Bacillus tequilensis and application thereof

Abstract

The invention discloses bacillus tequilensis and application thereof, and belongs to the technical field of biology. The preservation number of the bacillus tequilensis is CCTCC (China Center For Type Culture Collection) NO: M 20251909, and the bacillus tequilensis has a remarkable inhibition effect on rice sheath blight disease pathogenic bacteria (Rhizoctonia solani). An in-vitro confrontation culture and potting verification method is adopted to prove that the strain can inhibit the growth of germs, and a plate confrontation experiment shows that the hypha growth inhibition rate of the strain to YM-Q-7 reaches 70.36%. The bacterial suspension (1 * 10 < 8 > CFU / ml) of the strain is used for performing root irrigation treatment on potted rice, the prevention and treatment effect reaches 28.85%, and a good application prospect is provided for prevention and treatment of rice sheath blight disease.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biotechnology, in particular to a Bacillus turicatus strain and application thereof. BACKGROUND

[0002] Rice sheath blight, caused by Rhizoctonia solani, is an important disease in global rice production areas, which can cause 10-30% yield reduction, and even more than 50% in severe cases. Current prevention and control relies on chemical fungicides, but long-term use leads to enhanced pathogen resistance and excessive pesticide residues in soil and rice, threatening ecological and food safety.

[0003] Bacillus turicatus, as a widely used biocontrol agent, has significant potential for preventing and controlling rice sheath blight. It can inhibit pathogen mycelial growth by competing for nutrients and space, secreting lipopeptide antibacterial substances (such as iturin), parasitizing pathogen, and inducing systemic resistance in rice, while also having growth-promoting effects. However, existing strains have problems such as unstable field control effect and insufficient stress resistance, and there is an urgent need to screen new Bacillus turicatus strains with better control effect on rice sheath blight and stronger environmental adaptability. SUMMARY

[0004] To solve the above technical problems, the present application provides a Bacillus turicatus strain and application thereof. The Bacillus turicatus strain can be used for preventing and controlling rice sheath blight.

[0005] To achieve the above-mentioned purpose, the present application provides a Bacillus turicatus strain in the first aspect ( Bacillus tequilensis ), with the accession number CCTCC NO: M 20251909.

[0006] The present application provides a microbial agent in the second aspect, wherein the active ingredient of the microbial agent comprises the Bacillus turicatus strain of the first aspect.

[0007] The present application provides the application of the Bacillus turicatus strain of the first aspect or the microbial agent of the second aspect in the third aspect, in the prevention and control of rice sheath blight.

[0008] The present application provides a method for preventing and controlling rice sheath blight in the fourth aspect, comprising the following steps: applying the Bacillus turicatus strain of the first aspect in a concentration of 1x10 8 CFU / ml of suspension to rice during the tillering stage.

[0009] In summary, the present application has the following beneficial effects: the Bacillus turicatus strain provided by the present application can be used for preventing and controlling rice sheath blight. BRIEF DESCRIPTION OF DRAWINGS

[0010] Figure 1 is a picture of plate pure culture of the Bacillus turicatus strain in the present application; Figure 2 is the morphology of Bacillus tectonicus under an optical microscope in the present application, A is a vegetative cell, B and C are spores; Figure 3 is a phylogenetic tree of Bacillus tectonicus in the present application; Figure 4 is a picture of a CK plate of Rhizoctonia solani and a picture of confrontation between the HZB-44 strain and Rhizoctonia solani in the present application; Figure 5 is a picture of an in-vitro inoculation experiment in the present application, the first picture on the left in the figure is inoculated only with the HZB-44 strain, the middle leaf is inoculated with the HZB-44 strain for 24 hours and then inoculated with Rhizoctonia solani, and the right leaf is inoculated only with Rhizoctonia solani, the first picture is a picture of the back of the leaf, and the second picture is a picture of the front of the leaf; Figure 6 is a picture of a water rice potting in a tissue culture bottle in the present application; Figure 7 is a picture of the growth inhibition of Rhizoctonia solani by the crude extract of the HZB-44 strain in the present application.

[0011] Biological preservation The Bacillus tectonicus provided in the present application has the following characteristics: Bacillus subtilis , and is classified and named as: Bacillus tequilensis HZB-44, and has the preservation number CCTCC NO: M 20251909, and was preserved in the China Center of Type Culture Collection on August 27, 2025, at the address of No. 299, Bajiyi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, and the postcode is 430072. DETAILED DESCRIPTION

[0012] The endpoints of the ranges and any values disclosed in this document are not limited to the precise values stated. The ranges and values should be construed to be roughly about the ranges or values. For ranges, the endpoints are included between the values; the endpoints are included with the individual points; and the individual points are included between the endpoints. Any of the numerical ranges are intended to incorporate every narrower numerical range that falls within the broader numerical range. Moreover, any incorporated range or value is intended to include every narrower subrange, sub-range, or value that falls within the broader range or value.

[0013] The Bacillus tectonicus HZB-44 and the Bacillus tectonicus (CCTCC NO: M 20251909) in the present application are the same strain, and have the same meaning, and the names (numbers) thereof can be used interchangeably.

[0014] During the research process, the inventors of this invention isolated a strain of Bacillus tekirae, named Bacillus tekirae HZB-44, which was deposited on August 27, 2025, at the China Center for Type Culture Collection, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, with accession number CCTCC NO: M 20251909.

[0015] Based on this, the first aspect of the present invention provides a strain of Bacillus tekirae, whose preservation number is CCTCC NO: M20251909.

[0016] Further research has revealed that Bacillus tektii can be used to control rice sheath blight.

[0017] Based on this, the second aspect of the present invention provides the application of the above-mentioned Bacillus tektii in the prevention and control of rice sheath blight.

[0018] In this invention, there are no particular restrictions on the specific dosage of Bacillus tektii, as long as it can achieve the prevention and control of rice sheath blight.

[0019] To make the objectives, technical solutions, and beneficial effects of the present invention clearer, the preferred embodiments of the present invention will be described in detail below to facilitate understanding by those skilled in the art.

[0020] Example 1: Isolation and Identification of Strains 1. Isolation of strains The inventor directly isolated it from the soil of potato fields in Haozhiba Village, Zhutang Township, Lancang Lahu Autonomous County, Pu'er City, Yunnan Province, and named it: Bacillus tekirae HZB-44.

[0021] 2. Identification of strains 2.1 Pure culture of strain on plate The strain was inoculated onto LB medium, as shown in the attached image. Figure 1 As shown, the colonies are grayish-white, usually round or irregular in shape, with irregular edges, appearing wavy or serrated. The surface is rough and opaque, resembling sandpaper or having spider web-like wrinkles. As the incubation time is extended, the wrinkles become more obvious. The colonies are usually raised and gradually thicken as they grow, with a more pronounced degree of elevation.

[0022] 2.2 Morphological observation of the strain under an optical microscope As attached Figure 2 As shown, the vegetative cells are rod-shaped single cells, which may appear in chain-like arrangements when growing in groups. The cells are straight rods with blunt, rounded ends, and are usually (0.7-0.8) × (2-3) μm in size. Most exist singly or in short chains (2-4 cells connected together), and in a few cases, they can form longer chains. The spores are round or oval, about 0.6-1.0 μm in diameter, and are enclosed in a tough spore wall.Figure 2 In the image, A represents the vegetative body, and B and C represent spores. All three images were observed under a 40x objective lens. Image A was not magnified but only cropped. Images B and C were both cropped at approximately 10x magnification. 2.3 Molecular Identification After pretreatment such as pure culture and genomic DNA extraction of the target bacterial strain, PCR amplification was performed using the 16S rDNA (16S ribosomal RNA gene), a core conserved fragment for bacterial species identification (this fragment is highly conserved in bacteria and contains species-specific variation regions, making it the internationally recognized "gold standard" fragment for bacterial classification and identification). A specific primer combination (forward primer 27F: AGAGTTTGATCCTGGCTCAG; reverse primer 1492R: GGTTACCTTGTTACGACTT) was used for amplification. Verification was performed by 1.2% agarose gel electrophoresis (confirming the appearance of a target band of approximately 1500 bp, with no non-specific amplification bands or primer dimers, consistent with the normal length range of bacterial 16S rDNA fragments). The successfully amplified PCR products were selected and sequenced using Sanger paired-end sequencing technology by Sangon Biotech (Shanghai) Co., Ltd., to obtain the complete 16S rDNA sequence of the strain. The obtained 16S rDNA complete sequence was submitted to the NCBI website (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Homology alignment was performed using the BLASTn program (selecting the "nr / nt" non-redundant nucleotide database and setting the default parameter E-value=1e-5). Reference strain sequences (covering Bacillus tekirae and closely related type strain sequences) with ≥97% sequence similarity to the target strain were screened and downloaded. Subsequently, a phylogenetic tree was constructed using MEGA 7.0 software with the neighbor-joining method (NJ). The bootstrap validation replicates were set to 1000 times to ensure the reliability of the tree. The construction results are attached. Figure 3 As shown. Strains and reference standard strains Bacillus tequilensis The similarity was 98.38%; based on morphological characteristics, strain HZB-44 was identified as... Bacillus tequilensis Bacillus tekirae.

[0023] Sequence (SEQ ID NO.1):

[0024] Preparation of Bacillus tekiria inoculum: The selected strains were inoculated onto LB medium and cultured at 25-30℃ for 3-5 days to activate the strains. Preparation of inoculum: The fermentation broth is concentrated by centrifugation (4000-6000 r / min, 10-15 min), and a certain amount of thickener is added to obtain a liquid inoculum with a viable count ≥10⁻⁶. 10 CFU / ml; spray-dry the fermentation broth, mix the precipitated bacteria with an appropriate amount of carrier, such as diatomaceous earth or sodium lignosulfonate, and adjust the viable Bacillus count in the inoculum to 1×10⁻⁶. 8 - 1×10¹ 0 CFU / g, to produce microbial agents in the form of wettable powders or granules.

[0025] In actual field application, apply biocontrol granules to the soil before sowing or transplanting, and spray the suspension again during the seedling stage (3-6 leaf stage) to consolidate the efficacy.

[0026] 2.4 Confrontation experiment with Rhizoctonia solani on agar plates: Experimental steps: ① Culture medium preparation: Prepare sterile basal culture medium (LB), pour into plates and cool to solidify, set up 3 replicate plates and blank control.

[0027] ② Pretreatment of strains: Both Bacillus tekirae and Rhizoctonia solani were activated in advance. For Rhizoctonia solani, active areas at the edge of hyphae were collected, and single colonies of strain HZB-44 were picked.

[0028] ③ Four-point inoculation: On a sterile operating table, mark the petri dish with a cross, and inoculate one piece of HZB-44 strain at four equal intervals around the perimeter of the plate (2-3 cm from the plate wall), and inoculate Rhizoctonia solani at the center point. The blank control plate is inoculated only with Rhizoctonia solani.

[0029] ④ Incubation at constant temperature: Invert the plate and place it in a 28℃ incubator for 3-7 days, until the Rhizoctonia solani on the blank control plate has grown to more than 2 / 3 of the plate.

[0030] The experimental results are attached. Figure 4 As shown, compared with the blank control, an inhibition zone can be seen between strain HZB-44 and Rhizoctonia solani.

[0031] Example 2: In vitro inoculation experiment (1) Material preparation: HZB-44 strain bacterial suspension (concentration 1×10⁻⁶) 8CFU / ml), Rhizoctonia solani mycelium cake (PD culture for 7-10 days, cake made with 5mm punch), and sterilized rice functional leaves (75% ethanol for 30 seconds + 0.1% mercuric chloride for 2-3 minutes, rinsed with sterile water).

[0032] (2) Inoculation procedure: Line sterile culture dishes with absorbent paper and set up 3 groups (3 replicates, 10 leaves per group): ① Control group (first inoculate with antagonistic bacterial suspension, incubate at 25℃ for 24 hours, then apply pathogenic bacterial cake); ② Pathogenic control group (only apply pathogenic bacterial cake); ③ Blank control group (no inoculation).

[0033] (3) Observation and statistics: After incubation at 25-28℃ for 3-5 days, the diameter of the lesions was measured and the control efficacy was calculated as ((control group lesions - control group lesions) / control group lesions × 100%).

[0034] Experimental results: As shown in Figure 5, the experimental results indicate that there are significant differences in the susceptibility response of leaves to Rhizoctonia solani in different treatment groups. The specific characteristics are quantitatively analyzed as follows: Control group (inoculated only with Rhizoctonia solani): Leaves showed a severely infected phenotype, with lesions initially exhibiting typical water-soaked characteristics that continued to spread over time, eventually completely covering the entire leaf. The lesions maintained a stable, typical yellowish-brown color, accompanied by obvious cell disintegration and tissue necrosis; photosynthetic pigments in the leaves were severely degraded, physiological metabolic pathways were blocked, and the leaves were almost completely dead, with only a small amount of non-functional parenchyma tissue remaining at the edges. Treatment group (inoculated first with HZB-44, then with Rhizoctonia solani): Leaf lesions were limited to the Rhizoctonia solani inoculation site and surrounding area. The lesions were pale yellow in color, water-soaked, and only reached the epidermis, without penetrating into the mesophyll tissue.

[0035] The above results confirm that HZB-44 can significantly reduce the severity of disease by inhibiting the mycelial expansion of Rhizoctonia solani and the release of pathogenic factors (such as cellulase and pectinase), while protecting the photosynthetic physiological function of leaf tissues, and has the potential for biocontrol of diseases caused by Rhizoctonia solani.

[0036] Example 3: Pot culture verification experiment of strain HZB-44 Application of the strain: After rice seedlings are transplanted into pots and grow to the tillering stage (keeping the substrate moist during this period), prepare a 1×10⁻⁶ concentration of Bacillus tektina. 8 CFU / ml bacterial suspension was applied to each pot, with an equal volume of bacterial solution (or sterile water) poured along the roots to ensure even penetration of the bacterial solution around the roots. Two treatments were set up: a control inoculated only with the pathogen and a treatment inoculated with HZB-44 antagonistic bacteria followed by Rhizoctonia solani 24 hours later. Each treatment was replicated three times, and 2-3 rice seedlings were planted in each bottle.

[0037] Inoculation with pathogens: 24 hours after application of the strain, use sterile forceps to pick up one fully infected barley grain of Rhizoctonia solani at the leaf sheath of a rice plant near the water surface (2-3 cm from the base), fix it tightly against the leaf sheath, and wrap it with moist defatted cotton (to maintain humidity and promote sclerotium germination). After inoculation, place the potted plants in an artificial climate chamber (temperature 28℃, relative humidity 85%, light 12h / d) for cultivation.

[0038] Environmental control: During the experiment, the substrate moisture content was maintained at 70%-80% of the field capacity to avoid waterlogging; Investigation period: Samples were taken and photographed when the control group (CK) developed symptoms after inoculation with the pathogen; Disease severity grading criteria: Incidence rate = {Number of infected plants / Total number of plants surveyed} × 100%; Disease index = {total (number of diseased plants at each level × corresponding level) / total number of plants surveyed × highest disease level} × 100.

[0039] Experimental results: This experiment set up two treatment groups and analyzed the regulatory effect of HZB-44 antagonistic bacteria on the pathogenic process of Rhizoctonia solani using quantitative indicators. The specific data are as follows: 1. Indicators related to disease occurrence HZB-44 pretreatment group (inoculated with HZB-44 antagonistic bacteria for 24 hours, followed by inoculation with Rhizoctonia solani): leaf disease incidence was 90.90%, and disease index was 43.94 (disease index classification refers to the "Standard for Grading Plant Diseases", with a value range of 0-100, and the higher the value, the more severe the disease). Pathogen control group (inoculated only with Rhizoctonia solani): leaf disease incidence reached 100%, and the disease index was 61.76; Compared with the control group, the incidence rate of HZB-44 pretreatment group decreased by 9.10 percentage points and the disease index decreased significantly by 28.85%, indicating that HZB-44 antagonistic bacteria can effectively inhibit the pathogenicity of Rhizoctonia solani and reduce the severity of disease. 2. Plant growth and physiological indicators HZB-44 pretreatment group: The plant chlorophyll content was 42.32 SPAD value (SPAD value is a relative content index measured by a chlorophyll meter, the higher the value, the more chlorophyll accumulated), the plant height was 91.61 cm, and the number of tillers per plant was 11. Pathogen control group: The plant chlorophyll content was only 29.67 SPAD value, the plant height was 80.03cm, and the number of tillers per plant was 5. Comparison of physiological and growth indicators showed that the chlorophyll content of the HZB-44 pretreated group increased by 42.64% compared with the control group, effectively alleviating the degradation of photosynthetic pigments caused by pathogens; plant height increased by 14.47%, and the number of tillers increased by 120%, indicating that the HZB-44 antagonistic bacteria, while reducing disease, can protect the plant's photosynthetic function, promote vegetative growth, and maintain normal tillering ability, as shown in the attached figure. Figure 6 As shown. In summary, HZB-44 antagonistic bacteria have a significant biocontrol and plant growth protection effect on diseases caused by Rhizoctonia solani by reducing the incidence and disease index of diseases caused by Rhizoctonia solani, protecting chlorophyll synthesis in plants, and thus promoting plant height growth and tillering.

[0040] Example 4: Fermentation broth experiment: For strain and culture medium pretreatment, the strains were inoculated onto corresponding solid slant agar for activation. Liquid fermentation medium (LB for *Bacillus tekiria*) and basal medium for agar plates were prepared and sterilized at 121℃ for 20-30 minutes. For liquid fermentation, the activated strains were aseptically inoculated into the liquid medium and cultured at 28℃ with shaking at 200 rpm for 24 hours. A crude fermentation broth was prepared and filtered through sterile gauze or a 0.22 μm filter membrane, and the filtrate was collected. Plates containing the fermentation broth were prepared by mixing different concentrations of crude fermentation broth (gradients of 10%, 20%, 30%, 40%, and 50%) with basal medium at 50-60℃, inverting the plates to solidify, and setting multiple control groups. *Rhizoctonia solani* was inoculated; activated *Rhizoctonia solani* mycelial cakes were inoculated into the center of the plates and incubated upside down at 28℃ for 3-7 days. Subsequent assays included measuring the growth rate of *Rhizoctonia solani*, observing the inhibition zone and hyphal morphology, and evaluating the antagonistic effect of the fermentation broth.

[0041] Experimental Objective: To systematically analyze the effects of secondary metabolites of *Rhizoctonia solani* on the growth of *Rhizoctonia solani* under different concentrations of crude extract of strain HZB-44, and to preliminarily assess its antagonistic activity, by measuring the colony growth rate of *Rhizoctonia solani* treated with different concentrations of crude extract and combining this with microscopic observation of hyphal morphology. This study can provide basic data support and research directions for further in-depth analysis of the disease resistance mechanism of strain HZB-44 against *Rhizoctonia solani* and clarification of its biocontrol potential.

[0042] Experimental Results: As shown in Figure 7, after culturing Rhizoctonia solani on plates for 24 h, there were significant differences in the effects of different concentrations of crude extract of strain HZB-44 on its growth: Compared with the blank control (CK), the 50% concentration crude extract treatment group significantly inhibited the growth of Rhizoctonia solani, and its colony growth rate was significantly reduced; while the 30% concentration crude extract treatment group did not show a significant difference in colony hyphal coverage area compared with the CK group, but microscopic observation revealed that the hyphal density of Rhizoctonia solani in this group was significantly lower than that in the CK group, and the hyphal structure was more loose.

[0043] Figure 7 The first image shows the control group (CK). The second image shows the top of a plate with a 10% concentration of crude fermentation broth. The third image shows the top of plates with a 30% concentration and the fourth image shows the top of plates with a 50% concentration of crude fermentation broth. From left to right, the control group (CK) shows vigorous microbial growth and a large mycelial coverage area. When the concentration of crude fermentation broth is 10%, 30%, and 50%, the growth range of microorganisms gradually shrinks and the mycelial density decreases as the concentration increases. This indicates that the crude fermentation broth may have an inhibitory effect on the growth of this microorganism, and the higher the concentration, the more significant the inhibitory effect.

Claims

1. A strain of Bacillus tekiria ( Bacillus tequilensis (), its accession number is CCTCC NO: M20251909.

2. A microbial agent, wherein the microbial agent is a solid or liquid microbial agent; the active ingredient of the microbial agent comprises Bacillus tekirae as described in claim 1.

3. The application of Bacillus tektii as described in claim 1 or the inoculum as described in claim 2 in the control of rice sheath blight.

4. A method for controlling rice sheath blight, characterized in that: The process includes the following steps: During the rice tillering stage, apply a concentration greater than 1×10⁻⁶. 8 The Bacillus tekiri suspension of claim 1, CFU / ml, is applied to rice plants; or, biocontrol granules are applied to the field soil before sowing or transplanting, and liquid bacterial agent is applied again at the 3-6 leaf stage of rice.

5. The method for preparing the microbial agent as described in claim 2, characterized in that: It includes the following steps: S1, inoculate the strain onto LB liquid medium and ferment at 25-30℃ for 3-5 days; S2, centrifuge the fermentation broth at 4000-6000 r / min for 10-15 min, add a thickener to obtain a liquid inoculum; or, spray-dry the fermentation broth and mix it with a carrier, adjusting the viable count of Bacillus tekirae in the inoculum to 1×10⁻⁶. 8 -1×10¹ 0 CFU / g, formulated into wettable powder or granule forms of solid microbial agents.

6. The method for preparing the microbial agent according to claim 5, characterized in that: The carrier for step S2 is diatomaceous earth and / or sodium lignosulfonate.

Images