Cell
By using miRNA expression constructs to target and regulate the expression of peptides such as HLA and TCR, the problem of immune rejection in allogeneic cell therapy has been solved, achieving persistence and low immunogenicity of allogeneic cells, reducing costs and improving the sustainability of cell therapy.
Patent Information
- Application Number
- CN202480045578.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-05-04
- Filing Date
- 2024-05-03
- Publication Date
- 2026-02-06
AI Technical Summary
Existing autologous cell therapies, such as CAR T-cell therapy, face challenges of high cost and complex logistics, while allogeneic cell therapies need to avoid immune rejection to achieve durable and ready-to-use supply.
By using miRNA expression constructs to target and regulate the expression of peptides such as HLA and TCR, the immunogenicity of allogeneic cells is reduced, including downregulating the expression of HLA and TCR, and gene editing technologies such as CRISPR are used for modification.
This approach achieves persistence and low immunogenicity of allogeneic cells in the host's immune system, reduces the host's immune system's rejection response, and improves the sustainability and cost-effectiveness of cell therapy.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Background of the Invention Technical Field
[0001] This invention generally relates to the field of cell biology. More specifically, this invention relates to the use of miRNA gene constructs to construct universal donor cell (UDC) therapies for allogeneic, off-the-shelf delivery, particularly where the cells can persist for a longer period by avoiding rejection by the patient's immune system. Background Technology
[0002] Autologous cell therapies (such as chimeric antigen receptor (CAR) T-cell therapy) have proven to be effective treatments for conditions such as hematologic malignancies. However, such cell-based therapies face high production costs and complex logistical challenges, limiting their widespread application. Using allogeneic cells (i.e., cells genetically different from the patient's) promises to overcome these challenges because allogeneic cells can be prepared in multiple therapeutic doses using a single healthy donor unit, significantly reducing costs and enabling out-of-the-box supply.
[0003] However, to fully utilize allogeneic cell-based strategies, immune rejection must be avoided and the persistence of allogeneic cells in the host / patient immune system must be enhanced. This is crucial for achieving more durable clinical responses. Therefore, strategies that can continuously (e.g., permanently) modify donor cells are needed to provide engineered allogeneic cells with greater persistence in vivo.
[0004] The term Major Histocompatibility Complex (MHC) is used to describe a group of genes in animals and humans that encode a variety of cell surface markers, antigen-presenting molecules, and other proteins involved in immune function. Human leukocyte antigen (HLA) complex is synonymous with human MHC (Viatte S, Scur PH, Seo P. Human leukocyte antigens (HLA): Aroadmap. Published in: UpToDate, Post TW (ed.), UpToDate, Waltham, MA).
[0005] HLA / MHC class I deficiency, also known as naked lymphocyte syndrome type I (BLS I), is a severe combined immunodeficiency syndrome (SCID) characterized by defects in the molecular expression of HLA-I molecules on the cell surface. The most common cause of BLS I is mutations in the genes of TAP proteins, namely TAP1, TAP2, and TAPBP (Online Mendelian Inheritance in Man (OMIM), 604571). Cases of β2-microglobulin (B2M) deficiency have also been reported, with these patients exhibiting features similar to typical HLA class I deficiency but with more extensive immunodeficiency (Ardeniz et al., 2015, PMID: 25702838).
[0006] HLA / MHC class II deficiency, also known as naked lymphocyte syndrome type I (BLS II), is another SCID characterized by a defect in the molecular expression of HLA-II molecules on the cell surface. The most common cause of BLS II is a genetic defect in transcription factors involved in HLA-II expression (i.e., CIITA, RFXANK, RFX5, and RFXAP) (Online Database of Human Mendelian Genetics (OMIM), 209920).
[0007] Allogeneic infusion of engineered donor cells (such as CAR-T cells) requires further suppression of endogenous T cell receptor (TCR) expression to mitigate allogeneic reactivity and graft-versus-host disease (GvHD) in donor-derived T cells. This can be achieved through various genetic engineering methods, most commonly gene editing techniques such as CRISPR gene knockout. However, alternative and improved methods are still needed to provide allogeneic TCR-deficient T cells for this purpose.
[0008] In short, the present invention solves the above-mentioned problems and meets the need in the art for improved and efficient allogeneic engineered donor cells. Summary of the Invention
[0009] The invention is defined in the appended claims. The statements in the specification are intended to illustrate and further aid in understanding the invention.
[0010] In a first aspect, the present invention provides an engineered donor cell to which the host immune system has reduced rejection, wherein one or more polypeptides expressed on the cell surface involved in immune signal transduction are functionally regulated.
[0011] In a second aspect, the present invention provides a miRNA expression construct comprising one or more miRNA hairpins targeting B2M, NLRC5, TAP1, TAP2, TAPBP, RFX5, RFXANK, RFXAP, CIITA, TCRB, CD3d, CD3g, CD3e, and / or CD3z. In embodiments, the construct further comprises an expressed transcript.
[0012] In a third aspect, the present invention provides a DNA molecule comprising the miRNA expression construct described herein.
[0013] In a fourth aspect, the present invention provides plasmids comprising the miRNA expression constructs or DNA molecules described herein.
[0014] In a fifth aspect, the present invention provides a vector comprising the miRNA expression construct, DNA molecule or plasmid described in the present invention.
[0015] In a sixth aspect, the present invention provides engineered donor cells comprising the miRNA expression construct, DNA molecule, plasmid, or vector described in this invention.
[0016] In a seventh aspect, the present invention provides a method for downregulating peptides in cells, comprising expressing the miRNA expression construct, DNA molecule, plasmid, or vector described in the present invention in cells.
[0017] In an eighth aspect, the present invention provides a method for preparing engineered donor cells, comprising transfecting or transducing cells with the miRNA expression construct, DNA molecule, plasmid or vector described in the present invention.
[0018] In a ninth aspect, the present invention provides a method for preparing engineered donor cells from a patient donor or a healthy donor, comprising: (a) Collecting cells from the patient; and (b) Transfecting or transducing the cells using the miRNA expression construct, DNA molecule, plasmid, or vector described in this invention; and (c) Express the miRNA expression construct.
[0019] In a tenth aspect, the present invention provides engineered effector cells that are obtainable or have been obtained by the method described herein.
[0020] In an eleventh aspect, the present invention provides a composition comprising the engineered donor cells described herein.
[0021] In a twelfth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions thereof, for use in therapy.
[0022] In a thirteenth aspect, the present invention provides a method for applying the engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions described herein to the treatment of cancer, infectious diseases, autoimmune diseases or hereditary diseases.
[0023] In a fourteenth aspect, the present invention provides a method for treating cancer, infectious diseases, autoimmune diseases, or hereditary conditions, comprising administering engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors, or compositions as described in the present invention.
[0024] In a fifteenth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions described herein, which are used to manufacture medicaments for treating cancer, infectious diseases, autoimmune diseases or hereditary diseases.
[0025] In a sixteenth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions described herein for use in stem cell therapy.
[0026] In a seventeenth aspect, the present invention provides a stem cell therapy method comprising administering engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors, or compositions as described herein.
[0027] In an eighteenth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions described herein, which are used in the manufacture of drugs for stem cell therapy. Attached Figure Description
[0028] Figure 1 The expression of HLA-ABC in gene-modified primary T cells was downregulated using the target sequence of B2M miRNA, compared with the expression in T cells modified with disordered control miRNA. The results are expressed as normalized values of median HLA-ABC fluorescence intensity (MFI).
[0029] Figure 2Genetically engineered T cells exhibit varying levels of HLA class I molecule expression. Flow cytometry histograms of HLA-ABC expression and related descriptive statistics are presented. The Comp-FL7 channel reflects the median fluorescence intensity (MFI) of HLA-ABC (right column of the table). The percentage on the left side of the histogram represents the normalized HLA-ABC expression level relative to control transduced T cells known as scrambled-mCherry (expressing only mCherry).
[0030] Figure 3 Downregulation of HLA class I molecules. Flow cytometry histograms and normalized values of HLA-ABC expression. Histograms are based on gating analysis of gene-modified cells (i.e., those positive for mCherry reporter genes).
[0031] Figure 4 A flow cytometry gating strategy using B2M_T5 as an example. Gating was first based on T cell selection, excluding double-cell and dead cells. Subsequently, mCherry was aligned with HLA-ABC to create an overlap histogram to assess the silencing of HLA-ABC expression in genetically modified (mCherry-positive) and unmodified cells.
[0032] Figure 5 Multi-hairpin miRNA constructs targeting HLA class I molecules were constructed using B2M_T5. Histograms showed partial improvement in HLA-ABC silencing when B2M_T5 was added to the two-hairpin and three-hairpin (hp) miRNA constructs. Normalized expression levels reflected an HLA class I silencing rate >90% (n=3 donors).
[0033] Figure 6 Genetically engineered HEK293 cells exhibit varying levels of HLA class I molecule expression. Flow cytometry histograms of HLA-ABC expression and related descriptive statistical data are presented. The YL2 channel reflects mCherry reporter gene expression, while the median HLA-ABC values are listed in the VL1 channel (last column of the table). The percentages on the left side of the histogram represent the normalized HLA-ABC gene silencing level relative to control transduced HEK293 cells (expressing only mCherry).
[0034] Figure 7 : Figure 7 Downregulation of TCR α / β expression. Flow cytometry histograms and normalized values of the percentage of cells expressing TCR α / β and their MFI expression. Histograms are based on gating analysis of gene-modified cells (i.e., those positive for mCherry reporter genes).
[0035] Figure 8A flow cytometry gating strategy using TRAC_T1 as an example. Gating was first based on T cell selection, excluding double-cell pairs, and gating was performed on live cells. Subsequently, mCherry was plotted against TCR α / β and CD3e to assess the silencing of TCR expression in genetically modified (mCherry-positive) and unmodified cells.
[0036] Figure 9 Downregulation of TCR α / β expression. Flow cytometry histograms and normalized values of the percentage of cells expressing TCR α / β and their MFI levels. Histograms are based on gating analysis of gene-modified cells (i.e., those positive for mCherry reporter genes).
[0037] Figure 10 A flow cytometry gating strategy using CD3z_T1 as an example. Gating was first based on T cell selection, excluding double-cell pairs, and gating was performed on live cells. Subsequently, mCherry was plotted against TCR α / β and CD3e to assess the silencing of TCR expression in genetically modified (mCherry-positive) and unmodified cells.
[0038] Figure 11 TCR silencing efficiency in Jurkat cells. The single-hairpin CD3z_T2 construct resulted in complete silencing of TCR α / β expression (black indicates unstained control). Similarly, CD3e expression on the surface of Jurkat cells was reduced by more than 90%.
[0039] Figure 12 Multi-hairpin miRNA constructs targeting TCR were constructed using CD3z_T2. Histograms showed a slight improvement in TCR silencing when CD3z_T2 was added to the two-hairpin and three-hairpin (hp) constructs. Normalized expression levels reflected TCR silencing greater than 95%.
[0040] Figure 13 Histograms of multi-target constructs used to silence TCR expression. Except for the untransduced (UTD) condition, all histograms reflect cell surface expression in genetically modified T cells (gated with mCherry-positive cells). The “Freq. of Parent” column indicates the percentage of gated cells used to create the histograms, i.e., the percentage of transduced T cells. TCR α / β was detected in the BL1 channel, and CD3ε in the RL2 channel. =Higher copy number transduction (MOI = 2.0).
[0041] Figure 14: Mixed lymphocyte response (MLR) using T cells modified with CD3ζ_T2 and TRAC_T1.
[0042] (A) PBMCs from the same donor were transduced with miRNAs targeting CD3ζ_T2 or TRAC_T1 sequences, respectively. Transduction rates were 65-80%, yielding T cells with 95% or 30% TCR silencing, respectively. Control transduced T cells carried only the mCherry reporter gene, with TCR expression levels comparable to untransduced T cells (UTD). (B) CD137 expression in unstimulated, MLR (co-cultured with irradiated unmatched PBMCs at a 1:1 ratio), and CD3 / CD28 microbead-activated cells (positive control). CD137 expression was not observed in any of the unstimulated PBMC populations. In the MLR, CD137 expression was observed in cells transduced using our TRAC_T1 construct. A significant decrease in CD137 expression was observed in T cells (see upper quadrant, relative to unmodified cells in the lower quadrant). A significant decrease in CD137 expression was also observed in cells transduced with CD3ζ_T2 (lower panel, upper quadrant). When CD137 was transduced with control (mCherry only), a significant decrease was observed. When T cell CD137 expression levels were normalized, cell activation using the CD3ζ_T2 construct was less than 5%. Even under CD3 / CD28 bead activation conditions, a significant decrease in CD137 expression was observed when using the CD3ζ_T2 construct.
[0043] Figure 15: Screening for miRNAs to silence HLA class II molecule expression. (A) Summary of transduction rate and HLA-II expression silencing in primary T cells, showing that different constructs have comparable gene modification rates, with construct pATN504 showing the most significant silencing effect on HLA-CP / DQ / DR cell surface expression. (B) Flow cytometry histogram of primary T cells modified with miRNA constructs targeting CIITA (second round of screening). The histogram is based on gating analysis of gene-modified cells (i.e., those positive for mCherry reporter genes).
[0044] Figure 16 We constructed allogeneic, low-immunogenic CAR19T cells with finely tuned HLA-I expression silencing. All bimodal gene constructs were designed to silence TCR expression on the cell surface using optimized miRNAs targeting CD3z and to co-express the anti-CD19 CAR (CAR19) and RQR8 reporter genes. Constructs pATN292 and pATN293 were also designed to further silence HLA class I molecules using miRNAs targeting B2M_T2 and B2M_T5, respectively. Finally, pATN294 expressed dual miRNAs targeting B2M_T5 to achieve maximum HLA-I silencing.
[0045] Figure 17: Preparation and immunophenotypic characterization of allogeneic and low-immunogenic miCAR19 T cells. A. Schematic diagram of miCAR T cell preparation process. B. Flow cytometry scatter plot of miCAR19 T cells (pATN293, TCR α / β, and HLA-ABC silenced) before and after removal of TCR α / β positive cells. CAR-positive cells were detected based on CD34 positivity (RQR8). The remaining cells after TCR α / β removal did not express TCR α / β, HLA-ABC was silenced, and the RQR8 reporter gene (CD34) was fully expressed. C. Flow cytometry histogram showing cell surface expression of HLA-ABC in engineered miCAR19 T cells. Cells modified with pATN296 expressed similar levels of HLA-ABC as untransduced T cells. Cells modified with miRNA constructs (pATN292 and pATN293) targeting B2M_T2 and B2M_T5 showed downregulation of HLA-ABC by approximately 80% and 90%, respectively; while cells modified with constructs carrying dual miRNAs (both targeting B2M_T5) showed the most significant downregulation of HLA-ABC (95%).
[0046] Figure 18: Expanded immunophenotypic features of allogeneic and low-immunogenic miCAR19 T cells. All cell products were analyzed by flow cytometry 24 hours after thawing. In the positive control, untransduced and CAR19 T cells were activated with CD3 / CD28 microbeads on the day of thawing. UTD: Untransduced T cells
[0047] UTD act: Untransduced T cells; CAR19: CAR19 T cells activated with CD3 / CD28 microbeads; CAR19act: CAR19 T cells activated with CD3 / CD28 microbeads; 296: TCR-silenced CAR19 T cells; 294: TCR and HLA-I-silenced CAR19 T cells (B2M_T5_T5), HLA-I remaining 5%; 293: TCR and HLA-I-silenced CAR19 T cells (B2M_T5), HLA-I remaining 10%; 292: TCR and HLA-I-silenced CAR19 T cells (B2M_T2), HLA-I remaining 20%. A. The CD4+ / CD8+ T cell ratio indicates no difference among all manufactured T cell products. B. Post-manufacturing, the expression levels of PD1, TIGIT, and TIM3 in both CD4 and CD8 T cell populations were low. In the positive control (activated by CD3 / CD28 microbeads), the expression of PD1, TIGIT, and TIM3 was higher. C. Memory phenotype analysis based on CD45RA and CD62L expression showed that CD4+ T cells were primarily central memory (TCM), while CD8+ T cells were primarily primordial / stem cell memory (TSCM) phenotypes. In addition to the activated T cell population, a small proportion of effector memory T cells (TEM) and effector memory T cells re-expressing CD45RA (TEMRA) were also present. D. Activation status was assessed by detecting the presence of CD69 and CD25 positive cells; the results showed that the activation level of all manufactured T cell products was negligible.
[0048] Figure 19: Specific cytotoxicity of allogeneic and low-immunogenic miCAR19 T cells against tumor cells. UTD: Untransduced T cells; 296: TCR-silenced CAR19; 294: TCR and HLA-I-silenced CAR19 (B2M_T5_T5), with 5% HLA-I remaining; 293: TCR and HLA-I-silenced CAR19 (B2M_T5), with 10% HLA-I remaining; 292: TCR and HLA-I-silenced CAR19 (B2M_T2), with 20% HLA-I remaining. A. In short-term cytotoxicity assays, miCAR19 T cells with varying degrees of HLA-I silencing exhibited comparable functional activity against CD19-expressing tumor cells. Engineered miCAR19 T cells (effective cells, E) and JeKo-1 cells (target cells, T) were co-cultured at E:T ratios of 1:1 and 3:1 for 24, 48, and 72 hours. Viability of target cells (GFP-expressing JeKo-1 cells) was assessed by flow cytometry at specified time points. Data points in the figures represent the mean and standard deviation from n=3 donors. Dashed lines in each representative figure represent the percentage of JeKo-1 cells initially plated in co-culture. B and C show that allogeneic and low-immunogenic miCAR19 T cells maintained effective cytotoxicity against CD19-expressing tumor cells. B. In short-term cytotoxicity assays, miCAR19 T cells with varying degrees of HLA-I silencing exhibited comparable functional activity against CD19-expressing tumor cells. Engineered miCAR19 T cells (effective cells, E) and JeKo-1 cells (target cells, T) were co-cultured at E:T ratios of 1:9, 1:3, 1:1, and 3:1. Viability of target cells (GFP-expressing JeKo-1 cells) was assessed by flow cytometry at specified time points. Data points in the figures represent the mean and standard deviation from n=3 donors. C. In a long-term trial, miCAR19 T cells with an 80% HLA-I silencing rate (engineered using construct 292) effectively eliminated JeKo-1 tumor cells after four rounds of restimulation with the same number of target cells. D. Allogeneic and low-immunogenic miCAR19 T cells maintained effective cytotoxicity against CD19-expressing tumor cells. In the recursive killing assay, all miCAR19 T cells with varying degrees of HLA-I silencing showed equally excellent lysis of target cells in four rounds of JeKo-1 tumor cell exposure (tumor cells were added to the culture on days 1, 3, 7, and 10), while untransduced T cells failed to control tumor growth.
[0049] Figure 20: Mixed lymphocyte reaction using allogeneic and low-immunogenic miCAR19 T cells with mismatched CD8+ T cells and NK cells. UTD: Untransduced T cells; 296: TCR-silenced CAR19; 294: TCR and HLA-I-silenced CAR19 (B2M_T5_T5), HLA-I remaining 5%; 293: TCR and HLA-I-silenced CAR19 (B2M_T5), HLA-I remaining 10%; 292: TCR and HLA-I-silenced CAR19 (B2M_T2), HLA-I remaining 20%. A. Host PBMCs were pre-sensitized with mitomycin C-treated graft donor cells (CAR19 T cells), followed by isolation of CD8-positive T cells and labeling with CellTraceViolet (CTV) dye. Pre-sensitized CD8+ T cells (effective cells, E) were co-cultured with transplanted miCAR19 T cells (target cells, T) at a 1:1 E:T ratio. Cells were analyzed by flow cytometry after 6 days of co-culture. Untransduced (UTD) and allogeneic miCAR19 T cells (296, without HLA-I silencing) were primarily consumed by the pre-sensitized CD8+ T cells, while all HLA-I-silenced miCAR19 T cell populations (292, 293, and 294) were equally protected regardless of their HLA-I silencing levels (80%, 90%, or 95%). B. Pre-sensitized CD8+ T cells were activated and proliferated only when co-cultured with UTD and 296 miCAR T cells, as evidenced by the dilution of CTV signal. Corresponding to the lack of cytotoxicity in HLA-I-silenced miCAR19 T cells, pre-sensitized CD8+ T cells exposed to the same miCAR19 T cell population showed equivalent CTV signaling. C. Host NK cells (effector cells, E) and transplanted miCAR19 T cells (target cells, T) were co-cultured at a 5:1 E:T ratio. After 24 hours, the cells were analyzed by flow cytometry to assess the proportions of NK cells and T cells based on CD56 and CD5 expression, respectively. Transplanted UTD and fully HLA-I-expressing miCAR19 T cells (pATN296) were equally protected, while the miCAR19 T cells with the highest degree of HLA-I silencing (294) were most sensitive to NK cell-mediated cytotoxicity. Transplanted miCAR19 T cells with 80% (292) and 90% (293) HLA-I silencing were correspondingly protected from NK cell-mediated cytotoxicity. Figures C and D show that, based on HLA-I expression, finely regulated silencing of HLA-I can protect miCAR19 T cells from NK cell rejection. D. Host NK cells (effective cells, E) co-cultured with transplanted miCAR19 T cells (target cells, T) at different E:T ratios.Untransduced transplanted T cells and fully HLA-I-expressing miCAR19-allo T cells were not lysed, while 95% HLA-I-silenced CAR19-allo T cells were most sensitive to NK cell-mediated cytotoxicity at all E:T ratios. Notably, finely regulated HLA-I silencing of 80-90% of transplanted miCAR19 T cells still significantly protected them from NK cell-mediated cytotoxicity. E. Host NK cells (effective cells, E) were co-cultured with transplanted miCAR19 T cells (target cells, T) at different E:T ratios. During the first 24 hours of co-culture (E:T ratio 5:1), host NK cells exhibited the most significant rejection of HLA-I-silenced transplanted T cells. All experiments used n=3 NK cell donors. F. In vitro experiments showed that the rejection of CD19 CAR T cells by pre-sensitized CD8 T cells or NK cells was correlated with HLA-ABC levels. First, CD8+ T cells from three different donors were pre-sensitized with CD19 CAR T cells, and then co-cultured with CD19 CAR T cells expressing different levels of HLA-ABC (transplanted cells) at a 1:1 ratio. The number of remaining transplanted cells was analyzed after 6 days of co-culture. G. In vitro experiments showed that the rejection of CD19 CAR T cells by pre-sensitized CD8 T cells or NK cells was correlated with HLA-ABC levels. NK cells from three different donors were plated with CD19 CAR T cells expressing different levels of HLA-ABC (transplanted cells) at a 5:1 ratio. The number of remaining transplanted cells was analyzed after 48 hours of co-culture.
[0050] Figure 21: TCR-silenced CAR T cells were not activated in the CD3 stimulation assay. T cells were stimulated with anti-CD3 antibody (OKT3) at concentrations ranging from 0 to 17.5 μg / mL, and the expression levels of CD137 / CD69 activation markers were assessed 24 hours later. The results showed that untransduced T cells and control CAR T cells (278) were activated at 0.54 μg / mL OKT3, and the increase in activation levels was comparable. Notably, within the same concentration range, the expression of activation markers in the TCR-silenced CAR T cell population remained unchanged, confirming the loss of TCR function after receptor silencing. UTD: Untransduced T cells; 278: Disordered CAR T cells; 296: TCR-silenced CAR19; 294: TCR and HLA-I-silenced CAR19 (B2M_T5_T5), HLA-I remaining 5%; 293: TCR and HLA-I-silenced CAR19 (B2M_T5), HLA-I remaining 10%; 292: TCR and HLA-I-silenced CAR19 (B2M_T2), HLA-I remaining 20%. A. Expression of activation markers in total viable cells (CD8+CD4+ CAR T cells). B. Expression of activation markers in CD8+ CAR T cell population. C. No non-cytokine-dependent exogenous growth of multiple engineered miCAR19 T cells. Engineered T cells were cultured for 13 days with or without IL-7 and IL-15. Cell survival was observed in all cell populations in the presence of cytokines, but no exogenous cell activity was observed in the absence of cytokines.
[0051] Figure 22: Validation of the principle of simultaneously silencing HLA-ABC receptors and co-expressing HLA-E-B2M fusion protein using a single bimodal gene construct. A. All bimodal gene constructs were designed to silence TCR expression on the cell surface using optimized miRNAs targeting CD3z and to co-express anti-CD19 CAR (CAR19), HLA-E-B2M fusion protein, and RQR8 reporter gene. Construct pATN302 was designed to additionally silence HLA class I molecules by targeting B2M_T2 miRNAs, while pATN304 contained dual miRNAs targeting B2M_T5. B. HEK293 cells were genetically modified via lentiviral vector transduction, and the expression of HLA class I molecules on the cell surface was analyzed by flow cytometry. Histograms show the membrane expression of HLA-ABC and HLA-E proteins in genetically modified cells (gated based on CAR19-positive cells) and unmodified cells. Cells modified with pATN306 showed similar levels of HLA-ABC expression to untransduced cells, but also exhibited co-expression of the HLA-E-B2M fusion protein. Cells modified with constructs carrying B2M-targeting miRNAs (pATN302 and pATN304) showed downregulated HLA-ABC expression and overexpression of HLA-E. Cells modified with pATN302 (carrying a B2M_T2-targeting miRNA) and pATN304 (a B2M_T5 dual miRNA) showed approximately 60% and 90% silencing of HLA-ABC, respectively.
[0052] Figure 23 : Final summary and detailed information of the sequences used in this article.
[0053] Figure 24According to the present invention, various cell types, including stem cells, progenitor cells, or fully differentiated cells, can be used to construct universal donor cells. When using the illustrated dual-mode gene construct, these cells can be engineered through a single-gene modification step. In this way, universal donor cells are endowed with properties that enhance their persistence after infusion into a patient (host) as a cell therapy product (graft). On one hand, an optimized miRNA gene silencing cassette is designed to functionally silence the expression of HLA class I and HLA class II molecules. Therefore, in a particularly preferred embodiment of the invention, both HLA-I and HLA-II are downregulated. On the other hand, the same gene construct allows for the expression of immunomodulatory receptors on the surface of universal donor cells. Therefore, in a preferred embodiment of the invention, CD47 and / or PD-L1 are also upregulated, preferably both CD47 and PD-L1 are upregulated. In embodiments of the invention, when HLA-I expression is reduced by 50-90%, non-classical HLA may not be upregulated. However, in embodiments where HLA-I expression is reduced by more than 90% (preferably functional silencing, preferably negligible expression levels), non-canonical HLA can be upregulated, most preferably modified non-canonical HLA sequences, such as HLA-E, G, or F sequences fused to the B2M protein, and most preferably, the gene encoding the B2M protein is codon-optimized. In this embodiment, the function of non-canonical HLA is to reduce NK cell-mediated cytotoxicity. Furthermore, the multiple engineering of universal cells in this invention aims to limit the host immune system's rejection of these transplanted cells.
[0054] Figure 25: Illustration and results of Example 7. A. Three constructs used: (i) a single-hairpin (1hp) miRNA targeting CD3z (T2), (ii) a double-hairpin (2hp) miRNA (T1_T2) targeting two different regions of the CD3z transcript, and (iii) a non-targeting miRNA (with a disordered guide strand sequence). B. Pure TCR-mCh was obtained. + C. Cell population. D. T cell expansion and production. It is noteworthy that, although the number of cells harvested under all conditions was the same, the yield of TCR-silenced T cells constructed from the dual miRNAs CD3z_T1_T2 was almost double that of TCR-silenced T cells constructed from a single miRNA gene construct targeting CD3z_T2 (unpaired T-test, p=0.0136). Therefore, in a particularly preferred embodiment of the present invention, two miRNA hairpins inhibit CD3z expression, wherein each hairpin targets a different region of the CD3z transcript, preferably, wherein the hairpins are CD3z_T1 and CD3z_T2, respectively.
[0055] Figure 26: Induced pluripotent stem cells (iPSCs) transduced using the UDC constructs shown in Table 4 of Example 8. UTD: Untransduced iPSCs; 1689: iPSCs transduced using constructs that silence β2M_T5 and CIITA_T19 and overexpress CD47, PDL1, RQR8, and β2M-HLAE; 1690: iPSCs transduced using constructs that silence β2M_T5 and CIITA_T19 and overexpress CD47, PDL1, and RQR8; 1692: iPSCs transduced using constructs that silence scr48 and overexpress CD47, PDL1, RQR8, and β2M-HLAE. Because these cells do not express these molecules, HLA-DPDQDR silencing in this cell type could not be assessed. A. All UDC-transduced cells expressed >90% OCT4, indicating that these cells exhibited an undifferentiated phenotype. B. UDC-transduced iPSCs showed overexpression of CD47, PD-L1, and HLA-E. C. UDC-transduced iPSCs showed overexpression of CD47, PD-L1, and HLA-E, and HLA-ABC silencing. D. UDC-transduced iPSCs showed overexpression of CD47 and PD-L1, and HLA-ABC silencing.
[0056] Figure 27 T cells transduced using the UDC construct shown in Table 4 of Example 8. UTD: Untransduced T cells; Transduced: T cells transduced using UDC. The transduced T cells exhibited overexpression of CD47 and PD-L1, and silencing of HLA-ABC and HLA-DPDQDR.
[0057] Figure 28: Illustration and results of Example 9. A. Overall study design. B. Main study design. C. Flow cytometry analysis to confirm the transplantation of modified cells. D. Survival curves showing that mice receiving TCR-silenced T cells were fully viable within 100 days. E. Changes in relative body weight percentage indicate that mice receiving control expanded T cells showed a decreasing body weight trend, while mice receiving TCR-silenced T cells showed a continuous increase in body weight during the 100-day study period.
[0058] Figure 29: Illustrations and results of Example 10 show that TCR / CD3 and HLA-I gene expression was persistently and "finely regulated" silenced in a mouse model of T-cell transplantation. A. In vivo study design in NSG mice. B. miCAR19 T cells tracked in vivo samples by flow cytometry. Scatter plots show the definitive identification of miCAR19 T cells based on CAR positivity and CD3 silencing. Representative histograms show HLA-I expression based on samples taken on day 4 and day 32. Notably, HLA-I gene expression levels were clearly detected to varying degrees of "finely regulated" silencing on day 4 (one day after CAR T-cell infusion), and this silencing persisted until the end of the study (day 32) in all sampled tissues. Detailed Implementation
[0059] This invention relates to the construction of allogeneic cells, allogeneic engineered donor cells, the use of miRNA gene constructs therein, and universal donor cell (UDC) therapy. Specifically, this invention utilizes miRNA-based gene constructs to construct allogeneic engineered donor cells in which the expression of one or more cell surface peptides is regulated (e.g., downregulated and / or upregulated).
[0060] Specifically, this invention relates to engineered donor cells in which the expression of certain combinations of cell surface peptides is regulated. Specifically, the expression of one or more HLA peptides can be downregulated by miRNAs targeting HLA peptides (such as B2M) or transcription factors that upregulate HLA expression. Not intending to be theoretically limited, the inventors believe that applying miRNAs in this manner can reduce HLA expression levels, thereby avoiding rejection by CD8+ T cells, while maintaining a certain HLA expression level to avoid rejection by NK cells. Therefore, the engineered donor cells according to this invention, under optimal conditions, will not be rejected by the host immune system and have low immunogenicity. This allows the engineered cells to survive for a longer period, thereby exerting better therapeutic effects in vivo.
[0061] Specifically, this invention also relates to engineered donor cells in which the expression of one or more TCR peptides is downregulated by miRNAs targeting TCR complex peptides (such as CD3z). Not to be limited by theory, the inventors believe that applying miRNAs in this manner can effectively and sustainably reduce TCR expression to negligible levels, such as 0%. Therefore, the genetically engineered donor cells described in this invention are allogeneic cells and can be used as allogeneic CAR T cells.
[0062] Engineered donor cells
[0063] In a first aspect, the present invention provides an engineered donor cell to which the host immune system has reduced rejection, wherein one or more polypeptides expressed on the cell surface involved in immune signal transduction are functionally regulated.
[0064] In this embodiment, the engineered donor cell refers to a cell derived from a donor and used as a therapeutic cell in cell-based therapies. In one embodiment, the engineered donor cell has been extracted from a donor. In this embodiment, the engineered donor cell is not a naturally occurring cell. In this embodiment, the engineered donor cell has been modified. In this embodiment, the engineered donor cell contains a miRNA expression construct. In this embodiment, the miRNA expression construct contained in the engineered donor cell is not endogenous to the donor cell.
[0065] In one embodiment, the engineered donor cells reduce the host immune system's rejection response, meaning that the host immune system's immune response to the engineered donor cells is reduced. In another embodiment, the host is a human. In yet another embodiment, the host is a patient. In yet another embodiment, the engineered donor cells are allogeneic to the host. In yet another embodiment, the host's CD8+ T cell response to the engineered donor cells is reduced. In yet another embodiment, the host's NK cell response to the engineered donor cells is reduced. In yet another embodiment, both the host's CD8+ T cell response and NK cell response to the engineered donor cells are reduced. In yet another embodiment, the engineered donor cells do not induce GvHD in the host. In yet another embodiment, the engineered donor cells have a reduced ability to induce GvHD in the host. In yet another embodiment, the host immune system's rejection response to the engineered donor cells is reduced compared to the rejection response to an equivalent unmodified donor cell. In yet another embodiment, the engineered donor cells have low immunogenicity to the host. In one embodiment, the engineered donor cells exhibit greater persistence in the host immune system, such as improved persistence relative to the equivalent unmodified donor cells. In another embodiment, "equivalent unmodified donor cells" refers to cells derived from the same source / donor as the engineered donor cells, but not modified to contain the miRNA construct according to the present invention.
[0066] In one embodiment, the cell surface-expressed polypeptide involved in immune signal transduction is a polypeptide encoded by the donor cell, wherein the polypeptide is expressed on the cell surface of the donor cell. In another embodiment, the encoded polypeptide is targeted for expression on the cell surface. Specifically, in any embodiment where the polypeptide is upregulated, the upregulated polypeptide may be a polypeptide expressed on the surface of the engineered donor cell. Specifically, in any embodiment where the polypeptide is functionally downregulated, the downregulated polypeptide may be a polypeptide expressed on the surface of an equivalent unmodified donor cell.
[0067] In this embodiment, peptides expressed on the cell surface that participate in immune signal transduction trigger an immune response from the host immune system. In this embodiment, the peptides can enhance the strength of the immune response. In this embodiment, the immune response targets engineered donor cells.
[0068] In some embodiments, functional regulation includes regulating the formation of functional complexes containing the polypeptide on the cell surface. In some embodiments, functional regulation includes directly regulating the polypeptide. In some embodiments, functional regulation includes regulating polypeptide expression. In some embodiments, functional regulation includes regulating the transcription or translation of a gene encoding the polypeptide. Therefore, in some embodiments, functional regulation includes targeting the polypeptide, the mRNA encoding the polypeptide, or the gene encoding the polypeptide. In some embodiments, the regulation is relative to an unmodified or engineered equivalent donor cell. In some embodiments, the regulation is relative to an equivalent donor cell that does not contain a non-endogenous miRNA construct. In some embodiments, the regulation is relative to an equivalent donor cell that does not contain the miRNA construct of the present invention. In some embodiments, the regulation in engineered donor cells is permanent.
[0069] In one embodiment, one or more cell surface-expressed peptides involved in immune signal transduction are downregulated. In another embodiment, the peptides are functionally downregulated. In another embodiment, the localization of the peptides to the cell surface is inhibited. In another embodiment, the number of peptides on the cell surface is reduced. In another embodiment, the formation of functional complexes on the cell surface comprising one or more of the peptides is inhibited. In another embodiment, the number of functional complexes on the cell surface comprising one or more of the peptides is reduced. In another embodiment, the functional complex is an HLA and / or TCR complex. In another embodiment, the formation of the HLA and / or TCR complex is inhibited.
[0070] In one embodiment, downregulation of one or more cell surface peptides involved in immune signal transduction is achieved by inhibiting the expression of target genes. In another embodiment, downregulation of one or more cell surface peptides involved in immune signal transduction is achieved by silencing target genes. In yet another embodiment, the expression of the target gene is reduced relative to an equivalent unmodified donor cell. It should be understood that, in the context of this invention, any reduction in peptide and gene expression or inhibition within engineered donor cells, for example, can be considered relative to an equivalent unmodified donor cell. In a general embodiment, the expression of the target gene is reduced to 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, or 0% or negligible amounts. In a preferred embodiment, the downregulation involves fine-tuning that maintains the reduced expression level, thereby improving the persistence of engineered donor cells in the host immune system, such as by inhibiting the killing effect of NK cells on engineered donor cells. Therefore, in the implementation, the expression of the target gene will not decrease to less than 30%, less than 20%, or less than 10%.
[0071] In this embodiment, downregulation of one or more cell surface-expressed polypeptides involved in immune signal transduction is achieved by inhibiting the miRNA of a target gene. In this embodiment, the miRNA contains a sequence that can bind complementary to the target gene mRNA transcript, thereby inhibiting the expression of the target gene. In this embodiment, downregulation can be achieved by inhibiting the expression of genes encoding cell surface-expressed polypeptides via miRNA. In this embodiment, downregulation can be achieved by inhibiting the expression of transcription factors that induce the expression of genes encoding cell surface-expressed polypeptides via miRNA.
[0072] In one embodiment, downregulation of cell surface-expressed peptides involved in immune signal transduction can be achieved using a miRNA construct containing a single miRNA hairpin targeting a gene encoding the peptide. In another embodiment, downregulation can be achieved using a miRNA construct containing two miRNA hairpins targeting a gene encoding the peptide. In yet another embodiment, downregulation can be achieved using a miRNA construct containing three miRNA hairpins targeting a gene encoding the peptide. In embodiments where more than one miRNA hairpin targets the same gene, the miRNA hairpins can target different transcript sequences contained in the mRNA transcript encoded by the gene. In this embodiment, the miRNA inhibition is permanent in engineered donor cells.
[0073] In one embodiment, one or more of the downregulated surface-expressed peptides are selected from the group consisting of HLA class I (HLA-I) peptides and HLA class II (HLA-II) peptides. In one embodiment, one or more of the downregulated surface-expressed peptides are peptides essential for the formation of functional HLA class I and / or HLA class II. Therefore, in this embodiment, HLA is downregulated. In this embodiment, HLA-I is downregulated. In this embodiment, HLA-II is downregulated. In this embodiment, both HLA-I and HLA-II are downregulated.
[0074] In this implementation, HLA class I peptides can be downregulated by inhibiting the expression of one or more of B2M (β-2-microglobulin), NLRC5 (containing NLR family CARD domain protein 5), TAP1, TAP2, TAPBP, RFX5 (regulatory factor X5), RFXANK (containing regulatory factor X-related ankyrin protein), and / or RFXAP (regulatory factor X-related protein).
[0075] In one embodiment, downregulation of HLA class I peptides is achieved by inhibiting B2M expression via miRNA. In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTGACTTTCCATTCTCTGCTGG (SEQ ID NO: 1; B2M_T2). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTGACTTTCCATTCTCTGCTGG (SEQ ID NO: 1; B2M_T2). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTATGCACGCTTAACTATCTTA (SEQ ID NO: 2; B2M_T3). In one embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTATGCACGCTTAACTATCTTA (SEQ ID NO: 2; B2M_T3). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TAAACCTGAATCTTTGGAGTAC (SEQ ID NO: 3; B2M_T5). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TAAACCTGAATCTTTGGAGTAC (SEQ ID NO: 3; B2M_T5). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CCAGCAGAGAATGGAAAGTCAA (SEQ ID NO: 30; B2M_T2). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CCAGCAGAGAATGGAAAGTCAA (SEQ ID NO: 30; B2M_T2).In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GTACTCCAAAGATTCAGGTTTA (SEQ ID NO: 31; B2M_T5). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GTACTCCAAAGATTCAGGTTTA (SEQ ID NO: 31; B2M_T5). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CGTGCATAAGTTAACTTCCAAT (SEQ ID NO: 32; B2M_T6). In one embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CGTGCATAAGTTAACTTCCAAT (SEQ ID NO: 32; B2M_T6). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GCTGTCTCCATGTTTGATGTAT (SEQ ID NO: 33; B2M_T7). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GCTGTCTCCATGTTTGATGTAT (SEQ ID NO: 33; B2M_T7). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GGTTGTGGTTAATCTGGTTTAT (SEQ ID NO: 34; B2M_T8). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GGTTGTGGTTAATCTGGTTTAT (SEQ ID NO: 34; B2M_T8).In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CTCTGCTTAGAATTTGGGGGAA (SEQ ID NO: 35; B2M_T9). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CTCTGCTTAGAATTTGGGGGAA (SEQ ID NO: 35; B2M_T9). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CATCCGACATTGAAGTTGACTT (SEQ ID NO: 36; B2M_T10). In one embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CATCCGACATTGAAGTTGACTT (SEQ ID NO: 36; B2M_T10). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CCAGCGTACTCCAAAGATTCAG (SEQ ID NO: 37; B2M_T11). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CCAGCGTACTCCAAAGATTCAG (SEQ ID NO: 37; B2M_T11). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CCCCACTGAAAAAGATGAGTAT (SEQ ID NO: 38; B2M_T12). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CCCCACTGAAAAAGATGAGTAT (SEQ ID NO: 38; B2M_T12).In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CGTACTCCAAAGATTCAGGTTT (SEQ ID NO: 39; B2M_T13). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CGTACTCCAAAGATTCAGGTTT (SEQ ID NO: 39; B2M_T13). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with AAGGCATGGTTGTGGTTAATCT (SEQ ID NO: 40; B2M_T14). In one embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with AAGGCATGGTTGTGGTTAATCT (SEQ ID NO: 40; B2M_T14). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GACTGGTCTTTCTATCTCTTGT (SEQ ID NO: 41; B2M_T15). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GACTGGTCTTTCTATCTCTTGT (SEQ ID NO: 41; B2M_T15). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GATCGAGACATGTAAGCAGCAT (SEQ ID NO: 42; B2M_T16). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GATCGAGACATGTAAGCAGCAT (SEQ ID NO: 42; B2M_T16).In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTGCTATGTGTCTGGGTTTCAT (SEQ ID NO: 43; B2M_T17). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTGCTATGTGTCTGGGTTTCAT (SEQ ID NO: 43; B2M_T17). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TAAGATAGTTAAGCGTGCATAA (SEQ ID NO: 44; B2M_T3). In an embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TAAGATAGTTAAGCGTGCATAA (SEQ ID NO: 44; B2M_T3).
[0076] NLRC5, TAP1, TAP2, TAPBP, RFX5, RFXANK, and RFXAP are transcription factors that induce HLA-I expression. In this implementation, HLA-I is downregulated by inhibiting the expression of these transcription factors via miRNA.
[0077] In one embodiment, downregulation of HLA class I peptides is achieved by miRNA inhibiting NLRC5 expression. In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTTGCATAGAAGATAACCTTCC (SEQ ID NO: 4; NLRC_T4). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTTGCATAGAAGATAACCTTCC (SEQ ID NO: 4; NLRC_4). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTAGTCTGTGAGTAAGCAAGGC (SEQ ID NO: 5; NLRC_T9). In one embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTAGTCTGTGAGTAAGCAAGGC (SEQ ID NO: 5; NLRC_T9). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TATAGACCAACAATCATGTATC (SEQ ID NO: 6; NLRC_T11). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TATAGACCAACAATCATGTATC (SEQ ID NO: 6; NLRC_T11). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TGAAAGCATAGCCTGTCTGCTG (SEQ ID NO: 7; NLRC_T16). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TGAAAGCATAGCCTGTCTGCTG (SEQ ID NO: 7; NLRC_T16).In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GGAAGGTTATCTTCTATGCAAA (SEQ ID NO: 45; NLRC_T4). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GGAAGGTTATCTTCTATGCAAA (SEQ ID NO: 45; NLRC_T4). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GCCTTGCTTACTCACAGACTAA (SEQ ID NO: 46; NLRC_T9). In one embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GCCTTGCTTACTCACAGACTAA (SEQ ID NO: 46; NLRC_T9). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GATACATGATTGTTGGTCTATA (SEQ ID NO: 47; NLRC_T11). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GATACATGATTGTTGGTCTATA (SEQ ID NO: 47; NLRC_T11). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CAGCAGACAGGCTATGCTTTCA (SEQ ID NO: 48; NLRC_T16). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CAGCAGACAGGCTATGCTTTCA (SEQ ID NO: 48; NLRC_T16).
[0078] In this embodiment, the downregulation of HLA class I peptides is achieved by inhibiting the expression of TAP1 via miRNA. In this embodiment, the downregulation of HLA class I peptides is achieved by inhibiting the expression of TAP2 via miRNA. In this embodiment, the downregulation of HLA class I peptides is achieved by inhibiting the expression of TAPBP via miRNA. In this embodiment, the downregulation of HLA class I peptides is achieved by inhibiting the expression of RFX5 via miRNA. In this embodiment, the downregulation of HLA class I peptides is achieved by inhibiting the expression of RFXANK via miRNA. In this embodiment, the downregulation of HLA class I peptides is achieved by inhibiting the expression of RFXAP via miRNA.
[0079] In a preferred embodiment, the expression of endogenous HLA class I molecules in the donor cells is downregulated. Therefore, in this embodiment, the engineered donor cells have reduced immunogenicity. In this embodiment, the expression of HLA class I molecules is reduced to levels of 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, 5% or less, 0%, or negligible. In this embodiment, reduced immunogenicity refers to a reduced level of rejection response from the immune system of the subject or patient induced by the engineered donor cells. In this embodiment, the level of rejection or killing of CD8+ T cells in the immune system of the subject or patient induced by the engineered donor cells is reduced. In this embodiment, reduced immunogenicity refers to the engineered donor cells being more persistent in mismatched hosts. In the context of this invention, "killing" refers to the killing effect of the engineered donor cells.
[0080] However, the inventors also unexpectedly discovered that miRNAs can be used to downregulate the expression of HLA class I peptides (such as B2M) in donor cells (thus achieving the aforementioned advantage of reduced immunogenicity) while still effectively maintaining the (reduced) HLA class I expression level. This can be termed "fine-tuning" of B2M. Therefore, in embodiments, the maintained HLA class I expression level in engineered donor cells is sufficient to inhibit NK cell killing. In embodiments, the reduction in HLA class I expression in engineered donor cells is sufficient to inhibit CD8+ cell killing, but the maintained HLA class I expression level in engineered donor cells is still sufficient to inhibit NK cell killing. In embodiments, the engineered donor cells described in this invention are able to avoid being killed by CD8+ T cells and NK cells. In embodiments, the CD8+ T cells and NK cells are those in the host / patient immune system. In embodiments, the engineered donor cells described in this invention can reduce CD8+ T cell-mediated cytotoxicity and NK cell-mediated cytotoxicity. Therefore, in embodiments, the expression of HLA class I molecules is reduced by 50% to 95% (including 50% and 95%), preferably 50% to 90% (including 50% and 90%), more preferably 70% to 95% (including 70% and 95%), and most preferably 70% to 90% (including 70% and 90%). In a preferred form of this embodiment, the engineered donor cells do not contain upregulated gene-modified non-classical HLA peptides.
[0081] In this implementation, the downregulation of HLA class II peptides is achieved by miRNA inhibiting the expression of one or more of CIITA (class II major histocompatibility complex transcription activator), RFX5, RFXANK, and / or RFXAP.
[0082] CIITA, RFX5, RFXANK, and RFXAP are transcription factors that induce HLA-II expression. In this implementation, HLA-II is downregulated by inhibiting the expression of these transcription factors via miRNA.
[0083] In one embodiment, downregulation of HLA-II peptides is achieved by inhibiting CIITA expression via miRNA. In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTTCCAAGGACTTCAGCTGGGG (SEQ ID NO: 8; CIITA_T13). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTTCCAAGGACTTCAGCTGGGG (SEQ ID NO: 8; CIITA_T13). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTAGTGTCCTCAGAGAACATGC (SEQ ID NO: 9; CIITA_T16). In one embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTAGTGTCCTCAGAGAACATGC (SEQ ID NO: 9; CIITA_T16). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TATTGTACAAGCTTAGCCTGAG (SEQ ID NO: 10; CIITA_T19). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TATTGTACAAGCTTAGCCTGAG (SEQ ID NO: 10; CIITA_T19). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CCCCAGCTGAAGTCCTTGGAAA (SEQ ID NO: 49; CIITA_T13). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CCCCAGCTGAAGTCCTTGGAAA (SEQ ID NO: 49; CIITA_T13).In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GCATGTTCTCTGAGGACACTAA (SEQ ID NO: 50; CIITA_T16). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GCATGTTCTCTGAGGACACTAA (SEQ ID NO: 50; CIITA_T16). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CTCAGGCTAAGCTTGTACAATA (SEQ ID NO: 51; CIITA_T19). In an embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with CTCAGGCTAAGCTTGTACAATA (SEQ ID NO: 51; CIITA_T19).
[0084] In one embodiment, the downregulation of HLA class II peptides is achieved by inhibiting the expression of RFX5 via miRNA. In another embodiment, the downregulation of HLA class II peptides is achieved by inhibiting the expression of RFXANK via miRNA. In yet another embodiment, the downregulation of HLA class II peptides is achieved by inhibiting the expression of RFXAP via miRNA.
[0085] In a preferred embodiment, the expression of endogenous HLA class II molecules in the donor cells is downregulated. Therefore, in this embodiment, the engineered donor cells have reduced immunogenicity. In this embodiment, the expression of HLA class II molecules is reduced to levels of 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, 5% or less, 0%, or negligible. In this embodiment, reduced immunogenicity refers to a reduced level of rejection response from the immune system of the subject or patient induced by the engineered donor cells. In this embodiment, the level of rejection or killing of CD4+ T cells in the immune system of the subject or patient induced by the engineered donor cells is reduced. In this embodiment, reduced immunogenicity refers to the engineered donor cells being more persistent in mismatched hosts. In the context of this invention, "killing" refers to the killing effect of the engineered donor cells.
[0086] In embodiments, the reduction in HLA class II expression in engineered donor cells is sufficient to suppress CD4+ cell killing. In embodiments, the CD4+ T cells are those in the host / patient immune system. In embodiments, the engineered donor cells of the present invention can induce reduced CD4+ T cell-mediated cytotoxicity. In a preferred embodiment, downregulation of HLA class II expression to reduce CD4+ cell killing is combined with downregulation of HLA class I expression to reduce CD8+ cell killing. In a preferred embodiment, this is further combined with the use of miRNA to reduce HLA class I expression while maintaining a low level of HLA class I expression to reduce NK cell killing. In an alternative preferred embodiment, this is further combined with effective inhibition of HLA class I expression (i.e., reducing its expression / function to a negligible level) and upregulation of non-classical HLA peptides (preferably HLA-E, F, or G peptides fused with B2M peptides according to the present invention).
[0087] In embodiments of the engineered donor cells of the present invention, one or more of the downregulated surface-expressed peptides are T-cell receptor (TCR) peptides. In embodiments, one or more of the peptides form portions of the TCR-CD3 complex. In embodiments, one or more of the peptides are associated with the TCR-CD3 complex. In embodiments, one or more of the peptides are essential for the formation of a functional TCR complex. Therefore, in embodiments, the TCR-CD3 complex is downregulated.
[0088] In this implementation, the downregulation of TCR peptides is achieved by miRNAs inhibiting the expression of TCRa (TCRα, TRAC), TCRb (TCRβ), CD3g (CD3γ), CD3d (CD3δ), CD3e (CD3ε) and / or CD3z (CD3ζ).
[0089] In the most preferred embodiment, the downregulation of the TCR peptide is achieved by inhibiting CD3z expression via miRNA. In this embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTTGGAGCTAAATATAACCAAA (SEQ ID NO: 11; CD3z_T1). In this embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTTGGAGCTAAATATAACCAAA (SEQ ID NO: 11; CD3z_T1). In this embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TATCCTAGTACATTGACGGGTT (SEQ ID NO: 12; CD3z_T2). In one embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TATCCTAGTACATTGACGGGTT (SEQ ID NO: 12; CD3z_T2). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTCCACTTCATCTTGTCCTTTC (SEQ ID NO: 13; CD3z_T3). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTCCACTTCATCTTGTCCTTTC (SEQ ID NO: 13; CD3z_T3). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTTGGTTATATTTAGCTCCAAA (SEQ ID NO: 52; CD3z_T1). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTTGGTTATATTTAGCTCCAAA (SEQ ID NO: 52; CD3z_T1).In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with AACCCGTCAATGTACTAGGATA (SEQ ID NO: 53; CD3z_T2). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with AACCCGTCAATGTACTAGGATA (SEQ ID NO: 53; CD3z_T2). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GAAAGGACAAGATGAAGTGGAA (SEQ ID NO: 54; CD3z_T3). In an embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GAAAGGACAAGATGAAGTGGAA (SEQ ID NO: 54; CD3z_T3).
[0090] In one embodiment, the downregulation of the TCR peptide is achieved by inhibiting the expression of TCRa via miRNA. In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TCATGAGCAGATTAAACCCGGC (SEQ ID NO: 14; TRAC_T1). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TCATGAGCAGATTAAACCCGGC (SEQ ID NO: 14; TRAC_T1). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTAGGTTCGTATCTGTTTCAAA (SEQ ID NO: 15; TRAC_T4). In one embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTAGGTTCGTATCTGTTTCAAA (SEQ ID NO: 15; TRAC_T4). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TCAGATTTGTTGCTCCAGGCCA (SEQ ID NO: 15; TRAC_T5). In yet another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TCAGATTTGTTGCTCCAGGCCA (SEQ ID NO: 15; TRAC_T5). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GCCGGGTTTAATCTGCTCATGA (SEQ ID NO: 55; TRAC_T1). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with GCCGGGTTTAATCTGCTCATGA (SEQ ID NO: 55; TRAC_T1).In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTTGAAACAGATACGAACCTAA (SEQ ID NO: 56; TRAC_T4). In another embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TTTGAAACAGATACGAACCTAA (SEQ ID NO: 56; TRAC_T4). In yet another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TGGCCTGGAGCAACAAATCTGA (SEQ ID NO: 57; TRAC_T5). In an embodiment, the miRNA comprises a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with TGGCCTGGAGCAACAAATCTGA (SEQ ID NO: 57; TRAC_T5).
[0091] In one embodiment, the downregulation of the TCR peptide is achieved by inhibiting the expression of TCRb via miRNA. In another embodiment, the downregulation of the TCR peptide is achieved by inhibiting the expression of CD3g via miRNA. In yet another embodiment, the downregulation of the TCR peptide is achieved by inhibiting the expression of CD3d via miRNA. In yet another embodiment, the downregulation of the TCR peptide is achieved by inhibiting the expression of CD3e via miRNA.
[0092] In a preferred embodiment, the endogenous TCR of the engineered donor cells is downregulated. In this embodiment, the cell is a T cell. In this embodiment, the cell is a CAR T cell. Therefore, in this embodiment, the engineered donor cells are allogeneic cells, such as allogeneic CAR-T cells. In this embodiment, TCR expression is reduced to 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, 5% or less, 0%, or negligible. In this embodiment, the endogenous TCR of the engineered donor cells is not functionally expressed. In this embodiment, when co-cultured with mismatched peripheral blood mononuclear cells (PBMCs), the allogeneic reactivity induced by the engineered donor cells in mixed lymphocyte reactions is reduced. In this embodiment, "mismatched" means that the PBMCs are derived from a different host than the engineered donor cells. In this embodiment, mismatched means that the PBMCs and the engineered donor cells are allogeneic. In this embodiment, when engineered donor cells are co-cultured with mismatched PBMCs, a decrease in CD137 expression levels is induced in CD8+ CAR T cells. In this embodiment, CD137 expression levels are reduced to 40%, 30%, 20%, 10%, 5%, 0%, or negligible levels. In this embodiment, the engineered donor cells do not exhibit allogeneic reactivity. In this embodiment, this reduction is relative to the mixed lymphocyte response induced when equivalent unmodified donor cells are co-cultured with mismatched PBMCs. In this embodiment, the engineered donor cells are suitable for allogeneic administration. In this embodiment, the engineered donor cells are suitable for allogeneic CAR T cell therapy.
[0093] In a preferred embodiment of the engineered donor cells of this invention, both classical HLA peptides and TCR peptides are downregulated. In this preferred embodiment, the HLA peptides are endogenous HLA class I and / or class II peptides. Therefore, in this embodiment, the resulting engineered donor cells have the reduced immunogenicity described above and are suitable for allogeneic administration as described above.
[0094] In embodiments of the engineered donor cells of this invention, one or more of the downregulated surface-expressed peptides are CD58 peptides. In embodiments, the downregulation of the CD58 peptide is achieved by miRNA targeting CD58 expression. In embodiments, the downregulation of the CD58 peptide is achieved by miRNA inhibiting CD58 expression. In embodiments, CD58 is downregulated to reduce bystander T cell activation. In embodiments, CD58 is downregulated to limit co-activation of bystander T cells. In embodiments, CD58 is downregulated to reduce the rejection response of host CD4+ and CD8+ T cells.
[0095] In any embodiment of the invention, wherein the engineered donor cell comprises a miRNA expression construct targeting one or more of the B2M, CIITA, NLRC5, CD3z, and TRAC genes, the transcripts of these corresponding genes targeted by the miRNA expression construct may be any transcripts defined in Table 1 below.
[0096] Table 1: Target Transcripts
[0097] In Table 1, the first column represents the target protein / gene, and the second and third columns represent the transcripts of that gene. Any miRNA expression construct of the present invention targeting the gene shown in the first column preferably targets the transcript. The transcripts provided in the second column are referenced from the NCBI database, and the transcripts provided in the third column are referenced from the ENSEMBL database. These database references correspond to the major releases available online as of May 3, 2023. Therefore, for example, for any miRNA expression construct of the present invention containing a miRNA hairpin targeting CD3z, the miRNA hairpin targeting CD3z preferably targets any transcript of NM_198053, NM_001378515, NM_001378516, ENST00000362089, and ENST00000392122. Therefore, the hairpin targeting CD3z preferably targets a sequence contained in one of the listed transcripts. This applies to each gene and its associated transcript listed in Table 1. In embodiments, the miRNA expression construct targeting the genes listed in Table 1 of the present invention targets transcripts with 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the transcripts listed in Table 1. The transcripts are those corresponding to the target genes. Preferably, for the miRNA expression construct of the present invention, the above applies to all listed target genes, such as all two, three, four, five, or six listed target genes.
[0098] In this embodiment, one or more cell surface peptides involved in immune signal transduction are upregulated. It should be understood that upregulation simply means increasing the expression of the peptide, which can start at zero and does not necessarily mean that these peptides were previously expressed. For example, upregulation may involve the expression of a naturally non-expressed peptide CAR. For example, if one or more of CD47 and / or PD-L1 are already expressed in donor cells, upregulating CD47 and / or PD-L1 expression may involve increasing the levels of CD47 and / or PD-L1. In this embodiment, upregulation includes the expression of the peptide. In this embodiment, the peptide is not expressed in equivalent unmodified donor cells.
[0099] In one embodiment, upregulation is achieved through the expression of a transcript. In another embodiment, the expressed transcript encodes one or more polypeptides expressed on the cell surface that participate in immune signal transduction. In another embodiment, the expressed transcript is a sequence encoding a protein. In another embodiment, the expressed transcript is a nucleic acid. In another embodiment, the expressed transcript is a non-endogenous nucleic acid. In another embodiment, the expressed transcript comprises RNA. In another embodiment, the expressed transcript comprises mRNA encoding a polypeptide.
[0100] In this embodiment, the surface-expressed peptides involved in the upregulation of immune signal transduction are selected from the group consisting of non-classical HLA peptides, CD47, PD-L1, and CAR.
[0101] In one embodiment, the upregulated surface expression peptide involved in immune signal transduction is a non-classical HLA-I peptide. In another embodiment, the non-classical HLA-I peptide is an HLA-E, HLA-G, or HLA-F peptide. In yet another embodiment, the non-classical HLA-I peptide is a genetically modified HLA-E, HLA-G, or HLA-F peptide. In yet another embodiment, the genetically modified HLA-E, HLA-G, and / or HLA-F peptide is a B2M fusion protein. In yet another embodiment, the non-classical HLA-I molecule is an HLA-E-B2M fusion protein, an HLA-G-B2M fusion protein, or an HLA-F-B2M fusion protein. In yet another embodiment, the B2M fusion protein comprises the non-classical HLA peptide or a functional fragment thereof, and a B2M peptide or a functional fragment thereof. In yet another embodiment, the miRNAs targeting endogenous HLA I and / or II of the present invention do not inhibit the expression of HLA-E, HLA-G, and / or HLA-F peptides.
[0102] In one embodiment, the non-classical HLA class I molecule is an HLA-B2M fusion protein, which comprises a B2M polypeptide encoded by SEQ ID NO: 27, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In another embodiment, the non-classical HLA class I molecule is an HLA-E-B2M fusion protein, which comprises a B2M polypeptide encoded by SEQ ID NO: 27, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In yet another embodiment, the non-classical HLA class I molecule is an HLA-F-B2M fusion protein, which comprises a B2M polypeptide encoded by SEQ ID NO: 27, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In some embodiments, the non-classical HLA class I molecule is an HLA-G-B2M fusion protein comprising a B2M polypeptide encoded by SEQ ID NO: 27, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In preferred embodiments of these types, upregulation of the non-classical HLA class I molecule is achieved through codon-optimized sequences. In preferred embodiments of these types, upregulation of the non-classical HLA class I molecule is achieved by expressing a sequence comprising SEQ ID NO: 27, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In some embodiments, the sequence is an RNA (such as mRNA) equivalent to SEQ ID NO: 27, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it.
[0103] In one embodiment, the non-classical HLA class I molecule is an HLA-E-B2M fusion protein encoded by SEQ ID NO: 19, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In another embodiment, the non-classical HLA class I molecule is an HLA-E-B2M fusion protein comprising the sequence of SEQ ID NO: 20, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it.
[0104] In a preferred embodiment, the non-classical HLA class I molecule is an HLA-E-B2M fusion protein encoded by a codon-optimized nucleotide sequence. In a preferred embodiment, the non-classical HLA class I molecule is encoded by SEQ ID NO: 21, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In an embodiment, the non-classical HLA class I molecule is an HLA-E-B2M fusion protein comprising the sequence of SEQ ID NO: 22, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it.
[0105] In this embodiment, the upregulated surface-expressed polypeptide involved in immune signal transduction is CD47. Herein, CD47 includes full-length polypeptides and truncated polypeptides, such as functional fragments of CD47. In this embodiment, CD47 is upregulated to inhibit phagocytosis of engineered donor cells by macrophages. In this embodiment, the polypeptide is a functional fragment of CD47. In this embodiment, the polypeptide is a truncated CD47 polypeptide. In this embodiment, the truncated CD47 polypeptide is encoded by the sequence of SEQ ID NO: 23, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In this embodiment, the truncated CD47 polypeptide comprises the sequence of SEQ ID NO: 24, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it.
[0106] In this embodiment, the upregulated surface-expressed polypeptide involved in immune signal transduction is PD-L1. Herein, PD-L1 includes full-length polypeptides and truncated polypeptides, such as functional fragments of PD-L1. In this embodiment, PD-L1 is upregulated to induce unresponsiveness / exhaustion of bystander T cells. In this embodiment, the polypeptide is a functional fragment of PD-L1. In this embodiment, PD-L1 is encoded by the sequence of SEQ ID NO: 25, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In this embodiment, the truncated PD-L1 polypeptide comprises the sequence of SEQ ID NO: 26, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it.
[0107] In one embodiment, the upregulated surface-expressed polypeptide involved in immune signal transduction is a CAR. In another embodiment, the CAR is an anti-CD19 CAR. In yet another embodiment, the CAR is encoded by SEQ ID NO: 17, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In yet another embodiment, the CAR comprises the sequence of SEQ ID NO: 18, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it.
[0108] In some embodiments, surface-expressed non-classical HLA class I molecules are upregulated, while surface-expressed HLA class I molecules are downregulated. In others, surface-expressed non-classical HLA class I molecules are upregulated, while surface-expressed classical HLA class I molecules are downregulated. In still others, surface-expressed non-classical HLA class I molecules are upregulated, while surface-expressed endogenous HLA class I molecules are downregulated. In these preferred embodiments, the downregulated HLA class I molecules are effectively silenced. Therefore, in these embodiments, the downregulated HLA class I molecules inhibit CD8+ T cell killing, while the upregulated non-classical HLA class I molecules inhibit NK cell killing.
[0109] In one embodiment, surface-expressed CAR is upregulated, while surface-expressed TCR is downregulated. In another embodiment, TCR is downregulated by miRNAs targeting sequences contained in the endogenous TCR sequence but not in the CAR sequence. In yet another embodiment, TCR downregulation is achieved by miRNAs that do not target the CD3z activation domain. This downregulation is particularly preferred in any embodiment of the invention where the miRNA inhibits CD3z expression.
[0110] In some embodiments, the engineered donor cells of this invention further express a safety switch gene or a suicide gene. In some embodiments, the safety switch gene or suicide gene helps induce exhaustion of the engineered donor cells. In some embodiments, exhaustion is induced if the engineered donor cells are tumorigenic, and / or if the engineered donor cells cause adverse events (cytokine storm (CRS)).
[0111] In an embodiment, the suicide gene or safety switch gene is selected from the group consisting of: herpes simplex virus thymidine kinase (HSV-tk), inducible caspase 9 (iCasp9), truncated endothelial growth factor receptor (tEGFR), RQR8, dihydrofolate reductase (DHFR), CD20 or truncated CD20 (tCD20), and thymidine synthase (TYMS).
[0112] In an embodiment, the engineered donor cells described in this invention further express a selection gene. In an embodiment, the selection gene is LNGFR, a truncated endothelial growth factor receptor (tEGFR), tCD19, CD20, or a truncated CD20 (tCD20), tCD34, or a derivative thereof.
[0113] Used to construct miRNA expression constructs for allogeneic cells
[0114] A second aspect of the invention relates to a miRNA expression construct present in the engineered donor cells described herein and usable for producing the engineered donor cells described herein.
[0115] In a second aspect, the present invention provides a miRNA expression construct comprising one or more miRNA hairpins targeting B2M, NLRC5, TAP1, TAP2, TAPBP, RFX5, RFXANK, RFXAP, CIITA, TCRA, TCRb, CD3d, CD3g, CD3e and / or CD3z.
[0116] In one embodiment, the construct further comprises an expressed transcript. In another embodiment, the expressed transcript is a sequence encoding a protein.
[0117] In an embodiment, the miRNA expression construct comprises at least a first miRNA hairpin and a second miRNA hairpin, wherein the first miRNA hairpin and the second miRNA hairpin target a combination of two sequences, the two sequences being independently selected from any one of SEQ ID NO: 1 to 16 having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of them.
[0118] In an embodiment, the miRNA expression construct comprises at least a first miRNA hairpin and a second miRNA hairpin, wherein the first miRNA hairpin and the second miRNA hairpin respectively target combinations selected from the following: SEQ ID NO: 1 and 2, SEQ ID NO: 1 and 3, SEQ ID NO: 1 and 4, SEQ ID NO: 1 and 5, SEQ ID NO: 1 and 6, SEQ ID NO: 1 and 7, SEQ ID NO: 1 and 8, SEQ ID NO: 1 and 9, SEQ ID NO: 1 and 10, SEQ ID NO: 1 and 11, SEQ ID NO: 1 and 12, SEQ ID NO: 1 and 13, SEQ ID NO: 1 and 14, SEQ ID NO: 1 and 15, SEQ ID NO: 1 and 16, SEQ ID NO: 2 and 2, SEQ ID NO: 2 and 3, SEQ ID NO: 2 and 4, SEQ ID NO: 2 and 5, SEQ ID NO: 2 and 6, SEQ ID NO: 2 and 7, SEQ ID NO: 2 and 8, SEQ ID NO: 2 and 7, SEQ ID NO: 2 and 8, SEQ ID NO: 2 and 2, SEQ ID NO: 2 and 3, SEQ ID NO: 2 and 4, SEQ ID NO: 2 and 5, SEQ ID NO: 2 and 6 ... SEQ ID NO: 2 and 9, SEQ ID NO: 2 and 10, SEQ ID NO: 2 and 11, SEQ ID NO: 2 and 12, SEQ ID NO: 2 and 13, SEQ ID NO: 2 and 14, SEQ ID NO: 2 and 15, SEQ ID NO: 2 and 16, SEQ ID NO: 3 and 3, SEQ ID NO: 3 and 4, SEQ ID NO: 3 and 5, SEQ ID NO: 3 and 6, SEQ ID NO: 3 and 7, SEQ ID NO: 3 and 8, SEQ ID NO: 3 and 9, SEQ ID NO: 3 and 10, SEQ ID NO: 3 and 11, SEQ ID NO: 3 and 12, SEQ ID NO: 3 and 13, SEQ ID NO: 3 and 14, SEQ ID NO: 3 and 15, SEQ ID NO: 3 and 16, SEQ ID NO: 4 and 4, SEQ ID NO: 4 and 5, SEQ ID NO: 4 and 6, SEQ ID NO: 4 and 7, SEQ ID NO: 4 and 8, SEQ ID NO: 4 and 9, SEQ ID NO: 4 and 10, SEQ ID NO: 4 and 11, SEQ ID NO: 4 and 12, SEQ ID NO: 4 and 13, SEQ ID NO: 4 and 14, SEQ ID NO: 4 and 15, SEQ ID NO: 4 and 16, SEQ ID NO: 5 and 5, SEQ ID NO: 5 and 6, SEQ ID NO:5 and 7, SEQ ID NO: 5 and 8, SEQ ID NO: 5 and 9, SEQ ID NO: 5 and 10, SEQ ID NO: 5 and 11, SEQ ID NO: 5 and 12, SEQ ID NO: 5 and 13, SEQ ID NO: 5 and 14, SEQ ID NO: 5 and 15, SEQ ID NO: 5 and 16, SEQ ID NO: 6 and 6, SEQ ID NO: 6 and 7, SEQ ID NO: 6 and 8, SEQ ID NO: 6 and 9, SEQ ID NO: 6 and 10, SEQ ID NO: 6 and 11, SEQ ID NO: 6 and 12, SEQ ID NO: 6 and 13, SEQ ID NO: 6 and 14, SEQ ID NO: 6 and 15, SEQ ID NO: 6 and 16, SEQ ID NO: 7 and 7, SEQ ID NO: 7 and 8, SEQ ID NO: 7 and 9, SEQ ID NO: 7 and 10, SEQ ID NO: 7 and 11, SEQ ID NO: 7 and 12, SEQ ID NO: 7 and 13, SEQ ID NO: 7 and 14, SEQ ID NO: 7 and 15, SEQ ID NO: 7 and 16, SEQ ID NO: 8 and 8, SEQ ID NO: 8 and 9, SEQ ID NO: 8 and 10, SEQ ID NO: 8 and 11, SEQ ID NO: 8 and 12, SEQ ID NO: 8 and 13, SEQ ID NO: 8 and 14, SEQ ID NO: 8 and 15, SEQ ID NO: 8 and 16, SEQ ID NO: 9 and 9, SEQ ID NO: 9 and 10, SEQ ID NO: 9 and 11, SEQ ID NO: 9 and 12, SEQ ID NO: 9 and 13, SEQ ID NO: 9 and 14, SEQ ID NO: 9 and 15, SEQ ID NO: 9 and 16, SEQ ID NO: 10 and 10, SEQ ID NO: 10 and 11, SEQ SEQ ID NO: 10 and 12, SEQ ID NO: 10 and 13, SEQ ID NO: 10 and 14, SEQ ID NO: 10 and 15, SEQ ID NO: 10 and 16, SEQ ID NO: 11 and 11, SEQ ID NO: 11 and 12, SEQ ID NO: 11 and 13, SEQ ID NO: 11 and 14, SEQ ID NO: 11 and 15, SEQ ID NO: 11 and 16, SEQ ID NO: 12 and 12, SEQ ID NO: 12 and 13, SEQ IDSEQ ID NO: 12 and 14, SEQ ID NO: 12 and 15, SEQ ID NO: 12 and 16, SEQ ID NO: 13 and 13, SEQ ID NO: 13 and 14, SEQ ID NO: 13 and 15, SEQ ID NO: 13 and 16, SEQ ID NO: 14 and 14, SEQ ID NO: 14 and 15, SEQ ID NO: 14 and 16, SEQ ID NO: 15 and 15, SEQ ID NO: 15 and 16, and SEQ ID NO: 16 and 16.
[0119] In an embodiment, the miRNA expression construct comprises at least a first miRNA hairpin and a second miRNA hairpin, wherein the first miRNA hairpin and the second miRNA hairpin respectively target combinations selected from the following: SEQ ID NO: 30 and 31, SEQ ID NO: 30 and 32, SEQ ID NO: 30 and 33, SEQ ID NO: 30 and 34, SEQ ID NO: 30 and 35, SEQ ID NO: 30 and 36, SEQ ID NO: 30 and 37, SEQ ID NO: 30 and 38, SEQ ID NO: 30 and 39, SEQ ID NO: 30 and 40, SEQ ID NO: 30 and 41, SEQ ID NO: 30 and 42, SEQ ID NO: 30 and 43, SEQ ID NO: 30 and 44, SEQ ID NO: 31 and 31, SEQ ID NO: 31 and 32, SEQ ID NO: 31 and 33, SEQ ID NO: 31 and 34, SEQ ID NO: 31 and 35, SEQ ID NO: 31 and 36, SEQ ID NO: 31 and 37, SEQ ID NO: 31 and 38, SEQ ID NO: 31 and 39, SEQ ID NO: 31 and 40, SEQ ID NO: 31 and 41, SEQ ID NO: 31 and 42, SEQ ID NO: 31 and 43, SEQ ID NO: 32 and 32, SEQ ID NO: 32 and 33, SEQ ID NO: 32 and 34, SEQ ID NO: 32 and 35, SEQ ID NO: 32 and 36, SEQ ID NO: 32 and 37, SEQ ID NO: 32 and 38, SEQ ID NO: 32 and 39, SEQ ID NO: 32 and 40, SEQ ID NO: 32 and 41, SEQ ID NO: 32 and 42, SEQ ID NO: 32 and 43, SEQ ID NO: 33 and 33, SEQ ID NO: 33 and 34, SEQ ID NO: 33 and 35, SEQ ID NO: 33 and 36, SEQ ID NO: 33 and 37, SEQ ID NO: 33 and 38, SEQ ID NO: 33 and 39, SEQ ID NO: 33 and 40, SEQ ID NO: 33 and 41, SEQ ID NO: 33 and 42, SEQ ID NO: 33 and 43, SEQ ID NO: 34 and 34, SEQ ID NO: 34 and 35, SEQ ID NO: 34 and 36, SEQ ID NO: 34 and 37, SEQ ID NO:34 and 38, SEQ ID NO: 34 and 39, SEQ ID NO: 34 and 40, SEQ ID NO: 34 and 41, SEQ ID NO: 34 and 42, SEQ ID NO: 34 and 43, SEQ ID NO: 35 and 35, SEQ ID NO: 35 and 36, SEQ ID NO: 35 and 37, SEQ ID NO: 35 and 38, SEQ ID NO: 35 and 39, SEQ ID NO: 35 and 40, SEQ ID NO: 35 and 41, SEQ ID NO: 35 and 42, SEQ ID NO: 35 and 43, SEQ ID NO: 36 and 36, SEQ ID NO: 36 and 37, SEQ ID NO: 36 and 38, SEQ ID NO: 36 and 39, SEQ ID NO: 36 and 40, SEQ ID NO: 36 and 41, SEQ ID NO: 36 and 42, SEQ ID SEQ ID NO:36 and 43, SEQ ID NO:37 and 37, SEQ ID NO:37 and 38, SEQ ID NO:37 and 39, SEQ ID NO:37 and 40, SEQ ID NO:37 and 41, SEQ ID NO:37 and 42, SEQ ID NO:37 and 43, SEQ ID NO:38 and 38, SEQ ID NO:38 and 39, SEQ ID NO:38 and 40, SEQ ID NO:38 and 41, SEQ ID NO:38 and 42, SEQ ID NO:38 and 43, SEQ ID NO:39 and 39, SEQ ID NO:39 and 40, SEQ ID NO:39 and 41, SEQ ID NO:40 and 42, SEQ ID NO: 40 and 43, SEQ ID NO: 41 and 41, SEQ ID NO: 41 and 42, SEQ ID NO: 41 and 43, SEQ ID NO: 42 and 42, SEQ ID NO: 42 and 43, and SEQ ID NO: 43 and 43.
[0120] In an embodiment, the miRNA expression construct comprises at least a first miRNA hairpin and a second miRNA hairpin, wherein the first miRNA hairpin and the second miRNA hairpin respectively target combinations selected from the following: SEQ ID NO: 30 and 44, SEQ ID NO: 30 and 45, SEQ ID NO: 30 and 45, SEQ ID NO: 30 and 46, SEQ ID NO: 30 and 47, SEQ ID NO: 30 and 48, SEQ ID NO: 30 and 49, SEQ ID NO: 30 and 50, SEQ ID NO: 30 and 51, SEQ ID NO: 30 and 52, SEQ ID NO: 30 and 53, SEQ ID NO: 30 and 54, SEQ ID NO: 30 and 55, SEQ ID NO: 30 and 56, SEQ ID NO: 30 and 57, SEQ ID NO: 31 and 44, SEQ ID NO: 31 and 45, SEQ ID NO: 31 and 46, SEQ ID NO: SEQ ID NO: 31 and 47, SEQ ID NO: 31 and 48, SEQ ID NO: 31 and 49, SEQ ID NO: 31 and 50, SEQ ID NO: 31 and 51, SEQ ID NO: 31 and 52, SEQ ID NO: 31 and 53, SEQ ID NO: 31 and 54, SEQ ID NO: 31 and 55, SEQ ID NO: 31 and 56, SEQ ID NO: 31 and 57, SEQ ID NO: 44 and 44, SEQ ID NO: 44 and 45, SEQ ID NO: 44 and 46, SEQ ID NO: 44 and 47, SEQ ID NO: 44 and 48, SEQ ID NO: 44 and 49, SEQ ID NO: 44 and 50, SEQ ID NO: 44 and 51, SEQ ID NO: 44 and 52, SEQ ID NO: 44 and 53, SEQ ID NO: 44 and 54, SEQ ID NO: 44 and 55, SEQ ID NO: 44 and 56, SEQ ID NO: 44 and 57, SEQ ID NO: 45 and 45, SEQ ID NO: 45 and 46, SEQ ID NO: 45 and 47, SEQ ID NO: 45 and 48, SEQ ID NO: 45 and 49, SEQ ID NO: 45 and 50, SEQ ID NO: 45 and 51, SEQ ID NO: 45 and 52, SEQ ID NO: 45 and 53, SEQ ID NO: 45 and 54, SEQ ID NO: 45 and 55, SEQ ID NO:45 and 56, SEQ ID NO: 45 and 57, SEQ ID NO: 46 and 46, SEQ ID NO: 46 and 47, SEQ ID NO: 46 and 48, SEQ ID NO: 46 and 49, SEQ ID NO: 46 and 50, SEQ ID NO: 46 and 51, SEQ ID NO: 46 and 52, SEQ ID NO: 46 and 53, SEQ ID NO: 46 and 54, SEQ ID NO: 46 and 55, SEQ ID NO: 46 and 56, SEQ ID NO: 46 and 57, SEQ ID NO: 47 and 47, SEQ ID NO: 47 and 48, SEQ ID NO: 47 and 49, SEQ ID NO: 47 and 50, SEQ ID NO: 47 and 51, SEQ ID NO: 47 and 52, SEQ ID NO: 47 and 53, SEQ ID NO: 47 and 54, SEQ ID SEQ ID NO:47 and 55, SEQ ID NO:47 and 56, SEQ ID NO:47 and 57, SEQ ID NO:48 and 48, SEQ ID NO:48 and 49, SEQ ID NO:48 and 50, SEQ ID NO:48 and 51, SEQ ID NO:48 and 52, SEQ ID NO:48 and 53, SEQ ID NO:48 and 54, SEQ ID NO:48 and 55, SEQ ID NO:48 and 56, SEQ ID NO:48 and 57, SEQ ID NO:49 and 49, SEQ ID NO:49 and 50, SEQ ID NO:49 and 51, SEQ ID NO:49 and 52, SEQ ID NO:49 and 53, SEQ ID NO:49 and 54, SEQ ID NO:49 and 55, SEQ ID NO:49 and 56, SEQ ID NO:49 and 57, SEQ ID NO: 50 and 50, SEQ ID NO: 50 and 51, SEQ ID NO: 50 and 52, SEQ ID NO: 50 and 53, SEQ ID NO: 50 and 54, SEQ ID NO: 50 and 55, SEQ ID NO: 50 and 56, SEQ ID NO: 50 and 57, SEQ ID NO: 51 and 51, SEQ ID NO: 51 and 52, SEQ ID NO: 51 and 53, SEQ ID NO: 51 and 54, SEQ ID NO: 51 and 55, SEQ ID NO: 51 and 56, SEQ ID NO: 51 and 57, SEQ ID NO:52 and 52, SEQ ID NO: 52 and 53, SEQ ID NO: 52 and 54, SEQ ID NO: 52 and 55, SEQ ID NO: 52 and 56, SEQ ID NO: 52 and 57, SEQ ID NO: 53 and 53, SEQ ID NO: 53 and 54, SEQ ID NO: 53 and 55, SEQ ID NO: 53 and 56, SEQ ID NO: 53 and 57, SEQ ID NO: 54 and 54, SEQ ID NO: 54 and 55, SEQ ID NO: 54 and 56, SEQ ID NO: 54 and 57, SEQ ID NO: 55 and 55, SEQ ID NO: 55 and 56, SEQ ID NO: 55 and 57, SEQ ID NO: 56 and 56, SEQ ID NO: 56 and 57, and SEQ ID NO: 57 and 57.
[0121] The terms "first," "second," etc., used in this article do not necessarily refer to the gene sequence of miRNA hairpins, but are only used to define several separate miRNA hairpin elements.
[0122] In this implementation, there are two copies of the first miRNA hairpin and / or two copies of the second miRNA hairpin.
[0123] In this implementation, there are three copies of the first miRNA hairpin and / or three copies of the second miRNA hairpin.
[0124] In this implementation, the miRNA expression construct contains at least two different miRNA hairpins that target different regions of the same transcript.
[0125] In this implementation, the miRNA expression construct contains at least two different miRNA hairpins that target different transcripts of the same gene.
[0126] In this implementation, the miRNA expression construct contains at least two different miRNA hairpins that target different splice variants of the same gene.
[0127] In one embodiment, the miRNA expression construct further includes a promoter element. In another embodiment, the promoter element is a promoter. In another embodiment, the promoter is a eukaryotic promoter. In another embodiment, the eukaryotic promoter is a Pol II or Pol III promoter. In another embodiment, the promoter is an inducible promoter, a tissue-specific promoter, a cell lineage-specific promoter, or a synthetic promoter. In another embodiment, the promoter element is selected from the promoter elements in Table 2. In another embodiment, the promoter element is a UBI promoter. In another embodiment, the promoter is an EF1α promoter, a derivative of an EF1α promoter, or a short EF1 promoter.
[0128] In one embodiment, the miRNA expression construct further includes a spacer. In one embodiment, the spacer includes an enhancer. In one embodiment, the spacer is an enhancer. In one embodiment, the spacer is at least 50 nucleotides long. In one embodiment, the spacer is 50 to 1000 nucleotides long. In one embodiment, the spacer is 50 to 900, 50 to 800, 100 to 800, or 50 to 800 nucleotides long. In one embodiment, the spacer is at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, or 200 nucleotides long. In one embodiment, the spacer is a GFP sequence. In a preferred embodiment, the spacer is a GFP1 sequence. In a preferred embodiment, the spacer is a GFP1 sequence encoded by a sequence comprising SEQ ID NO: 28, or a sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In a preferred embodiment, the spacer is a GFP2 sequence. In a most preferred embodiment, the spacer is a GFP2 sequence encoded by a sequence comprising SEQ ID NO: 29, or a sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it.
[0129] In one embodiment, the spacer is located between the promoter and the miRNA hairpin. In another embodiment, the spacer is heterogeneous to the promoter element. In yet another embodiment, the spacer contains an encoded open reading frame.
[0130] In this implementation, at least two miRNA hairpins are separated by intercalation sequences.
[0131] In this implementation, the expressed transcript is at least one gene selected from the group consisting of non-classical HLA class I, chimeric antigen receptor, CD47, and PD-L1.
[0132] In one embodiment, the expressed transcript comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 17, 19, or 21. In another embodiment, the expressed transcript encodes a protein having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 18, 20, or 22.
[0133] In an embodiment, the expressed transcript encodes any non-classical HLA, the definition of which is the same as the upregulated non-classical HLA contained in the engineered donor cells of the present invention.
[0134] In one embodiment, the miRNA expression construct includes a sequence encoding a functional portion of immune effector cells for redirection. In another embodiment, the miRNA expression construct includes a sequence encoding an engineered T-cell receptor. In yet another embodiment, the miRNA expression construct includes a sequence encoding a CAR. In yet another embodiment, the CAR is a CAR that targets HIV-infected cells or tumor cells, optionally said CAR is an anti-CD19 CAR, optionally said CAR is FMC63. In yet another embodiment, the chimeric antigen receptor is a bispecific chimeric antigen receptor or a bichimeric antigen receptor.
[0135] In one embodiment, the miRNA hairpin of the miRNA expression construct is controlled by a first promoter, and the sequence encoding the T-cell receptor or chimeric antigen receptor is controlled by a second promoter; or, the miRNA hairpin and the sequence encoding the T-cell receptor or chimeric antigen receptor are controlled by a single promoter. In another embodiment, the miRNA hairpin is controlled by a first promoter, and the sequence encoding the chimeric antigen receptor is controlled by a second promoter. In yet another embodiment, the miRNA hairpin and the chimeric antigen receptor are controlled by the same promoter.
[0136] In this implementation, the miRNA expression construct further includes a T-cell receptor sequence.
[0137] In one embodiment, the miRNA expression construct further includes a selection gene. In another embodiment, the selection gene is LNGFR, a truncated endothelial growth factor receptor (tEGFR), tCD19, CD20, or a truncated CD20 (tCD20), tCD34, or a derivative thereof.
[0138] In an embodiment, the construct further comprises a sequence encoding a suicide gene or a safety switch gene. In an embodiment, the suicide gene or safety switch gene is selected from the group consisting of: herpes simplex virus thymidine kinase (HSV-tk), inducible caspase 9 (iCasp9), truncated endothelial growth factor receptor (tEGFR), RQR8, dihydrofolate reductase (DHFR), CD20 or truncated CD20 (tCD20), and thymidine synthase (TYMS).
[0139] In one embodiment, the miRNA expression construct further includes an internal ribosome entry site (IRES). In another embodiment, the construct further includes a peptide cleavage site. In another embodiment, the peptide cleavage site is a 2A peptide. In another embodiment, the 2A peptide is selected from the group consisting of: 2A, P2A, T2A, E2A, F2A, BmCPV 2A, and BmIFV 2A.
[0140] In this implementation, the miRNA expression construct is an isolated nucleic acid.
[0141] In this embodiment, the first nucleotide of the miRNA target sequence in one or more hairpins of the miRNA expression construct is a thymidine nucleotide.
[0142] In a preferred embodiment, the miRNA expression construct includes an EF1s promoter and a spacer containing an enhancer.
[0143] Specific miRNA expression construct
[0144] In one embodiment, the miRNA expression construct of the present invention comprises a single miRNA hairpin targeting B2M. In another embodiment, the miRNA expression construct of the present invention comprises two miRNA hairpins targeting B2M. In yet another embodiment, the miRNA expression construct of the present invention comprises three miRNA hairpins targeting B2M.
[0145] In one embodiment, the miRNA expression construct of the present invention comprises a single miRNA hairpin targeting TRAC. In another embodiment, the miRNA expression construct of the present invention comprises two miRNA hairpins targeting TRAC. In yet another embodiment, the miRNA expression construct of the present invention comprises three miRNA hairpins targeting TRAC.
[0146] In some embodiments, the TRAC-targeting miRNA expression construct of the present invention further comprises miRNA hairpins targeting one or more other TCR complex peptides. In some embodiments, the TRAC-targeting miRNA expression construct of the present invention further comprises one or more miRNA hairpins targeting TCRB, CD3d, CD3g, CD3e, and / or CD3z. In some embodiments, the TRAC-targeting miRNA expression construct of the present invention further comprises one or more miRNA hairpins targeting CD3z. In some embodiments, the TRAC-targeting miRNA expression construct of the present invention further comprises a single miRNA hairpin targeting CD3z.
[0147] In one embodiment, the miRNA expression construct of the present invention comprises a single miRNA hairpin targeting CD3z. In another embodiment, the miRNA expression construct of the present invention comprises two miRNA hairpins targeting CD3z. In yet another embodiment, the miRNA expression construct of the present invention comprises three miRNA hairpins targeting CD3z.
[0148] In one embodiment, the miRNA expression construct of the present invention comprises a first miRNA hairpin targeting a first CD3z transcript region and a second miRNA hairpin targeting a second, different CD3z transcript region. In another embodiment, the miRNA expression construct of the present invention comprises no more than two miRNA hairpins targeting CD3z, namely a first miRNA hairpin targeting a first CD3z transcript region and a second miRNA hairpin targeting a second, different CD3z transcript region. In another embodiment, compared to an equivalent miRNA expression construct that targets only the same CD3z transcript sequence (such as two miRNA hairpins), the miRNA expression construct targeting multiple different CD3z transcript regions can provide more silencing.
[0149] In one embodiment, the miRNA expression construct of the present invention comprises a single miRNA hairpin targeting CIITA. In another embodiment, the miRNA expression construct of the present invention comprises two miRNA hairpins targeting CIITA. In yet another embodiment, the miRNA expression construct of the present invention comprises three miRNA hairpins targeting CIITA.
[0150] In one embodiment, the miRNA expression construct of the present invention comprises a first miRNA hairpin targeting a first CD3z transcript sequence and a second miRNA hairpin targeting a second, different CD3z transcript sequence. In another embodiment, the miRNA expression construct further comprises a third miRNA hairpin targeting a B2M transcript sequence. In yet another embodiment, the miRNA expression construct further comprises a fourth miRNA hairpin targeting the same B2M transcript sequence. In yet another embodiment, the miRNA expression construct further comprises a sequence encoding a CAR. In yet another embodiment, the CAR is an anti-CD19 CAR. In yet another embodiment, the CAR is encoded by SEQ ID NO: 17, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In yet another embodiment, the CAR comprises the sequence of SEQ ID NO: 18, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In yet another embodiment, the CAR is expressed by a PGK promoter.
[0151] In one embodiment, the miRNA expression construct of the present invention comprises a first miRNA hairpin and a second miRNA hairpin. The first miRNA hairpin targets CD3z_T1 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. The second miRNA hairpin targets CD3z_T2 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In a first embodiment, the miRNA expression construct further comprises a third miRNA hairpin, which targets B2M_T2 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it, or the third miRNA hairpin targets B2M_T5 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In a second, different embodiment, the miRNA expression construct includes third and fourth miRNA hairpins, each targeting B2M_T5 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In an embodiment, the miRNA expression construct further includes a sequence encoding a CAR. In an embodiment, the CAR is an anti-CD19 CAR. In an embodiment, the CAR is encoded by SEQ ID NO: 17, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In an embodiment, the CAR includes a sequence having SEQ ID NO: 18, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with it. In an embodiment, the CAR is expressed by a PGK promoter.
[0152] DNA, plasmids, vectors, and related cells
[0153] In a third aspect, the present invention provides a DNA molecule comprising the miRNA expression construct described herein.
[0154] In a fourth aspect, the present invention provides plasmids comprising the miRNA expression constructs or DNA molecules described herein.
[0155] In a fifth aspect, the present invention provides a vector comprising the miRNA expression construct, DNA molecule or plasmid described in the present invention.
[0156] In some embodiments, the vector is an expression vector. In some embodiments, the expression vector is an adenovirus, adeno-associated virus, retrovirus, or lentiviral vector. In some embodiments, the expression vector of the present invention further comprises at least one drug resistance marker.
[0157] In an embodiment, the DNA, plasmid, or vector described in this invention is isolated.
[0158] In a sixth aspect, the present invention provides engineered donor cells comprising the miRNA expression construct, DNA molecule, plasmid, or vector described in the present invention.
[0159] Manufacturing method
[0160] In a seventh aspect, the present invention provides a method for downregulating peptides in cells, comprising expressing the miRNA expression construct, DNA molecule, plasmid, or vector described in the present invention in cells.
[0161] In an embodiment, the present invention provides a method for downregulating HLA-I, the method being achieved by providing a miRNA expression construct that inhibits B2M expression and expressing the miRNA expression construct in cells, wherein HLA-I expression levels are reduced by approximately 50% to approximately 90% (inclusive), wherein the reduction in HLA-I expression levels is predetermined by the following: a) Provide one, two, or three miRNA hairpins targeting B2M in the miRNA expression construct; b) Provide B2M hairpins targeting different or the same regions of the B2M transcript in the miRNA expression construct; and c) Provide transduction efficiency of the miRNA expression construct such that one, two, or three copies of the miRNA expression construct are produced in the cell.
[0162] In an eighth aspect, the present invention provides a method for preparing engineered donor cells, comprising transfecting or transducing cells with the miRNA expression construct, DNA molecule, plasmid or vector described in the present invention.
[0163] In a ninth aspect, the present invention provides a method for preparing engineered donor cells from a patient donor or a healthy donor, comprising: (a) Collecting cells from the patient; and (b) Transfecting or transducing the cells using the miRNA expression construct, DNA molecule, plasmid, or vector described in this invention; and (c) Express the miRNA expression construct.
[0164] In one embodiment, the engineered donor cell is a T cell. In another embodiment, the miRNA expression construct, DNA molecule, plasmid, or vector downregulates the TCR peptide and upregulates the CAR peptide, wherein the engineered donor cell is a CAR T cell.
[0165] In an embodiment, the chimeric antigen receptor targets HIV-infected cells or tumor cells, optionally wherein the chimeric antigen receptor is an anti-CD19 chimeric antigen receptor, optionally wherein the chimeric antigen receptor is FMC63.
[0166] In the implementation, the above method is an in vitro or ex vivo method.
[0167] In a tenth aspect, the present invention provides engineered effector cells that are obtainable or have been obtained by the method described herein.
[0168] Specific forms of engineered donor cells
[0169] This article outlines the specific forms of the engineered donor cells of this invention.
[0170] In one embodiment, the engineered donor cell is a eukaryotic cell. In another embodiment, the engineered donor cell is a mammalian cell.
[0171] In this embodiment, the engineered donor cells are immune effector cells. In this embodiment, the immune effector cells are selected from the group consisting of: αβ T cells, γδ T cells, tumor-infiltrating lymphocytes (TILs), TCR-engineered T cells, CAR T cells, NK cells, NK / T cells, regulatory T cells, monocytes, and macrophages. In this embodiment, the immune effector cells are CAR T cells. Specifically, in this embodiment, where the expression of one or more TCR peptides is downregulated while the expression of CAR is upregulated, the engineered donor cells are CAR-T cells.
[0172] In this embodiment, the engineered donor cell is a stem cell or progenitor cell.
[0173] In this embodiment, the engineered donor cell is a pluripotent stem cell, such as an embryonic stem cell or an induced pluripotent stem cell.
[0174] In this embodiment, the engineered donor cells are pluripotent stem cells, such as hematopoietic stem cells, mesenchymal stem cells, neural stem cells, or muscle stem cells (satellite cells).
[0175] In this embodiment, the stem cells are human embryonic stem cells. In this embodiment, the acquisition of the stem cells does not require the destruction of human embryonic stem cells. In this embodiment, the stem cells are not animal embryonic stem cells. In this embodiment, the acquisition of the stem cells does not require the destruction of animal embryonic stem cells.
[0176] In one embodiment, the engineered donor cells are differentiated cells. In another embodiment, the engineered donor cells are transplanted cells. In yet another embodiment, the engineered donor cells are used for transplantation or cell therapy applications. In yet another embodiment, the engineered donor cells are cells from transplanted tissue or organs that have been removed from a donor. In yet another embodiment, the engineered donor cells are cells from ex vivo tissue or organs. In yet another embodiment, the engineered donor cells are pancreatic cells, optionally islet cells or pancreatic β cells.
[0177] In one embodiment, the engineered donor cell is an in vitro cell. In another embodiment, the engineered donor cell is an isolated cell. In yet another embodiment, the engineered donor cell is a separated engineered donor cell. In yet another embodiment, the engineered donor cell does not exist in nature. In yet another embodiment, the engineered donor cell contains non-endogenous miRNA. In yet another embodiment, the engineered donor cell contains synthetic miRNA. In yet another embodiment, the engineered donor cell contains miRNA produced through recombinant technology.
[0178] Methods, uses and therapies
[0179] In an eleventh aspect, the present invention provides a composition comprising the engineered donor cells described herein.
[0180] In a twelfth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions thereof, for use in therapy.
[0181] In a thirteenth aspect, the present invention provides a method for applying the engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions described herein to the treatment of cancer, infectious diseases, autoimmune diseases or hereditary diseases.
[0182] In a fourteenth aspect, the present invention provides a method for treating cancer, infectious diseases, autoimmune diseases, or hereditary conditions, comprising administering engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors, or compositions as described in the present invention.
[0183] In a fifteenth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions described herein, which are used to manufacture medicaments for treating cancer, infectious diseases, autoimmune diseases or hereditary diseases.
[0184] In a sixteenth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions thereof, which are used in stem cell therapy.
[0185] In a seventeenth aspect, the present invention provides a stem cell therapy method comprising administering engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors, or compositions as described herein.
[0186] In an eighteenth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions described herein, which are used in the manufacture of drugs for stem cell therapy.
[0187] RNA inhibition
[0188] Repressive nucleic acids can inhibit gene transcription or prevent the translation of gene transcripts in cells. Repressive nucleic acids can be 16 to 1000 nucleotides long, and in some embodiments are 18 to 100 nucleotides long. In some embodiments, the repressive nucleic acid is an isolated nucleic acid that binds to or hybridizes with the gene of interest. Repressive nucleic acids are well known in the art. For example, siRNA, shRNA, and double-stranded RNA are described in U.S. Patents 6,506,559 and 6,573,099, and U.S. Patent Publications 2003 / 0051263, 2003 / 0055020, 2004 / 0265839, 2002 / 0168707, 2003 / 0159161, and 2004 / 0064842, all of which are incorporated herein by reference in their entirety.
[0189] Since Fire and colleagues discovered RNAi in 1998, its biochemical mechanisms have been rapidly characterized. Double-stranded RNA (dsRNA) is cleaved by Dicer (a ribonuclease of the RNase III family). This process produces miRNAs approximately 21 nucleotides in length. These miRNAs are integrated into a multiprotein RNA-induced silencing complex (RISC), which is directed to the target mRNA. The RISC cleaves the target mRNA in the middle of its complementary region. In mammalian cells, the relevant miRNAs are short RNA fragments (approximately 22 nucleotides). These miRNAs are produced by the Dicer-mediated cleavage of longer (approximately 70 nucleotides) precursor RNA with incomplete hairpin RNA structures. These miRNAs are integrated into a miRNA-protein complex (miRNP), leading to translational repression of the target mRNA.
[0190] When designing RNAi, several factors need to be considered, such as the nature of the siRNA, the persistence of the silencing effect, and the choice of delivery system. To produce an RNAi effect, the miRNA incorporated into the organism typically contains exon sequences. Furthermore, the RNAi process relies on homology; therefore, sequence selection is usually very careful to maximize gene specificity while minimizing cross-interference between homologous but non-gene-specific sequences. Specifically, the nucleotide identity between the miRNA sequence and the target gene is typically greater than 80%, 85%, 90%, 95%, 98%, or even 100%. Sequences with less than 80% identity to the target gene may have significantly reduced effectiveness. Therefore, the higher the identity of the miRNA to the target gene to be suppressed, the less likely irrelevant gene expression will be affected.
[0191] Furthermore, the size of the miRNA is also an important consideration. In some embodiments, the present invention relates to miRNA molecules comprising at least about 19-25 nucleotides and capable of regulating target gene expression. In the context of the present invention, the length of the miRNA is specifically less than 500, 200, 100, 50, 25, 24, 23, or 22 nucleotides. In some embodiments, the length of the miRNA is about 25 to about 35 nucleotides, or about 19 to about 25 nucleotides.
[0192] To improve the effectiveness of miRNA-mediated gene silencing, researchers have developed guidelines for mRNA target site selection to optimize miRNA design (Soutschek et al., 2004; Wadhwa et al., 2004). These strategies help to rationally select siRNA sequences to achieve maximum gene knockdown. To facilitate miRNA entry into cells and tissues, researchers have used various vectors, including plasmids and viral vectors such as adenoviruses, lentiviruses, and retroviruses (Wadhwa et al., 2004).
[0193] In repressive nucleic acids, the components of the nucleic acids need not be of the same type or completely homogeneous (e.g., repressive nucleic acids may contain nucleotides and nucleic acids or nucleotide analogs). Typically, repressive nucleic acids form a double-stranded structure; said double-stranded structure can be formed by two separate nucleic acids that are partially or completely complementary. In some embodiments of the invention, the repressive nucleic acid may contain only a mononucleotide (polynucleotide) or nucleic acid analog and form a double-stranded structure through self-complementarity (e.g., forming a hairpin loop). The double-stranded structure of the repressive nucleic acid may contain 16 to 500 or more consecutive nucleotides, including all ranges therein. The repressive nucleic acid may contain 17 to 35 consecutive nucleotides, more specifically 18 to 30 consecutive nucleotides, more specifically 19 to 25 nucleotides, more specifically 20 to 23 consecutive nucleotides, or 20 to 22 consecutive nucleotides, or 21 consecutive nucleotides, which hybridize with a complementary nucleic acid (which may be another part of the same nucleic acid or separate complementary nucleic acids) to form a double-stranded structure.
[0194] miRNAs can be obtained from commercial sources, natural sources, or synthesized using any of a variety of techniques known to those skilled in the art. For example, commercial sources of pre-designed miRNAs include Invitrogen's Stealth Select technology (Carlsbad, California), Ambion (Austin, Texas), and Qiagen (Valencia, California). The repressive nucleic acid applicable in the compositions and methods of this invention can be any nucleic acid sequence that has been proven by any source to be an effective downregulator of a target gene.
[0195] In an embodiment, the miRNA molecule has at least 75%, 80%, 85%, or 90% homology with at least six consecutive nucleotides of any nucleic acid sequence contained in the transcript, specifically at least 95%, 99%, or 100% similarity or identity, or any percentage between the above percentages (e.g., the present invention considers 75% and above, 80% and above, 85% and above, etc., and the range is intended to include all integers between the two), and the nucleic acid sequence may cover protein-coding sequence regions as well as non-coding or non-translated regions.
[0196] The miRNA may also contain alterations to one or more nucleotides. Such alterations may include the addition of non-nucleotide substances, such as at one or more ends or within the RNA of 19 to 25 nucleotides (at one or more nucleotides of the RNA). In some aspects, the RNA molecule contains a 3'-hydroxyl group. The nucleotides in the RNA molecule of the present invention may also contain non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. The double-stranded oligonucleotide may contain a modified backbone, such as a phosphate thioester, a dithiophosphate, or other modified backbones known in the art, or may contain non-natural internucleotide linkages. Other modifications to siRNA (e.g., 2'-O-methylribonucleotide, 2'-deoxy-2'-fluororibonucleotide, "universal base" nucleotide, 5-C-methyl nucleotide, internucleotide linkages of one or more phosphate thioesters, and incorporation of inverse deoxy base residues) are known in U.S. Publication No. 2004 / 0019001 and U.S. Patent No. 6,673,611 (the full text of which is incorporated herein by reference). All such modified nucleic acids or RNAs are collectively referred to as modified miRNAs.
[0197] In the most preferred embodiment, the miRNA hairpins included in the multiplex miRNA expression construct of the present invention are constructed according to the miRNA structure and design described in WO2019186274, which is incorporated herein by reference in its entirety. Those skilled in the art will understand how to apply miRNA design principles in the art and this reference to obtain optimal results using the multiplex miRNA expression construct of the present invention.
[0198] Vectors used for cloning, gene transfer, and expression
[0199] In some respects, expression vectors are used to express nucleic acids of interest, such as those that inhibit the expression of specific genes. Expression requires the provision of appropriate signals within the vector, including various regulatory elements, such as enhancers / promoters from viral and mammalian sources, which drive the expression of the gene of interest in the host cell. Elements designed to optimize RNA stability in the host cell are also defined. Conditions for establishing permanent, stable cell clones of the expression product using many major drug selection markers are also provided, as are elements that link the expression of drug selection markers to peptide expression.
[0200] Control element
[0201] In this application, the terms "expression construct" or "expression vector" are intended to include any type of gene construct containing nucleic acid encoding a gene product, wherein some or all of the nucleic acid coding sequence can be transcribed. The transcript may be translated into a protein, but not necessarily. In some embodiments, expression includes gene transcription and the translation of mRNA into a protein product. In other embodiments, expression includes only the transcription of the nucleic acid encoding the gene of interest, i.e., as in the case of the RNA molecule in the embodiments.
[0202] In some implementations, the nucleic acid encoding the gene product is under the transcriptional control of a promoter. A "promoter" is a DNA sequence recognized or introduced into the cellular synthetic mechanism for initiating specific transcription of the gene. The phrase "under transcriptional control" means that the promoter is in the correct position and orientation relative to the nucleic acid to control RNA polymerase initiation and gene expression.
[0203] The term "promoter" will be used here to refer to a group of transcriptional control modules clustered around the initiation site of eukaryotic RNA polymerases (Pol) I, II, or III. Much of the thinking about how promoters are organized comes from analysis of several viral Pol II promoters, including HSV thymidine kinase (…). tk The promoters of SV40 early transcription units and other related genes. These studies, along with recent work, show that promoters consist of discontinuous functional modules, each composed of approximately 7–20 bp of DNA, containing one or more recognition sites for transcription activators or inhibitory proteins. At least one module in each promoter is used to locate the initiation site of RNA synthesis. The most well-known example is the TATA box, but in some promoters lacking the TATA box, such as the promoters of mammalian terminal deoxynucleotidyl transferase genes and SV40 late-stage genes, discrete elements covering the initiation site itself help determine the initiation location.
[0204] Other promoter elements regulate the frequency of transcription initiation. These are typically located in a region 30–110 bp upstream of the start site, although it has recently been shown that many promoters also contain functional elements downstream of the start site. The spacing between promoter elements is usually flexible, allowing promoter function to be preserved when elements flip or move relative to each other. In the tk promoter, the spacing between promoter elements can increase to 50 bp before activity begins to decline. Depending on the promoter, individual elements appear to function synergistically or individually to activate transcription.
[0205] In some embodiments, the promoter includes the elongation factor 1 short (EF1) promoter. In other embodiments, high-level expression of the coding sequence of interest can be obtained using the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, the rat insulin promoter, and glyceraldehyde-3-phosphate dehydrogenase. Other viral, mammalian cell, or bacterial phage promoters known in the art can also be used to achieve expression of the coding sequence of interest, provided the expression level is sufficient to satisfy the given objective.
[0206] By using promoters with well-known properties, the expression levels and patterns of proteins of interest after transfection or transformation can be optimized. Furthermore, selecting promoters that are regulated in response to specific physiological signals can allow for the inducible expression of gene products. Tables 2 and 3 list several regulatory elements that can be used to regulate the expression of genes of interest in the context of this invention. This list is not intended to exhaustively enumerate all possible elements involved in promoting gene expression, but is merely illustrative. In some aspects, the promoters used according to this embodiment are non-tissue-specific promoters, such as constitutive promoters.
[0207] Enhancers are genetic elements that increase transcription from promoters located at a distal position on the same DNA molecule. Enhancers are structured much like promoters; that is, they contain many individual elements, each of which binds to one or more transcription proteins.
[0208] The fundamental difference between enhancers and promoters lies in their operational nature. An enhancer region as a whole must be able to stimulate transcription distally; this is not necessarily true for a promoter region or its constituent elements. Conversely, a promoter must have one or more elements that direct the initiation of RNA synthesis at a specific location and in a specific direction, while enhancers lack these characteristics. Promoters and enhancers are typically overlapping and continuous, often appearing to have very similar modular organization.
[0209] Below is a list of viral promoters, cellular promoters / enhancers, and inducible promoters / enhancers that can be used in combination with nucleic acids encoding genes or miRNAs of interest in expression constructs (Tables 2 and 3). Furthermore, any promoter / enhancer combination (according to the eukaryotic promoter database EPDB) can also be used to drive the expression of genes or miRNAs of interest. Truncated promoters can also be used to drive expression. Eukaryotic cells can support cytoplasmic transcription of certain bacterial promoters, either as part of a delivery complex or as an additional gene expression construct, provided appropriate bacterial polymerases are available.
[0210]
[0211] In the use of any cDNA insert, a polyadenylation signal is typically included to influence the appropriate polyadenylation of the gene transcript. The nature of the polyadenylation signal is not considered critical to the successful implementation of this invention, and any such sequence can be employed, such as the human growth hormone and SV40 polyadenylation signals. However, in some aspects, the polyadenylation signal sequence is not included in the vector of this embodiment. For example, incorporating such a signal sequence (before the 3' LTR) into a lentiviral vector can reduce the resulting lentiviral titer.
[0212] The nucleic acid construct may include a spacer sequence. The presence of a spacer appears to improve the knockdown efficiency of miRNAs (Stegmeier et al., 2005). The spacer can be any nucleotide sequence. In some aspects, the spacer is GFP.
[0213] Terminators can also be considered as elements of the expression box. These elements can improve the level of information and reduce the chance of reading other sequences from the box.
[0214] Selectable markers
[0215] In some embodiments of the invention, cells contain the nucleic acid construct of the invention, and the cells can be identified in vitro, ex vivo, or in vivo by including a marker in the expression construct. Such a marker introduces identifiable changes into the cells, making cells containing the expression construct easily identifiable. Typically, incorporating drug selection markers aids in the selection of clones and transformants; for example, genes conferring resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin, and histidinol are useful selection markers. Alternatively, enzymes such as herpes simplex virus thymidine kinase can be used. tk Alternatively, chloramphenicol acetyltransferase (CAT) or other alternative markers may be used. The alternative marker used is not considered critical, as long as it can be co-expressed with the nucleic acid encoding the gene product. Further examples of alternative markers are well known to those skilled in the art. In this embodiment, the alternative marker is RQR8, tEGFR, or TCD20.
[0216] Delivery of nucleic acid molecules and expression vectors
[0217] In some aspects, vectors for delivering the nucleic acids of this embodiment can be constructed to express these factors in cells. In specific aspects, the following systems and methods can be used to deliver nucleic acids to desired cell types.
[0218] Homologous recombination
[0219] In some aspects of this embodiment, the vector encoding the nucleic acid molecule of this embodiment can be introduced into cells in a specific manner, for example, through homologous recombination. Current methods for expressing genes in stem cells involve the use of viral vectors (e.g., lentiviral vectors and gamma retroviral vectors) or transgenes randomly integrated into the genome. Some of these methods, particularly the use of gamma retroviral vectors, have certain drawbacks, partly because the random integration of said vectors may activate or inhibit endogenous gene expression, and / or lead to transgene expression silencing. Problems associated with random integration can be partially overcome by homologous recombination with specific loci in the target genome.
[0220] Homologous recombination (HR), also known as general recombination, is a genetic recombination process used in all life forms in which nucleotide sequences are exchanged between two similar or identical DNA strands. Since the mid-1980s, this technique has been the standard method for genome engineering in mammalian cells. The process involves several steps of physical disruption and eventual DNA reconnection. It is most widely used in nature to repair lethal DNA double-strand breaks. Furthermore, homologous recombination produces new combinations of DNA sequences during meiosis, the process by which eukaryotes produce gametes such as sperm and eggs. These new DNA combinations represent genetic variation in offspring, enabling populations to evolve and adapt to changing environmental conditions over time. Homologous recombination is also used for horizontal gene transfer to exchange genetic material between different strains and species of bacteria and viruses. Homologous recombination is also used as a technique in molecular biology to introduce genetic changes into target organisms.
[0221] Homologous recombination can be used for targeted genome modification. The efficiency of standard HR in mammalian cells is only 10 times that of treated cells. -6 Up to 10 -9(Capecchi, 1990). The use of meganucleases, or homing endonucleases, such as I-SceI, has been used to improve HR efficiency. Both native meganucleases and engineered meganucleases with modification-target specificity have been used to improve HR efficiency (Pingoud and Silva, 2007; Chevalier et al., 2002). Another approach to improving HR efficiency is the engineering of chimeric endonucleases with programmable DNA-specific domains (Silva et al., 2011). Zinc finger nucleases (ZFNs) are an example of such chimeric molecules, in which the zinc finger DNA-binding domain is fused with the catalytic domain of an IIS-type restriction endonuclease (such as FokI) (as described in Durai et al., 2005; PCT / US2004 / 030606). Another class of such specific molecules includes transcription activator-like effector (TALE) DNA-binding domains fused to the catalytic domain of IIS-type restriction endonucleases such as FokI (Miller et al., 2011: PCT / IB2010 / 000154).
[0222] Nucleic acid delivery system
[0223] Those skilled in the art will be able to construct vectors using standard recombination techniques (e.g., see Sambrook et al., 2001 and Ausubel et al., 1996, both incorporated herein by reference). Vectors include, but are not limited to, plasmids, smears, viruses (bacteriophages, animal viruses, and plant viruses), and artificial chromosomes (such as YAC), such as retroviral vectors (e.g., vectors derived from Moloney mouse leukemia virus (MoMLV), MSCV, SFFV, MPSV, SNV, etc.), lentiviral vectors (e.g., derived from HIV-1, HIV-2, SIV, BIV, FIV, etc.), adenovirus (Ad) vectors, including their replication competent, replication defective, and virus-free forms, adeno-associated virus (AAV) vectors, simian virus 40 (SV-40) vectors, bovine papillomavirus vectors, Epstein-Barr virus vectors, herpesvirus vectors, vaccinia virus vectors, Harvey mouse sarcoma virus vectors, mouse mammary cancer virus vectors, and Rous sarcoma virus vectors.
[0224] Additional carrier
[0225] In certain aspects of the invention, the use of plasmid- or liposome-based extrachromosomal (i.e., appendage-type) vectors may also be provided, for example, for the reprogramming of somatic cells. Such appendage-type vectors may include, for example, oriP-based vectors and / or vectors encoding EBV protein EBNA-1 derivatives. These vectors allow the introduction of large DNA fragments into cells and their extrachromosomal retention, replication once per cell cycle, efficient distribution to daughter cells, and substantially no immune response.
[0226] Specifically, the only viral protein required for replication of oriP-based expression vectors, EBNA-1, does not trigger a cellular immune response because it has been developed with an efficient mechanism to bypass the processing required for presenting its antigen on MHC class I molecules (Levitskaya et al., 1997). Furthermore, EBNA-1 can transact to enhance clonal gene expression, inducing up to 100-fold expression in some cell lines (Langle-Rouault et al., 1998; Evans et al., 1997). Finally, the manufacturing cost of such oriP-based expression vectors is very low.
[0227] Other extrachromosomal vectors include other lymphotropic herpesvirus-based vectors. Lymphotropic herpesviruses are herpesviruses that replicate in lymphoblasts (e.g., human B lymphoblasts) and become plasmids in part of their natural life cycle. Herpes simplex virus (HSV) is not a “lymphotrophic” herpesvirus. Exemplary lymphotropic herpesviruses include, but are not limited to, EBV, Kaposi's sarcoma herpesvirus (KSHV); herpes virus saimiri (HS), and Marek's disease virus (MDV). Other episome-based vectors from other sources, such as yeast ARS, adenovirus, SV40, or BPV, are also considered.
[0228] Those skilled in the art will be able to construct vectors using standard recombination techniques (e.g., see Maniatis). et al., 1988 and Ausubel et al., 1994, both of which are included in this paper by reference.
[0229] The vector may also contain other components or functions that further regulate gene delivery and / or gene expression, or otherwise provide beneficial properties to target cells. Such other components include, for example, components that affect binding to or targeting cells (including components that mediate cell type or tissue-specific binding); components that affect cellular uptake of the vector nucleic acid; components that affect intracellular localization of polynucleotides after uptake (such as reagents that mediate nuclear localization); and components that affect polynucleotide expression.
[0230] Such components may also include biomarkers, such as detectable and / or selective biomarkers, which can be used to detect or select cells that have taken up and expressed nucleic acids delivered by the vector. These components may be provided as a natural feature of the vector (such as using certain viral vectors with components or functions that mediate binding and uptake), or the vector may be modified to provide such functions. A large number of such vectors are known in the art and are generally available. When maintained in a host cell, the vector can be stably replicated by the cell as an autonomous structure during mitosis, incorporated into the host cell's genome, or maintained in the host cell's nucleus or cytoplasm.
[0231] Transposon-based systems
[0232] Depending on the specific implementation method, nucleic acid can be introduced using a transposon-transposase system. The transposon-transposase system used can be the well-known Sleeping Beauty or Frog Prince transposon-transposase system (for a description of the latter, see, for example, EP1507865) or a TTAA-specific transposon delivery system.
[0233] Transposons are DNA sequences that can move to different locations within the genome of a single cell; this process is called transposition. During this process, they can cause mutations and alter the amount of DNA in the genome. Transposons, also known as jumping genes, are examples of mobile genetic elements.
[0234] There are various types of mobile genetic elements, which can be grouped based on their transposition mechanisms. Class I mobile genetic elements, or retrotransposons, are first transcribed into RNA, then reverse transcribed back into DNA by reverse transcriptase, and then inserted into another location in the genome to replicate themselves. Class II mobile genetic elements use transposases to move directly from one location to another, essentially "cutting and pasting" within the genome.
[0235] Viral vector
[0236] In generating recombinant viral vectors, non-essential genes are typically replaced by genes or coding sequences of heterologous (or non-native) proteins or nucleic acids. A viral vector is an expression construct that utilizes a viral sequence to introduce nucleic acids, and possibly proteins, into a cell. The ability of certain viruses to infect or enter cells via pH-dependent or pH-independent mechanisms, integrate their genetic payload into the host cell genome, and stably and efficiently express viral genes makes them attractive candidates for the transfer of exogenous nucleic acids into cells (e.g., mammalian cells). Non-limiting examples of viral vectors that can be used to deliver nucleic acids for certain aspects of the present invention are described below.
[0237] Because retroviruses can integrate their genes into the host genome, transfer large amounts of foreign genetic material, infect a wide range of species and cell types, and be packaged in specific cell lines, they hold promise as gene delivery vectors (Miller, 1992). To construct retroviral vectors, nucleic acids are inserted into specific viral sequences within the viral genome to produce replication-defective viruses. To produce viral particles, packaging cell lines containing the gag, pol, and env genes but lacking the LTR and packaging components were constructed (Mann et al., 1983). When a recombinant plasmid containing cDNA is introduced into a specific cell line along with the retroviral LTR and packaging sequence (e.g., by calcium phosphate precipitation), the packaging sequence allows the RNA transcript of the recombinant plasmid (i.e., the vector genome) to be packaged into viral particles, which are then secreted into the culture medium (Nicolas and Rubenstein, 1988; Temin, 1986; Mann et al., 1983). The culture medium containing the recombinant retrovirus is then collected, optionally concentrated, and used for gene transfer. Based on the tropism of the envelope proteins used to coat the surface of the vector particles, retroviral vectors can infect a variety of cell types. However, integration and stable expression require host cell division (Paskind et al., 1975).
[0238] Lentivirals are complex retroviruses, containing not only common retrovirus genes but also... gag, pol and env In addition, it contains other genes with regulatory or structural functions. Lentiviral vectors are well known in the art (see, for example, Naldini et al., 1996; Zufferey et al., 1997; Blomer et al., 1997; Giry-Laterriere et al., 2011; U.S. Patents 6,013,516 and 5,994,136).
[0239] Recombinant lentiviral vectors can infect non-dividing cells and can be used for in vivo and in vitro gene transfer and nucleic acid sequence expression. For example, recombinant lentiviruses capable of infecting non-dividing cells, wherein suitable host cells are transfected with two or more vectors carrying packaging functions, named gag, pol, and env, and rev and tat, are described in U.S. Patent 5,994,136, which is incorporated herein by reference.
[0240] Nucleic acid delivery
[0241] Introducing nucleic acids (e.g., DNA or RNA) into cells to be programmed with the present invention can be performed using any suitable method as described herein or known to those skilled in the art for the purpose of nucleic acid delivery to transform the cells. Such methods include, but are not limited to, direct delivery of DNA, such as by in vitro transfection (Wilson et al., 1989; Nabel et al., 1989), by injection (US Patent Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466, and 5,580,859, all incorporated herein by reference), including microinjection (Harland and Weintraub, 1985; US ...859, all incorporated herein by reference), including microinjection (Harland and Weintraub, 1985; US Patent Nos. 5,994,1995). Patent No. 5,789,215 (incorporated herein by reference); by electroporation (US Patent No. 5,384,253 (incorporated herein by reference; Tur-Kaspa et al., 1986; Potter et al., 1984); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); using DEAE dextran followed by polyethylene glycol (Gopal, 1985); by direct acoustic loading (Fechheimer et al., 1987); transfection via liposome-mediated methods (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991) and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988); transfection via particle bombardment (PCT applications WO94 / 09699 and 95 / 06128; US patents 5,610,042; 5,322,783, 5,563,055, 5,550,318, 5,538,877, and 5,538,880, each incorporated herein by reference; by stirring with silicon carbide fibers (Kaeppler et al., 1990; U.S. Patents 5,302,523 and 5,464,765, both incorporated herein by reference); by Agrobacterium-mediated transformation (U.S. Patents 5,591,616 and 5,563,055, both incorporated herein by reference); by drying / inhibition-mediated DNA uptake (Potrykus et al., 1985), and any combination of these methods. By applying techniques such as these, organelles, cells, tissues, or organisms can be stably or transiently transformed.
[0242] Liposome-mediated transfection
[0243] In one embodiment of the invention, nucleic acids may be encapsulated in lipid complexes, such as liposomes. Liposomes are vesicle structures characterized by a phospholipid bilayer and an internal aqueous medium. Multilayer liposomes have multiple lipid layers separated by an aqueous medium. They spontaneously form when phospholipids are suspended in excess aqueous solution. The lipid components undergo self-rearrangement before forming a closed structure and trap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Nucleic acids complexed with Lipofectamine (Gibco BRL) or Superfect (Qiagen) are also considered. The amount of liposomes used may vary depending on the nature of the liposomes and the cells used; for example, approximately 5 to approximately 20 per 1,000 to 10,000,000 cells may be considered. g-vector DNA. Liposome-mediated nucleic acid delivery and in vitro expression of exogenous DNA have been very successful (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987). The feasibility of liposome-mediated delivery and expression of exogenous DNA in cultured chicken embryos, HeLa cells, and hepatocellular carcinoma cells has also been demonstrated (Wong et al., 1980).
[0244] In some embodiments of the invention, liposomes may be complexed with hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote the entry of liposome-encapsulated DNA into the cell (Kaneda et al., 1989). In other embodiments, liposomes may be complexed with or combined with nuclear non-histone chromosomal protein (HMG-1) (Kato et al., 1991). In still other embodiments, liposomes may be complexed with or combined with both HVJ and HMG-1. In other embodiments, the delivery carrier may comprise a ligand and liposomes.
[0245] Electroporation
[0246] In some embodiments of the invention, nucleic acids are introduced into organelles, cells, tissues, or organisms via electroporation. Electroporation involves exposing a suspension of cells and DNA to a high-voltage discharge. Recipient cells can be made more susceptible to transformation through mechanical trauma. The amount of carrier used can vary depending on the nature of the cells used; for example, approximately 5 to 20 μg of carrier DNA per 1,000 to 10,000,000 cells may be considered.
[0247] Electroporation has been quite successful in transfecting eukaryotic cells. Mouse pre-B lymphocytes have been transfected with the human κ immunoglobulin gene (Potter et al., 1984), and rat hepatocytes have been transfected with the chloramphenicol acetyltransferase gene in this manner (Tur Kaspa et al., 1986).
[0248] Calcium phosphate
[0249] In other embodiments of the invention, calcium phosphate precipitation is used to introduce nucleic acids into cells. Human KB cells have been transfected with adenovirus 5 DNA using this technique (Graham and Van Der Eb, 1973). Similarly, mouse L(A9), mouse C127, CHO, CV1, BHK, NIH3T3, and HeLa cells have been transfected with neomycin marker genes (Chen and Okayama, 1987), and rat hepatocytes have been transfected with multiple marker genes (Rippe et al., 1990).
[0250] DEAE beta-glucan
[0251] In another implementation, the nucleic acid was delivered into the cells using DEAE dextran followed by polyethylene glycol. In this manner, the reporter plasmid was introduced into mouse myeloma and erythroleukemia cells (Gopal, 1985).
[0252] Cell culture
[0253] Typically, the cells of this invention are cultured in a culture medium, which is a nutrient-rich buffer solution that can maintain cell growth.
[0254] Culture media suitable for isolating, expanding, and differentiating stem cells according to the methods described herein include, but are not limited to, high-glucose Darwinian modified Ibsen medium (DMEM), DMEM / F-12, L-15 medium (Liebovitz L-15), RPMI 1640, Iscove modified Duchenne broth (IMDM), and Opti-MEM SFM (Invitrogen). Chemically defined media containing minimum essential media, such as Iscove modified Duchenne broth (IMDM) (Gibco), supplemented with human serum albumin, human ExCyte lipoprotein, transferrin, insulin, vitamins, essential and non-essential amino acids, and sodium pyruvate, glutamine, and mitogens are also suitable. As used herein, a mitogen refers to a reagent that stimulates cell division. The reagent can be a chemical substance, typically some form of protein, that induces cell division, thereby triggering mitosis. In one embodiment, serum-free culture media, such as those described in U.S. Serial Nos. 08 / 464,599 and WO96 / 39487, and the “complete culture medium” described in U.S. Patent No. 5,486,359, are considered for use in the methods described herein. In some embodiments, the culture medium is supplemented with 10% fetal bovine serum (FBS), autologous human serum, human AB serum, or platelet-rich plasma supplemented with heparin (2 U / mL). Cell cultures may be maintained in a CO2 atmosphere, for example, 5% to 12%, to maintain the pH of the culture medium, incubated in a humid atmosphere at 37°C, and passaged to maintain confluence below 85%.
[0255] As used herein, "an" or "a kind" may refer to one or more kinds. As used herein, when used in conjunction with the word "comprising," the word "an" or "a kind" may refer to one or more kinds. As used herein, in the description and claims, "another" or "another" may refer to at least a second kind or more kinds.
[0256] As used in this specification and claims, the term "about" is used to indicate a value that includes the inherent difference in error of the means or method used to determine the value, or a difference present in the subject of study.
[0257] As used herein, with respect to a specific component, "substantially free" means that the particular component was not intentionally formulated into the composition and / or is present only as a contaminant or in trace amounts. The total amount of a particular component due to any unintended contamination of the composition is preferably less than 0.01%. Most preferably, the composition is one in which the amount of the specified component cannot be detected using standard analytical methods.
[0258] Other objects, features, and advantages of the invention will be apparent from the embodiments. However, it should be understood that although the detailed description and specific embodiments illustrate certain implementations of the invention, they are not intended to limit the invention, but are merely illustrative, and the scope of the invention is defined by the appended claims.
[0259] Example
[0260] Example 1 Method
[0261] In summary, the inventors' method for developing optimal gene silencing constructs includes: (i) target sequence design; (ii) molecular cloning to construct single-hairpin miRNA constructs and produce lentiviral vectors; and (iii) gene modification of target cells and evaluation of gene / protein silencing using appropriate readout methods. Multi-hairpin miRNA constructs can then be constructed using one or more optimal target sequences, and their maximum gene silencing efficiency can be evaluated in a similar manner.
[0262] Target sequence design
[0263] A software program was used to design target sequences for integration into miRNA structures. This software can rationally prioritize the optimal gene silencing target sequences based on known parameters. Sequence prioritization is based on: identifying conserved regions in the target transcript; individually scoring each target sequence; and reducing the potential risk of off-target gene silencing (based on sequence identity between the target sequence and the target cell transcriptome). The notation "target name_T#" (e.g., TRAC_T1, B2M_T5) is used to refer to the target sequences in the gene and the associated miRNAs that target those sequences.
[0264] Molecular cloning
[0265] The preferred target sequence was synthesized within the mirGE backbone by a third-party manufacturer. Single mirGE sequences were cloned using LRClonase II. The mirGE pENTR plasmid, the elongation factor 1 short promoter plasmid (pENTR-L4-EFs-L1R), and the lentiviral vector target cassette containing the mCherry reporter gene (pCWX-R4dESTR2-PC) were cloned into single plasmids. Successful cloning of all constructs was confirmed by restriction endonuclease digestion mapping and DNA sequencing.
[0266] Lentiviral vectors and titration
[0267] Lentiviral vectors were prepared by transfecting HEK293T cells with a transfer plasmid carrying a gene silencing construct, along with a lentiviral packaging plasmid (PAX2) and an envelope plasmid (VSVg). Cell culture medium was added 4–6 hours later, followed by viral particle collection at 24 hours. The collected medium was filtered to remove cell debris, and viral particles were enriched using PEG-It viral precipitation buffer (System Biosciences) according to the manufacturer's instructions. Final aliquots of the concentrated lentiviral vectors were stored at -80°C. Functional viral vector titers were assessed by transducing primary T cells at a series of dilutions and measuring the percentage of cells expressing the mCherry reporter gene.
[0268] Cells and cell lines
[0269] The silencing of HLA-I, HLA-II, and TCR cell surface expressions was evaluated in Jurkat cells and primary T cells, wherein the primary T cells were prepared from anonymized erythrocyte sedimentation rate (ESR) brown-yellow layer blood units procured from the Transfusion Center of Geneva University Hospital. Peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll density gradient centrifugation, followed by T cell separation using Miltenyi CD4 / CD8 microbeads, aliquoting, and cryopreservation in liquid nitrogen. Several miRNA constructs were also tested using HEK293T cells.
[0270] Lentiviral vector transduction
[0271] After thawing, cryopreserved T cells were cultured overnight in T cell culture medium (Advanced RPMI, 10% FBS) and activated the following day with CD3 / CD28 magnetic beads at a 1:1 ratio. Forty-eight hours later, the activated T cells were transduced using a lentiviral vector carrying a miRNA gene silencing construct. Transduction was performed at a high density (2 million cells / mL), with culture medium replenished after 18–24 hours, and T cells maintained at a density of 1 million cells / mL every other day thereafter. For testing in HEK293T cells, multiplicity of infection (MOI) values of 0.2 and 2.0 were used to obtain cells with varying degrees of HLA class I silencing. Following transduction, HEK293T cells were cultured in suitable medium for at least 5 days, and then the silencing of HLA-ABC cell surface expression was assessed. For assessment in Jurkat cells, target cells were transduced and cultured in suitable medium for at least five days before the silencing of target gene expression was assessed.
[0272] Flow cytometry and gene silencing assessment
[0273] Flow cytometry was performed 5–7 days after T cell transduction. Cells were collected, washed, resuspended in PBS, and stained with a suitable antibody for 20–30 minutes to assess cell surface expression. After staining, cells were washed with PBS, resuspended in FACS buffer (Ca / Mg2+-free PBS, 2 mM EDTA, 0.5% BSA), and cell surface expression was assessed by flow cytometry. Data were exported to FlowJo for analysis. To calculate gene silencing levels, changes in the percentage of target-positive cells and median fluorescence intensity (MFI) were assessed. Normalization included in-sample expression levels (modified cells vs. unmodified cells), followed by calculation of expression levels relative to control transduced cells.
[0274] Mixed lymphocyte reaction
[0275] Primary T cells were transduced using miRNA constructs, and their functional silencing was detected in a mixed lymphocyte response (MLR) with mismatched PBMCs (stimulatory cells). Unmodified T cells were expected to be allogeneic responsive to stimulatory cells, while TCR-silenced T cells were not expected to be activated when co-cultured with mismatched T cells. Stimulatory cells were irradiated and labeled with PKH26 before co-culture. Reactive cells (TCR-silenced cells) were generated and quiescent after 12 days of cell culture and IL-2 removal. These cells were then co-cultured at a 1:1 ratio, and T cell activation was assessed by detecting CD137 expression in CD8+ T cells using flow cytometry. A positive control group activated with CD3 / CD28 microbeads (1:1) was also set up. The reactive cells were then returned to a quiescent state and restimulated in a similar manner.
[0276] Example 2: Fine Regulation of HLA-I Downregulation and B2M Expression of miRNA
[0277] The major histocompatibility complex (MHC), or human leukocyte antigen (HLA) class I receptors—namely HLA-A, HLA-B, and HLA-C—is expressed on the surface of all nucleated cells in the body. They work in conjunction with HLA class II molecules, playing a central role in the presentation of peptide antigens to the immune system, which are recognized by T cell receptors (TCRs) on T cells. Peptides presented via HLA class I and II receptors are recognized by CD8+ and CD4+ T cells, respectively. β2-microglobulin (B2M) is a common protein subunit of all HLA class I molecules.
[0278] In the context of allogeneic chimeric antigen receptor (CAR) T-cell therapy, in addition to silencing or knocking out T-cell receptors (TCRs) to prevent allogeneic reactions of CAR T cells, it is also crucial to prevent these donor-derived CAR T cells from being rejected by the recipient's immune system. Upregulation of HLA class I molecules in activated CAR T cells may lead to CD8+ T cell-mediated rejection. However, cells that do not express HLA class I molecules may lead to NK cell-mediated rejection.
[0279] The inventors have proposed a strategy to downregulate B2M (and consequently all HLA class I molecules) using miRNA. This strategy aims to improve the persistence of allogeneic CAR-T cells by avoiding CD8+ T cell-mediated cytotoxicity. However, the inventors have also unexpectedly discovered that their miRNA-based approach can also be used to "fine-tune" B2M expression, thereby maintaining beneficially low levels of HLA class I molecules. Therefore, this miRNA-based approach can also improve the persistence of allogeneic CAR-T cells by avoiding NK cell-mediated cytotoxicity. Furthermore, the miRNA constructs used to silence HLA class I molecules can also be used to construct universal donor cells from various sources, including induced pluripotent stem cells (iPSCs).
[0280] Traditional gene editing methods result in complete HLA-I deletion, making donor cells susceptible to clearance by NK cells. To prevent this, non-classical HLA-I molecules (HLA-E or HLA-G) can be co-expressed to improve persistence. However, the miRNA-based approach of this invention enables finely regulated silencing of HLA (e.g., 70-90%), thereby providing allogeneic miCAR T cells with sufficient or even longer persistence without the need for co-expression of HLA-E / G.
[0281] Gene silencing in target cells
[0282] The target sequences were screened using a method previously described by Myburgh et al. (2014–PMID: 25350582). The target sequences were for human B2M (ENSEMBL: ENSG00000166710). This yielded miRNAs named B2M_T5, B2M_T2, and B2M_T3.
[0283] The sequence was analyzed based on the downregulation of HLA-ABC expression in genetically modified primary T cells. Frozen T cells were thawed and activated using Thermo Fisher Scientific Dynabeads (3:1 bead-to-cell ratio), then resuspended in T cell culture medium. After 24 hours, activated T cells were transduced using a lentiviral vector carrying a miRNA gene silencing construct. Transduction was performed at a high density (2 million cells / mL), with culture medium replenished after 16–24 hours, and T cells maintained at a density of 1 million cells / mL every other day thereafter. Flow cytometry was performed 5 days after T cell transduction. Results are as follows: Figure 1 As shown (a series of silent constructs downregulate HLA-ABC expression), Figure 2 As shown (different HLA class I expression was obtained).
[0284] To further evaluate the efficiency of B2M gene silencing, we transduced primary T cells using lentiviral vectors carrying various hairpin miRNA constructs. The data are shown below. Figure 3 As shown. In these experiments, T cells from two donors were transduced. HLA class I gene silencing resulted in a 50-75% reduction in HLA class I expression in the gene-modified cells. The transduction rates for all cells were 30-40%, therefore the data reflect HLA class I gene silencing induced by 1-2 vector copy numbers. Given the high efficiency of HLA class I gene silencing, we proceeded with the development of subsequent constructs. Figure 4 The gating strategies for these evaluations are shown, using B2M_T5 as an example.
[0285] Multiple hairpin gene silencing targeting cells in gene modification
[0286] After identifying B2M_T5 as a highly effective target sequence for silencing HLA class I molecules, we integrated it into multiple hairpin miRNA constructs (1hp, 2hp, and 3hp) to assess whether it could further enhance the silencing of HLA class I molecules. Figure 5 As shown, the target silencing effect is improved when using a 2hp construct, but the improvement is minimal after using more than two hairpins.
[0287] To conduct functional studies on the persistence of CAR T cells, the ability of HEK293 cells to express different levels of HLA class I molecules was explored using different B2M gene silencing constructs. These constructs included single-hairpin and double-hairpin miRNA constructs targeting B2M_T2 or T5 sequences, transduced via 0.2 Mol and 1.0 Mol lentiviral vectors, respectively. Figure 6As shown, HEK293 cells may have been genetically engineered to express HLA class I molecules at levels ranging from 50% to 95%. This indicates that this miRNA gene silencing technology can uniquely regulate the expression levels of target genes.
[0288] in conclusion
[0289] This study demonstrates that B2M-targeting miRNA constructs can efficiently silence HLA class I molecules. Using a single-hairpin construct and low copy number transduction, silencing of 50-75% of HLA class I molecules can be achieved. For silencing of HLA class I molecules exceeding 90%, a 2hp conformation can be used to target multiple transcript sequences, and / or transduction efficiency can be increased (60-70%) to increase miRNA copy number. This technology provides a unique solution for finely tuning the silencing level of HLA class I molecules to the desired range of 50% to 90%.
[0290] Example 3: TCR downregulation and TRAC / CD3z silencing via miRNA
[0291] The inventors have developed a highly efficient miRNA gene construct capable of effectively silencing genes. Using this method, the inventors constructed TCR-deficient T cells and demonstrated their functional loss of allogeneic reactivity in both in vitro and in vivo models.
[0292] TRAC is the constant region of the T cell receptor (TCR) α chain (TCRa) (PubMed: 24600447). The αβ T cell receptor is an antigen-specific receptor crucial for the immune response and is located on the surface of T lymphocytes. Together with CD3, the TCR-CD3 complex constitutes the deterministic receptor for T cells. The TCR complex is formed by the non-covalent binding of eight subunits: one TCRRa, one TCRβ, one CD3γ, one CD3d, two CD3ε, and two CD3ζ. When antigen-presenting cells (APCs) activate the T cell receptor (TCR), TCR-mediated signals are transmitted across the cell membrane via the CD3 complex. This is a prerequisite for effective T cell adaptive immunity against pathogens (PubMed: 25493333).
[0293] Differentiation cluster 3ζ (CD3ζ), also known as CD247, is a component of the CD3 complex. All CD3 chains contain immunoreceptor tyrosine activation motifs (ITAMs) in their cytoplasmic domains. Upon TCR binding, these motifs are phosphorylated by Src family protein tyrosine kinases LCK and FYN, thereby activating downstream signal transduction pathways (PubMed: 2470098, PubMed: 7509083). CD3ζ ITAM phosphorylation can form multiple docking sites with protein kinase ZAP70, leading to ZAP70 phosphorylation and conversion into a catalytically active enzyme (PubMed: 7509083). CD3ζ also plays an important role in thymic T cell differentiation.
[0294] In the context of allogeneic CAR-T cell therapy, limiting the allogeneic reactivity of donor-derived CAR-T cells is crucial for reducing the risk of GvHD. Allogeneic reactivity is mediated by the T-cell receptor (TCR), therefore researchers have explored methods for preparing allogeneic CAR-T cells by gene silencing the TCR. Based on this, the inventors propose a study using miRNA constructs targeting selected TCR subunits (including TRAC and CD3z).
[0295] TRAC silencing via miRNA
[0296] Target sequences for human TRAC (ENSEMBL: ENSG00000277734) were screened, with priority given to sequences starting with thymine (T) residues. This yielded miRNAs targeting the TRAC target sequences, named TRAC_T1, TRAC_T4, and TRAC_T5, respectively. To assess the efficiency of TRAC gene silencing, lentiviral vectors carrying single-hairpin miRNA constructs were transduced into PBMCs, and the expression of TCRα / β and CD3ε was subsequently analyzed by flow cytometry.
[0297] like Figure 7 As shown, the TRAC_T1, TRAC_T4, and TRAC_T5 target sequences all resulted in TCR expression silencing greater than 50% (based on MFI readings normalized to mCherry controls). Furthermore, the percentage of cells expressing TCR decreased by more than 70%. Notably, the gene silencing trend among different TRAC-targeted constructs was consistent in both donor 1 and donor 2 samples, with donor 2 showing slightly higher efficiency. Transduction rates in all samples ranged from 55% to 65%, reflecting that most gene-modified T cells contained 2 to 3 vector copies. The gating strategy used to assess TCR silencing is as follows: Figure 8 As shown.
[0298] In summary, TRAC gene silencing was achieved using miRNA constructs. All three target sequences tested silenced TCR expression by more than 50% and resulted in a 70% reduction in TCR-expressing cells. Considering the potential risk of graft-versus-host disease in allogeneic T-cell therapy, achieving a TCR silencing rate exceeding 90% would be even more advantageous. This can be achieved by constructing multiple miRNA hairpins targeting TRAC and / or other subunits of the TCR-CD3 complex. Furthermore, a miRNA construct targeting CD3z was developed, and its TCR silencing data will be reported below.
[0299] CD3z silencing via miRNA
[0300] CAR-T cells typically contain a chimeric antigen receptor, which is engineered to include a CD3z activation domain. Therefore, the inventors identified CD3z target sequences outside of this domain to prevent miRNA constructs from silencing CAR expression. The target sequences are based on the gene encoding human CD247 (ENSEMBL: ENSG00000198821). Three miRNAs targeting CD3z were obtained in this manner and named CD3z_T1, CD3z_T2, and CD3z_T3, respectively.
[0301] To assess the efficiency of CD3z gene silencing, a lentiviral vector carrying a single hairpin miRNA construct was transduced into PBMCs, and the expression of TCRα / β and CD3ε was subsequently analyzed by flow cytometry. Figure 9 The experimental data presented are from PBMCs obtained from two healthy donors.
[0302] CD3z_T1, CD3z_T2, and CD3z_T3 all efficiently silenced TCR expression. Among them, the CD3z_T2 sequence showed the highest silencing efficiency, with a TCR expression silencing rate greater than 95%, and a similar decrease in the percentage of TCR-expressing cells was observed. The gene silencing trend was consistent in the samples from donor 1 and donor 2. Gating strategies used to evaluate TCR silencing include... Figure 10 As shown.
[0303] Given that the CD3z miRNA achieved highly efficient TCR silencing, further construct development will proceed. The next step is to transfect Jurkat cells to validate the efficiency of TCR silencing. Figure 11 As shown, Jurkat cells modified with the CD3z_T2 construct at an MOI of 0.3 completely eliminated the expression of TCR a / b.
[0304] After identifying effective targets for TCR expression silencing, the next step was to integrate CD3z miRNA into multi-hairpin miRNA constructs (1hp, 2hp, and 3hp) to evaluate whether further enhancement of TCR silencing was possible. Figure 12 As shown, enhanced TCR silencing was observed when using the 2hp construct targeting the same CD3z_T2 sequence.
[0305] In addition to the multiple "hairpin dose" tests on 1-3 hp CD3z_T2 in the above experiments, two double hairpin constructs targeting different transcript regions were constructed. The first construct used a combination of miRNAs targeting CD3z_T2 and CD3z_T1. A second construct targeting CD3z_T2 and TRAC_T1 was also constructed. To evaluate the efficiency of these novel constructs, primary T cells were transduced, and the expression of TCRα / β and CD3ε was assessed. Figure 13 In addition, 1-3hp constructs targeting CD3z_T2 were also examined. Based on Figure 13 Histograms and median fluorescence intensity (MFI) clearly show that the double hairpin construct targeting two different CD3z sequences (CD3z_T2 / T1) is the most efficient at silencing the expression of the TCR-CD3 complex on the cell surface. Even compared to the 3hp CD3z_T2 construct, the expression of TCR a / b and CD3e was significantly reduced. This indicates that the miRNA construct containing two miRNA hairpins targeting different sequences on CD3z provides a higher level of gene silencing than the construct containing two miRNA hairpins targeting only a single (identical) CD3z sequence. Notably, at a higher transduction rate of 46.5% (marked with an asterisk), more than 95% of transduced cells showed completely negative TCR expression. Furthermore, the CD3z_T2 / TRAC_T1 construct outperformed the 3hp CD3z_T2 construct at a cell transduction rate of 40.1%. These data demonstrate that a range of miRNA constructs can successfully silence TCRs, including CD3z_T2 / T1, which can completely silence TCR expression. Following TCR-based removal, any cells expressing residual TCRs were removed.
[0306] Next, we used two miRNA constructs to perform a mixed lymphocyte reaction to assess whether they would lead to loss of allogeneic reactivity when co-cultured with mismatched T cells. First, PBMCs were transduced with a miRNA targeting CD3z_T2. Second, a miRNA targeting TRAC_T1 was used to achieve moderate TCR gene silencing. Using lentiviral vector transduction, we generated T cells with TCR silencing rates of 95% and 30%, respectively, using the above constructs. Figure 14AAfter quiescent (12 days post-activation) these TCR-deficient T cells, we co-cultured them with irradiated, stimulated T cells at a 1:1 ratio. After 24 hours of co-culture, cells were collected and the expression of the CD137 activation marker in genetically modified CD8+ T cells (mCherry positive) was assessed. In T cells transduced with a construct targeting the TRAC_T1 target sequence, CD137 expression was reduced by 60%. This reduction was particularly significant for T cells with a TCR silencing rate of 30%. Furthermore, in CD8+ T cells with a TCR silencing rate of 95% (using miRNA targeting CD3z_T2), CD137 expression was negligible. Figure 14B This confirms that TCR-deficient T cells, including those silenced with the CD3z_T2 construct, are not allogeneic responsive to gene-mismatched stimuli.
[0307] In summary, the target sequence for CD3z was confirmed to effectively silence TCRs. Some differences were observed when using two and three hairpin constructs containing the same sequence. Furthermore, CD8+ T cells modified with a single hairpin miRNA construct showed negligible allogeneic reactivity in mixed lymphocyte responses.
[0308] Results, conclusions and in vivo studies
[0309] Novel gene silencing constructs targeting TRAC and CD3z were developed and identified as high-efficiency constructs based on TCR silencing efficiency, which were then selected for in-depth characterization. These constructs were delivered to primary T cells via lentiviral vector transduction and subsequently expanded in G-Rex cell culture plates. The gene-modified T cells were purified by removing TCR-expressing cells, and the loss of allogeneic reactivity was assessed in a mixed lymphocyte reaction (MLR). In summary, we demonstrated the successful construction of functional TCR silencing and non-allogeneic T cells.
[0310] Example 4: HLA-II downregulation silenced by CIITA
[0311] Class II transcription activator factors (CIITAs) are transcription factors essential for the transcriptional activity of the human leukocyte antigen (HLA) class II promoter. CIITAs function in a co-activator-like manner through protein-protein interactions, linking factors binding to the proximal HLA class II promoter to the transcriptional mechanism. They can also activate HLA class II transcription by modifying promoter-bound proteins. The promoter elements required for CIITA-mediated transcription differ from those required for constitutive HLA class I transcription.
[0312] CIITA is expressed in activated human T cells and regulates the expression of HLA class II molecules, thereby controlling the response to foreign antigens and maintaining immune tolerance. Inflammatory stimulation can upregulate CIITA expression. In vitro experiments have shown that T-cell malignancies exhibit a CIITA-dependent HLA class II molecule defect phenotype, thereby inhibiting cell death (PMID: 11207239).
[0313] In engineered allogeneic cell therapy and engineered T-cell therapy, specifically allogeneic chimeric antigen receptor (CAR) T-cell therapy, the expression of HLA class II molecules is upregulated in activated CAR T cells, making them susceptible to rejection by the host's CD4+ T cells. Gene silencing of HLA class II molecules is a possible solution to limit this rejection response. Furthermore, constructs that silence HLA-I can also be used to build universal donor cell therapies from multiple sources, including induced pluripotent stem cells (iPSCs).
[0314] Gene silencing in target cells
[0315] Target sequences have been identified and prioritized for selection. Target sequences were identified according to human CIITA (ENSEMBL: ENSG00000179583). If necessary, for identified target sequences, the first nucleotide of the guide strand can be altered, for example, by replacing cytosine (C) with thymine (T), to facilitate guide strand integration into the RISC (RNA-induced silencing complex).
[0316] We designed CIITA using target sequences and conducted screening experiments in primary T cells, the results of which are shown in Figure 15. In the second screening, all three constructs (pATN498, pATN501, and pATN504) significantly downregulated HLA class II molecules. Specifically, pATN504 achieved a stable HLA class II silencing rate of 65-75% in all three donor T cell products.
[0317] in conclusion
[0318] We screened and successfully identified a novel miRNA gene construct capable of silencing CIITA. This enabled highly efficient silencing of HLA class II cell surface expression. Among three different T cell donor products, the target sequence CIITA_T19 (located in construct pATN504) exhibited the most efficient and stable performance.
[0319] Example 5: A dual-mode construct for simultaneously downregulating HLA-I and TCR
[0320] The inventors have developed a novel dual-mode gene construct for simultaneous CAR expression and microRNA-mediated gene silencing (miCAR). This construct not only achieves efficient multiplex gene silencing but also enables finely regulated silencing of target genes. Using this method, the inventors constructed allogeneic CAR T cells capable of simultaneously expressing CAR and functionally silencing TCR and HLA-I. More specifically, this method can completely silence TCR expression while optimizing HLA-I silencing levels, thereby achieving a balance between CD8+ T cell and NK cell-mediated immune rejection.
[0321] While eliminating HLA-I expression on transplanted CAR-T cells may help prevent rejection by host CD8+ T cells, conversely, it may make these cells more susceptible to rejection by NK cells. A solution to this problem is to co-express additional NK cell inhibitory molecules, typically non-classical HLA-I molecules such as HLA-E, HLA-G, or HLA-F. Studies have also shown that co-expression of CD47 can prevent NK cell-mediated rejection. An alternative solution is to silence HLA-I expression to a level that not only protects transplanted cells from host CD8+ T cell attack but also provides sufficient protection against host NK cells without requiring co-expression of other receptors to avoid NK cell-mediated rejection.
[0322] method
[0323] First, gene constructs were constructed to silence HLA-I to varying degrees. Then, each construct was cloned into a previously optimized miCAR construct that expressed anti-CD19 CAR (CAR19) and miRNAs that efficiently silence TCR expression (the first miRNA hairpin targets CD3z_T1, and the second miRNA hairpin targets CD3z_T2). Figure 16 A schematic diagram of some of the components is shown.
[0324] Primary T cells were modified via lentiviral vector transduction, expanded in G-Rex cell culture plates, and purified by removing TCR-expressing cells. In vitro characterization included FACS immunophenotyping, cytotoxicity assays of CD19-expressing cells, and a low immunogenicity assay using mismatched T and NK cells in a mixed lymphocyte reaction (MLR). Figure 17 illustrates this process and its results.
[0325] For the use of allogeneic low-immunogenic miCAR19 T cells (e.g. Figure 20FThe mixed lymphocyte reaction of mismatched CD8+ T cells and NK cells (as shown) was first pre-sensitized to host PBMCs with mitomycin C-treated donor cells (CAR19 T cells), followed by isolation of CD8-positive T cells and labeling with CellTrace Violet (CTV) dye. The pre-sensitized CD8+ T cells (effector cells, E) were then co-cultured with transplanted miCAR19 T cells (target cells, T) at a 1:1 E:T ratio. After 6 days of co-culture, the cells were analyzed by flow cytometry. Similarly, for NK cells, the MLR (… Figure 20G Host NK cells (effector cells, E) and transplanted miCAR19 T cells (target cells, T) were co-cultured at an E:T ratio of 5:1. After 48 hours, the cells were analyzed by flow cytometry to assess the ratio of NK cells to T cells based on CD56 and CD5 expression, respectively.
[0326] result
[0327] Multiple engineered allogeneic miCAR19 T cells were successfully constructed, with complete TCR silencing in all cells and finely regulated HLA-I silencing maintained between 70-90% (Figure 17). In recurrent cytotoxicity assays against tumor cells, CAR function was maintained. Furthermore, in MLR assays, the constructed novel miCAR19 T cells resisted CD8+ T cell and NK cell-mediated cytotoxicity. In vitro experiments showed that the degree of rejection of CD19 CAR T cells by pre-sensitized CD8 T cells or NK cells was correlated with HLA-ABC expression levels (Figures 18, 19, and 20). Therefore, we have demonstrated an efficient method for multiple engineering of allogeneic low-immunogenicity CAR T cells and achieving functional silencing of TCR and HLA-I.
[0328] Furthermore, we validated a complementary approach: efficiently knocking down HLA-I to avoid CD8+ T cell killing, combined with non-classical HLA-B2M fusion protein expression to avoid NK cell killing (constructs shown in Figure 22). Using a B2M-targeting miRNA construct, approximately 60-90% silencing of HLA-ABC (classical HLA-I) was achieved while maintaining HLA-E expression (Figure 22).
[0329] Example 6: Further characterization of cells with both HLA-I and TCR downregulation
[0330] Allogeneic CAR T cells that simultaneously express CAR and functionally silence TCR and HLA-I were further characterized to observe their response to CD3 stimulation and IL-3 or IL-15 cytokines.
[0331] method
[0332] The same gene constructs as in Example 5 were used to silence HLA-I to varying degrees, and then each construct was cloned into a previously optimized miCAR construct that expressed anti-CD19 CAR (CAR19) and miRNAs that efficiently silence TCR expression (the first miRNA hairpin targets CD3z_T1, and the second miRNA hairpin targets CD3z_T2).
[0333] CD3 stimulation assay: Engineered T cells were stimulated with anti-CD3 antibody (OKT3) at concentrations ranging from 0 to 17.5 μg / mL, and the expression levels of CD137 / CD69 activation markers were assessed 24 hours later.
[0334] Cytokine exogenous assay: Engineered CAR T cells were cultured for 13 days with or without IL-7 and IL-15. Cells were counted every 3-4 days, and dead cells were excluded using trypan blue.
[0335] result
[0336] CD3 stimulation assay: Results showed that untransduced T cells and control CAR T cells (278) were activated at a concentration of 0.54 μg / mL of OKT3, with comparable activation rates. Figure 21A and 21B As shown in the figure. Notably, within the same concentration range, the expression of activation markers in the TCR-silenced CAR T cell population remained unchanged, confirming the loss of TCR function after receptor silencing.
[0337] Cytokine exogenous assay: In the presence of cytokines, cell survival was observed in all cell populations; however, in the absence of cytokines, no exogenous cell growth was observed. Figure 21C As shown.
[0338] Example 7: Preclinical-scale production of TCR-silencing T cells
[0339] method
[0340] According to the manufacturer's instructions, primary T cells were activated using TransAct (Miltenyi Biotec) and transduced two days later using a lentiviral vector carrying a miRNA gene construct for silencing CD3z expression. After transduction, T cells were seeded in G-Rex cell culture plates and expanded for 7 days in TexMACS medium containing IL-7 and IL-15. Cells were then collected and analyzed by flow cytometry.
[0341] like Figure 25A As shown. Three constructs were used in this experiment: (i) a single hairpin (1hp) miRNA targeting CD3z (T2), (ii) a double hairpin (2hp) miRNA (T1_T2) targeting two different regions of the CD3z transcript, and (iii) a non-targeting miRNA (with a disordered guide strand sequence).
[0342] result
[0343] like Figure 25B As shown, each construct was derived from cells from n=3 donors, and over 65% of the cells were transduced (assessed by mCherry positivity). After removing the remaining TCR-positive cells following transduction with the TCR-silencing construct, the remaining cells constituted a pure TCR-mCherry+ cell population.
[0344] like Figure 25C As shown, during the 9-day production process, T cells expanded by an average of 40-50 times, with no statistically significant difference in expansion folds between batches (Kruskal-Wallis ANOVA, p=0.975). D. Notably, although the number of cells harvested was the same under all conditions, the yield of TCR-silenced T cells constructed from the dual miRNA CD3z_T1_T2 almost doubled compared to TCR-silenced cells from a single miRNA gene construct targeting CD3z_T2 (unpaired T-test, p=0.0136). Therefore, this invention comprises miRNA constructs with two downregulating TCR miRNA hairpins, and cells containing these constructs can provide a higher yield of TCR-silenced cells.
[0345] Example 8 Generation of Universal Donor Cells
[0346] Induced pluripotent stem cells (iPSCs) can be used to generate universal donor cells (UDCs). Therefore, as shown in Table 4, we used UDC constructs to silence and overexpress the corresponding target genes in iPSCs. Subsequently, we further validated the results using T cells transduced with UDC constructs to express HLA-II molecules.
[0347]
[0348] method
[0349] iPSC transduction using UDC constructs: iPSCs were seeded in mTeSR complete medium containing CloneR2 (StemCell Technologies). On the same day, after cell adhesion, lentivirus was added directly to the medium for transduction (MOI5). Fresh medium was added after 24 hours. FACS analysis was performed 6 days after transduction to assess overexpression and silencing of the target protein of interest.
[0350] T cell transduction using UDC constructs: Frozen T cells were thawed and activated using CD3 / CD28 Dynabead at a 3:1 ratio. After 24 hours, activated T cells were transduced using a lentiviral vector carrying a miRNA gene silencing construct. Transduction was performed at a high density (2 million cells / mL), with culture medium replenished after 18–24 hours, and T cells maintained at a density of 1 million cells / mL every other day thereafter.
[0351] result
[0352] All iPSCs used showed greater than 90% OCT4 expression, with OCT4 being associated with an undifferentiated phenotype, confirming that the cells used possessed a stem cell phenotype. Figure 26A iPSCs can be transduced by the UDC construct, leading to overexpression of CD47, PD-L1, HLA-E, and CD34. Figure 26B Furthermore, iPSCs can also be transduced by the UDC construct, thereby simultaneously silencing HLA-ABC and CD47, and leading to overexpression of PD-L1, HLA-E, and CD34. Figure 26C Since HLA-E overexpression may not be a necessary condition for generating universal donor cells, it has also been shown that iPSCs can be transduced by UDC constructs to achieve overexpression of CD47, PD-L1, and CD34, as well as silencing of HLA-ABC. Figure 26D ).
[0353] Since iPSCs do not express HLA-II molecules, T cells (a more differentiated cell type expressing HLA-II) were also transduced using the UDC construct. This demonstrated that the construct resulted in HLA-I and HLA-II silencing, while simultaneously leading to overexpression of CD47, PD-L1, and CD34. Figure 27 ).
[0354] Therefore, in a preferred embodiment of the universal donor cells of the present invention, β2M and CIITA expression are downregulated, preferably by miRNA, and more preferably by β2M_T5 CIITA_T19 or the miRNA sequences mentioned herein. In other preferred embodiments, CD47, PDL1, and RQR8 expression is upregulated or overexpressed. In other preferred embodiments, β2M-HLAE expression is upregulated or overexpressed.
[0355] Example 9: In vivo study of TCR silencing cells in immunodeficient mice
[0356] In in vivo studies, immunodeficient mice were irradiated before infusion of 20 million TCR-silencing cells, and the occurrence of GvHD was assessed over 100 days. Researchers identified several novel miRNAs that induced TCR silencing rates greater than 50% and multiplied them in various combinations to screen for optimal constructs. Clearance of TCR-expressing cells resulted in a genetically modified TCR-negative T cell population with a purity exceeding 99%, confirmed by co-expression of the mCherry reporter gene. In MLR assays, negligible activation of TCR-silencing cells was observed. When control-transduced T cells were infused into immunodeficient mice, significant weight loss and GvHD occurred, with less than 50% of mice surviving by day 58. However, mice receiving TCR-silencing T cells remained healthy, and all mice survived to day 100 (data not shown). In conclusion, we demonstrate functional TCR silencing and the successful construction of non-allogeneic reactive T cells.
[0357] method
[0358] To assess whether TCR-silenced T cells maintain allograft reactivity in vivo and thus avoid graft-versus-host disease (GvHD), researchers infused TCR-silenced T cells into NOD SCID γ (NSG) mice. Figure 28A The overall research design, including preliminary experiments and main experiments, is described. Figure 28B The main experimental design was described, in which NSG mice were irradiated with a dose of 1 Gy, infused with 20 million T cells 24 hours later, and followed up for 100 days.
[0359] result
[0360] like Figure 28CAs shown, blood was collected on day 15 for flow cytometry analysis to confirm the implantation of modified cells (based on mCherry reporter gene expression). Results showed that more than 5% of circulating cells were genetically modified, confirming T cell implantation. Furthermore, mice receiving T cells modified with CD3z-targeting miRNAs exhibited persistent TCR / CD3 silencing. Figure 28D As shown, the survival curves indicate that mice receiving TCR-silenced T cells survived completely within 100 days (regardless of whether these cells were genetically modified with 1hp or 2hp miRNA targeting CD3z). Notably, all mice receiving control transduced or expanded T cells died on day 58 due to GvHD onset. Figure 28E As shown, the relative body weight percentage of these mice began to decline from about day 14, while mice that received only the carrier or TCR-silenced T cells continued to gain weight during the 100-day study period.
[0361] Example 10: In vivo study of the persistence of "fine-tuned" HLA-I and TCR / CD3 silencing cells in immunodeficient mice.
[0362] Before infusing host T cells and Raji-luc cells into immunodeficient mice, the mice were irradiated. Subsequently, finely regulated HLA-I and TCR / CD3-silenced cells were infused, with three levels of silencing (no HLA-I silence, 80% silence, and 90% silence). Mice were examined for 32 days to determine the presence of detectable finely regulated HLA-I silencing. Following infusion, finely regulated HLA-I silencing was clearly detectable by flow cytometry, and the different silencing levels were clearly distinguishable. This detectable HLA-I silencing persisted throughout the 32-day experimental period and in blood and other tissue samples. In conclusion, this study confirms the persistent finely regulated silencing of TCR / CD3 and HLA-I.
[0363] method
[0364] To assess whether finely regulated HLA-I silencing could persist in vivo, researchers infused finely regulated HLA-I and TCR / CD3-silenced T cells into NOD SCID γ (NSG) mice. Figure 29A The study design was demonstrated: NSG mice were irradiated with a dose of 1 Gy, and 24 hours later were infused with host T cells and Raji-luc cells. Three days later, miCAR19 T cells (allogeneic transplantation) were infused. Blood samples were collected on days 4, 11, 18, 25 and 32, and tissue samples were collected on day 32.
[0365] result
[0366] As shown in Figure 29, blood samples were collected on day 4 (one day after CAR-T cell infusion) for flow cytometry analysis to confirm HLA-I expression. The results showed that the "fine-tuned" silencing of HLA-I was clearly detectable at various levels. This expression persisted until the end of blood sample collection on day 32. Furthermore, the HLA-I expression level in the blood on day 32 was consistent with the expression levels in the spleen and bone marrow tissue samples collected at the end of the experiment. Figure 29B Representative histograms based on samples from day 4 and day 32 are provided to demonstrate the sustained expression of HLA-I.
Claims
1. An engineered donor cell to which the host immune system rejects the cell to a reduced degree, wherein one or more polypeptides expressed on the cell surface involved in immune signal transduction are functionally regulated.
2. The engineered donor cell of claim 1, wherein one or more cell surface peptides involved in immune signal transduction are functionally downregulated.
3. The engineered donor cell according to claim 2, wherein one or more of the downregulated surface-expressed polypeptides are selected from the group consisting of HLA class I polypeptides and HLA class II polypeptides.
4. The engineered donor cells according to claim 3, wherein the downregulation of HLA class I peptides is achieved by miRNA inhibition of the expression of one or more of B2M, NLRC5, TAP1, TAP2, TAPBP, RFX5, RFXANK and / or RFXAP.
5. The engineered donor cells according to claim 3 or 4, wherein the downregulation of HLA class II peptides is achieved by miRNA inhibiting the expression of one or more of CIITA, RFX5, RFXANK and / or RFXAP.
6. The engineered donor cell according to any one of claims 2 to 5, wherein one or more of the downregulated surface-expressed polypeptides are T-cell receptor (TCR) polypeptides.
7. The engineered donor cell of claim 6, wherein the downregulation of the TCR peptide is achieved by miRNA inhibiting the expression of TCRa, TCRb, CD3d, CD3g, CD3e and / or CD3z.
8. The engineered donor cell according to any one of claims 2 to 7, wherein one or more of the downregulated surface-expressed peptides are CD58 peptides, optionally wherein the downregulation is achieved by a miRNA targeting CD58 expression.
9. The engineered donor cell according to any one of claims 1 to 8, wherein one or more cell surface peptides involved in immune signal transduction are upregulated.
10. The engineered donor cell of claim 9, wherein the upregulation is achieved by expressing a transcript.
11. The engineered donor cell according to claim 9 or 10, wherein the upregulated surface-expressed polypeptide involved in immune signal transduction is selected from the group consisting of non-classical HLA class I polypeptides, CD47, PD-L1, and chimeric antigen receptors (CARs).
12. The engineered donor cell according to any one of claims 9 to 11, wherein non-classical HLA class I molecules expressed on the surface are upregulated, while HLA class I molecules expressed on the surface are downregulated.
13. The engineered donor cell according to claim 11 or 12, wherein the non-classical HLA class I polypeptide is a genetically modified HLA-E, HLA-G, or HLA-F polypeptide.
14. The engineered donor cell according to any one of claims 9 to 13, wherein the surface-expressed chimeric antigen receptor (CAR) is upregulated and the surface-expressed T cell receptor (TCR) is downregulated.
15. The engineered donor cell according to any one of claims 1 to 14, further expressing a safety switch gene or a suicide gene.
16. A miRNA expression construct comprising one or more miRNA hairpins targeting B2M, NLRC5, RFX5, RFXANK, RFXAP, CIITA, TCRRa, TCRb, CD3d, CD3g, CD3e and / or CD3z; optionally, said construct further comprises an expressed transcript.
17. The miRNA expression construct of claim 16, comprising at least a first miRNA hairpin and a second miRNA hairpin, wherein the first miRNA hairpin and the second miRNA hairpin target a combination of two sequences, the two sequences being independently selected from any one of SEQ ID NO: 1 to 16 having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the sequence.
18. The miRNA expression construct according to claim 16 or 17, wherein the expressed transcript comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 17, 19, or 21, and / or wherein the expressed transcript encodes a protein having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 18, 20, or 22.
19. The miRNA expression construct according to any one of claims 17 to 18, wherein there are two copies of a first miRNA hairpin and / or two copies of a second miRNA hairpin.
20. The miRNA expression construct according to any one of claims 17 to 19, wherein there are three copies of a first miRNA hairpin and / or three copies of a second miRNA hairpin.
21. The miRNA expression construct according to any one of claims 16 to 20, wherein the construct comprises at least two different miRNA hairpins targeting different regions of the same transcript.
22. The miRNA expression construct according to any one of claims 16 to 21, wherein the construct comprises at least two different miRNA hairpins targeting different transcripts of the same gene.
23. The miRNA expression construct according to any one of claims 16 to 22, wherein the construct comprises at least two different miRNA hairpins targeting different splice variants of the same gene.
24. The miRNA expression construct according to any one of claims 16 to 23, further comprising a promoter element.
25. The miRNA expression construct of claim 24, wherein the promoter element is a promoter.
26. The miRNA expression construct according to claim 25, wherein the promoter is a eukaryotic promoter.
27. The miRNA expression construct of claim 26, wherein the eukaryotic promoter is a Pol II or Pol III promoter.
28. The miRNA expression construct according to claim 25, wherein the promoter is an inducible promoter, a tissue-specific promoter, a cell lineage-specific promoter, or a synthetic promoter.
29. The miRNA expression construct according to claim 24, wherein the promoter element is selected from the promoter elements in Table 2.
30. The miRNA expression construct according to claim 25, wherein the promoter is the UBI promoter.
31. The miRNA expression construct according to claim 25, wherein the promoter is an EF1α promoter, a derivative of an EF1α promoter, or a short EF1 promoter.
32. The miRNA expression construct according to any one of claims 16 to 24, further comprising a spacer, optionally wherein the spacer comprises an enhancer, and optionally the spacer is an enhancer.
33. The miRNA expression construct according to claim 32, wherein the spacer is at least 50 nucleotides in length.
34. The miRNA expression construct of claim 32, wherein the spacer is 50 to 1,000 nucleotides in length.
35. The miRNA expression construct of claim 32, wherein the length of the spacer is 50 to 900, 50 to 800, 100 to 800, or 50 to 800 nucleotides.
36. The miRNA expression construct of claim 32, wherein the spacer is at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180 or 200 nucleotides in length.
37. The miRNA expression construct according to claim 32, wherein the spacer is a GFP sequence.
38. The miRNA expression construct according to any one of claims 32 to 37, wherein the spacer is located between the promoter and the miRNA hairpin.
39. The miRNA expression construct according to any one of claims 32 to 38, wherein the spacer is heterologous relative to the promoter element.
40. The miRNA expression construct according to any one of claims 32 to 39, wherein the spacer comprises an encoded open reading frame.
41. The miRNA expression construct according to any one of claims 16 to 40, wherein at least two of the miRNA hairpins are separated by intercalation sequences.
42. The miRNA expression construct according to any one of claims 16 to 41, wherein the expressed transcript is at least one gene selected from the group consisting of non-classical HLA class I, CD47, PD-L1 and chimeric antigen receptors.
43. The miRNA expression construct according to claim 42, wherein the expressed transcript has at least 80%, 85%, 90%, 95% or 100% sequence identity with the sequences shown in Table 1.
44. The miRNA expression construct according to any one of claims 16 to 43, wherein the construct comprises a sequence encoding a functional portion of an immune effector cell for redirection.
45. The miRNA expression construct according to any one of claims 16 to 44, wherein the construct comprises a sequence encoding an engineered T-cell receptor.
46. The miRNA expression construct according to any one of claims 16 to 45, wherein the construct comprises a sequence encoding a chimeric antigen receptor.
47. The miRNA expression construct according to claim 45 or 46, wherein the miRNA hairpin is controlled by a first promoter and the sequence encoding the T cell receptor or chimeric antigen receptor is controlled by a second promoter; or, wherein the miRNA hairpin and the sequence encoding the T cell receptor or chimeric antigen receptor are controlled by a single promoter.
48. The miRNA expression construct according to any one of claims 16 to 47, wherein the construct further comprises a T cell receptor sequence.
49. The miRNA expression construct according to any one of claims 16 to 48, wherein the construct further comprises a selection gene.
50. The miRNA expression construct according to claim 49, wherein the selected gene is LNGFR, truncated endothelial growth factor receptor (tEGFR), tCD19, CD20 or truncated CD20 (tCD20), tCD34 or a derivative thereof.
51. The miRNA expression construct according to any one of claims 16 to 50, wherein the construct further comprises a sequence encoding a suicide gene or a safety switch gene.
52. The miRNA expression construct according to claim 51, wherein the suicide gene or safety switch gene is selected from the group consisting of: herpes simplex virus thymidine kinase (HSV-tk), inducible caspase 9 (iCasp9), truncated endothelial growth factor receptor (tEGFR), RQR8, dihydrofolate reductase (DHFR), CD20 or truncated CD20 (tCD20), and thymidine synthase (TYMS).
53. The miRNA expression construct according to any one of claims 16 to 52, wherein the construct further comprises an internal ribosome entry site (IRES).
54. A DNA molecule comprising a miRNA expression construct as described in any one of claims 16 to 53.
55. A plasmid comprising a miRNA expression construct or a DNA molecule as described in any one of claims 16 to 54.
56. A vector comprising a miRNA expression construct, a DNA molecule, or a plasmid as described in any one of claims 16 to 55.
57. The carrier according to claim 56, wherein the carrier is an expression carrier.
58. The expression vector according to claim 57, wherein the expression vector is an adenovirus, adeno-associated virus, retrovirus, or lentiviral vector.
59. The expression vector according to claim 57 or claim 58, further comprising at least one drug resistance marker.
60. An engineered donor cell comprising a miRNA expression construct, DNA molecule, plasmid, or vector as claimed in any one of claims 16 to 59.
61. A method for downregulating a polypeptide in a cell, comprising expressing in the cell a miRNA expression construct, DNA molecule, plasmid, or vector as described in any one of claims 16 to 59.
62. A method for preparing engineered donor cells, comprising transfecting or transducing cells with a miRNA expression construct, DNA molecule, plasmid, or vector as described in any one of claims 16 to 59.
63. A method for preparing engineered donor cells from a patient donor or a healthy donor, comprising: (a) Collecting cells from the patient; as well as (b) Transfecting or transducing the cells using the miRNA expression construct, DNA molecule, plasmid, or vector as described in any one of claims 16 to 59; and (c) Express the miRNA expression construct.
64. The method according to claim 62 or 63, wherein the engineered donor cell is a T cell.
65. The method according to any one of claims 62 to 64, wherein the miRNA expression construct, DNA molecule, plasmid or vector downregulates the TCR peptide and upregulates the CAR peptide, wherein the engineered donor cell is a CAR T cell.
66. The method of claim 65, wherein the chimeric antigen receptor targets HIV-infected cells or tumor cells, optionally wherein the chimeric antigen receptor is an anti-CD19 chimeric antigen receptor, optionally wherein the chimeric antigen receptor is FMC63.
67. An engineered donor cell that can be obtained or has been obtained by the method of any one of claims 62 to 66.
68. The engineered donor cell according to any one of claims 1 to 15, 60 or 67, wherein the engineered donor cell is a eukaryotic cell, optionally wherein the engineered donor cell is a mammalian cell.
69. The engineered donor cell according to any one of claims 1 to 15, 60, 67 or 68, wherein the engineered donor cell is an immune effector cell.
70. The engineered donor cell of claim 69, wherein the immune effector cell is selected from the group consisting of αβ T cells, γδ T cells, tumor-infiltrating lymphocytes (TILs), TCR-engineered T cells, CAR T cells, NK cells, NK / T cells, regulatory T cells, monocytes, and macrophages.
71. The engineered donor cell of claim 70, wherein the immune effector cell is a CAR T cell.
72. The engineered donor cell according to any one of claims 1 to 15, 60, 67 or 68, wherein the engineered donor cell is a stem cell or progenitor cell.
73. The engineered donor cell of claim 72, wherein the engineered donor cell is a pluripotent stem cell, such as an embryonic stem cell and / or an induced pluripotent stem cell.
74. The engineered donor cell of claim 72, wherein the engineered donor cell is a pluripotent stem cell, such as a hematopoietic stem cell, mesenchymal stem cell, neural stem cell, or muscle stem cell (satellite cell).
75. The engineered donor cell according to any one of claims 1 to 15, 60, 67 or 68, wherein the engineered donor cell is a differentiated cell.
76. The engineered donor cell of claim 75, wherein the engineered donor cell is a pancreatic cell, optionally an islet cell or a pancreatic β cell.
77. A composition comprising the engineered donor cells as described in any one of claims 1 to 15, 60, or 67 to 76.
78. The engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition according to any one of claims 1 to 60 or 67 to 77, for use in therapy.
79. The engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition according to any one of claims 1 to 60 or 67 to 77, used in a method for treating cancer, infectious diseases, autoimmune diseases, or hereditary diseases.
80. A method of treating cancer, infectious diseases, autoimmune diseases, or hereditary conditions, comprising administering an engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition as described in any one of claims 1 to 60 or 67 to 77.
81. The engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition according to any one of claims 1 to 60 or 67 to 77, used in the manufacture of a medicament for the treatment of cancer, infectious diseases, autoimmune diseases, or hereditary conditions.
82. The engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition according to any one of claims 1 to 60 or 67 to 77, applied to stem cell therapy.
83. A stem cell therapy comprising administering an engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition as described in any one of claims 1 to 60 or 67 to 77.
84. The engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition according to any one of claims 1 to 60 or 67 to 77, used to manufacture a medicament for stem cell therapy.
Citation Information
Patent Citations
The frog prince, a transposon vector for gene transfer in vertebrates
EP1507865A2
Synthetic genes and genetic constructs comprising same i
US20020168707A1
Genetic inhibition by double-stranded RNA
US20030051263A1
Genetic inhibition by double-stranded RNA
US20030055020A1
Synthetic genes and genetic constructs comprising same I
US20030159161A1