCGCTCCTACGAATCCTGCCCCTGAGTAACAATGACTGACTTTTAATTTGTTTGCAGCTAGGGTGGGGATCGAGATGGTGATCTTGGAGCAGCCACAGCTGCTCCTTCTTCTTCTTCTTCTTGTAGCAGCTGCAGCTGCAA or TTAAT; the S7-7581 includes: C / T genotype at position 15787581 of chromosome 7.

2. A primer combination, characterized by The primer combination is used for amplifying the molecular marker combination as claimed in claim 1; preferably, the primer combination comprises the nucleotide sequences as shown in SEQ ID NO. 1-50.

3. A kit characterized in that, The molecular marker combination as claimed in claim 1, or the primer combination as claimed in claim 2.

4. The molecular marker combination as claimed in claim 1 as a target point in any one of the following: (1) genotyping of indica-japonica hybridization genes of rice; (2) detection of allelic functional variations of indica-japonica hybridization genes of rice; (3) prediction of indica-japonica hybridization of rice; (4) improvement of indica-japonica hybridization of rice; (5) molecular marker assisted breeding of rice; (6) improvement of germplasm resources of rice.

5. The primer combination as claimed in claim 2, or the kit as claimed in claim 3 in any one of the following: (1) genotyping of indica-japonica hybridization genes of rice; (2) detection of allelic functional variations of indica-japonica hybridization genes of rice; (3) prediction of indica-japonica hybridization of rice; (4) improvement of indica-japonica hybridization of rice; (5) molecular marker assisted breeding of rice; (6) improvement of germplasm resources of rice.

6. A method for identifying the fertility of indica-japonica hybrid rice, characterized in that, including: detecting the genotype of the molecular marker combination as claimed in claim 1 for a rice to be tested, and judging the indica-japonica hybridization of the rice to be tested according to the detection result.

7. The method of claim 6, wherein, The detection method comprises one or more of gene sequencing, PCR amplification, molecular probe, liquid phase capture or mass spectrometry.

8. The method of claim 7, wherein, The PCR detection is performed by using the primer combination as claimed in claim 2.

9. The method according to any one of claims 6-8, characterized in that, The judging of the indica-japonica hybridization of the rice to be tested according to the detection result comprises: for SaM-1235, genotype C represents indica type, and genotype A represents japonica type; for SaF-6434K, genotype C represents japonica type, and genotype T represents indica type; for Sc-1847, genotype A represents indica type, and genotype G represents japonica type; for HSA1a-7551, genotype G represents indica type, and genotype T represents japonica type; for F5-1005, genotype T represents wide compatibility type, and genotype G represents non-wide compatibility type; for DPL2-1347, genotype C represents japonica type, and genotype T represents indica type; for Duyao-F2, gene deletion represents no DUYAO-JIEYAO system, and no gene deletion represents containing DUYAO-JIEYAO system; for Duyao-F60T, genotype AC represents other type, and genotype TT represents DUYAO-JIEYAO type; for Jieyao-F2, gene deletion represents no DUYAO-JIEYAO system, and no gene deletion represents containing DUYAO-JIEYAO system; for Jieyao-I33L, genotype A represents DUYAO-JIEYAO type, and C represents other type; for Jieyao-K115E, genotype G represents other type, and genotype A represents DUYAO-JIEYAO type; for Jieyao-K115Q, genotype A represents DUYAO-JIEYAO type, and genotype C represents other type; For Jieyao-N114S, genotype AA represents DUYAO-JIEYAO type, and genotype TC represents other types; For Jieyao-T474K, genotype GG represents DUYAO-JIEYAO type, and genotype AA represents other types; For S5-9611, genotype TCGCTCCTACGAATCCTGCCCCTGAGTAACAATGACTGACTTTTAATTTGTTTGCAGCTAGGGTGGGGATCGAGATGGTGATCTTGGAGCAGCCACAGCTGCTCCTTCTTCTTCTTCTTCTTGTAGCAGCTGCAGCTGCAA represents non-broad affinity type, and genotype TTAAT represents broad affinity type; For S7-7581, C represents non-broad affinity type, and genotype T represents broad affinity type.

10. The method of claim 9, wherein, When the SaM-1235, SaF-6434K, Sc-1847, HSA1a-7551 and DPL2-1347 marker results are determined as japonica or indica, it indicates that the material to be tested is japonica or indica at the corresponding gene locus, which can guide the parent selection; and / or, When the F5-1005, S5-9611 or S7-7581 detection results are broad affinity type, it indicates that the material to be tested has indica-japonica affinity, which helps to improve hybrid seed setting rate; and / or, When Duyao-F2 and Jieyao-F2 are both "non-deletion" type, it indicates that the material to be tested contains DUYAO-JIEYAO system; and / or, Under the premise that the material to be tested has DUYAO-JIEYAO system, when Duyao-F60T, Jieyao-I33L, Jieyao-K115E, Jieyao-K115Q, Jieyao-N114S and Jieyao-T474K are all DUYAO-JIEYAO type, it is determined that the material to be tested is DUYAO-JIEYAO type, otherwise it is other type; if both hybrid parents are DUYAO-JIEYAO type, the hybrid can normally set seeds; if one is DUYAO-JIEYAO type and the other is other type, the hybrid offspring will show hybrid sterility.

Images