LAMP (Loop-Mediated Isothermal Amplification) detection primer of corn stalk rot pathogen as well as detection method and application thereof
By using LAMP detection technology and specific primers to amplify the EF-1α gene of *Cercospora cercosum*, the problem of rapid and accurate detection of *Cercospora cercosum* was solved, providing a basis for early disease diagnosis and control, and offering an effective means for disease monitoring during maize cultivation.
Patent Information
- Application Number
- CN202512007923.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-29
- Publication Date
- 2026-02-10
AI Technical Summary
Existing technologies are insufficient for the rapid and accurate detection of maize stalk rot pathogens, especially Fusarium verticillioides, resulting in a lack of effective means for disease control.
Using LAMP detection technology, specific primers were designed to amplify the EF-1α gene of Fusarium verticillatum, and combined with the SYBR Green I visual observation method, a rapid and simple detection method was established.
It enables early and accurate diagnosis and disease warning of corn stalk rot pathogen, providing a basis for disease prevention and control. The detection results are highly specific and sensitive, and can accurately identify pathogens in a short time.
Smart Images
Figure CN121496095A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of crop disease detection, identification and control technology, and more specifically to a LAMP detection primer for maize stem rot fungus and its detection method and application. Background Technology
[0002] China's annual corn production exceeds 260 million tons, accounting for nearly 40% of the country's total grain output, holding a pivotal position in national grain production. However, corn diseases, primarily corn stalk rot, have consistently posed a serious threat to the corn industry. Corn stalk rot, also known as corn bacterial wilt or corn stalk rot, is a globally prevalent soil-borne disease of corn, occurring frequently in my country's major corn-producing areas. Especially in recent years, with changes in farming practices such as returning corn stalks to the field and conservation tillage, the area of continuous corn cropping has been increasing, leading to a gradual exacerbation of corn stalk rot. Statistics show that the incidence rate of corn stalk rot is generally around 15% to 20% in normal years, but in rainy years, the incidence rate in some corn-producing areas of my country can reach as high as 70%, causing yield losses of up to 50% in severe cases.
[0003] The main pathogen causing corn stalk rot in my country is Fusarium. Fusarium and Pythium Pythium The main species is Fusarium verticillatum. Fusarium verticillium It is considered one of the main pathogens. Currently, the control of maize stalk rot mainly relies on disease-resistant varieties and chemical control. However, due to the diversity and differences among maize varieties, it is difficult to achieve targeted disease resistance in specific varieties. Chemical control mainly uses triazole fungicides, but long-term application of these agents can easily lead to the development of pathogen resistance, as well as a series of problems such as pesticide residues, environmental pollution, and reduction of soil microbial populations.
[0004] Loop-mediated isothermal amplification (LAMP) is a nucleic acid amplification technique for gene identification, publicly published by Japanese scholar Notomi. Under isothermal conditions of 60-65℃ and catalysis by strand displacement DNA polymerase, LAMP primers specifically designed for six regions of the target gene bind to both ends of the target sequence, cyclically generating circular single-stranded structures and continuously synthesizing new strands. Highly efficient amplification of the target gene can be achieved in 15-60 minutes, amplifying the target gene fragment to 10^60 nucleotides. 9 -10 10The byproduct magnesium pyrophosphate precipitate produced during the reaction is visible to the naked eye as a distinct white precipitate. To more accurately monitor the precipitate in a timely and quantitative manner, a real-time turbidity meter can be used to measure the turbidity. Compared to PCR, LAMP has the advantage of eliminating the need for cumbersome and time-consuming processes such as repeated thermal denaturation and temperature fluctuations. The reaction system can be continuously and rapidly amplified under constant temperature conditions, making it economical, convenient, and stable. It identifies six gene loci, resulting in high sensitivity and specificity, and enables rapid detection of pathogens, unaffected by contaminated samples or interfering fragments. The one-step LAMP technology, combining rapid DNA extraction with LAMP, further enhances the detection rate.
[0005] Currently, LAMP detection technology has been successfully applied to anthrax bacteria. Colletotrichum spp. Fusarium Fusarium spp. Phytophthora Phytophthora spp. Rapid detection of plant pathogenic fungi, but applicable to the pathogen of corn stalk rot. F. verticillioides Further research is needed on the detection methods.
[0006] Therefore, how to develop a LAMP detection method for maize stalk rot pathogen is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0007] In view of this, the purpose of the present invention is to provide a LAMP detection primer for maize stalk rot fungus and its detection method and application, so as to overcome the shortcomings of the prior art.
[0008] To achieve the above objectives, the present invention adopts the following technical solution: A LAMP detection primer for *Cephalotaxus fortunei*, comprising a pair of outer primers F3 / B3 and a pair of inner primers FIP / BIP, with the primer sequences as follows: FvF3-1 (as shown in SEQ ID NO. 1): TCTCCCATTCCACATCCTCA; FvB3-1 (as shown in SEQ ID NO. 2): CGGAGTAAGAGCGACAACAT; FvFIP1 (as shown in SEQ ID NO. 3): CGAGCTCAGCGGCTTCCTATTG-GAGCTCATCGTCACGTGTC; FvBIP1 (as shown in SEQ ID NO. 4): GCGTGAGCGTGGTATCACCA-ACGGTGACATAGTAGCGAGG.
[0009] This invention also claims the use of a LAMP detection primer for the above-mentioned corn stalk rot fungus in the detection of corn stalk rot fungus, wherein the corn stalk rot fungus is *Fusarium verticillatum*. Fusarium verticillium .
[0010] This invention also claims the use of the above-mentioned LAMP detection primers for the corn stalk rot fungus in the preparation of a kit for detecting the corn stalk rot fungus, wherein the corn stalk rot fungus is *Fusarium verticillatum*. Fusarium whorl-shaped .
[0011] A LAMP detection method for *Cephalotaxus fortunei*, comprising the following steps: (1) The LAMP detection primers of the above-mentioned maize stalk rot fungus were used to perform LAMP reaction on the test sample to obtain LAMP product; (2) The reaction results were observed simultaneously using a LAMP turbidimeter and the SYBR Green I visual observation method.
[0012] The purpose of this invention is to establish a rapid, simple, and sensitive LAMP (Loop-mediated isothermal amplification) visualization detection method for maize stalk rot pathogens, which can achieve early and accurate diagnosis of diseases and early warning of harmful organisms before plant symptoms appear or in the early stage of disease, providing direction and basis for disease prevention and control.
[0013] Method: Using pathogenic bacteria EF -1 a ( Elongation factor- 1 α Using the gene sequence as the target sequence, a set of LAMP-specific primers was designed; using its DNA as a template, the reaction temperature and reaction time were optimized to establish a LAMP detection reaction system. Based on this, specificity and sensitivity verification were conducted. Simultaneously, morphological identification was performed on 35 samples of suspected maize stalk rot naturally infected in the field. Through strain isolation and purification, morphological observation, and phenotypic analysis, it was determined whether the pathogen isolated from the samples was *Fusarium verticillatum*.
[0014] Results: The established LAMP reaction system could specifically and effectively detect Fusarium verticillatum. The optimal reaction temperature and time were 65℃ and 60 min, respectively. Specificity verification results showed that Fusarium verticillatum DNA showed a yellow-green positive reaction. Sensitivity verification results showed that the minimum detection concentration of LAMP was 10 fg·μL. -1The LAMP detection technology was used to detect 35 samples of suspected maize stem rot collected from the field and infected naturally. The results were compared with the morphological identification results. Among the 35 samples, 17 were identified as Fusarium moniliforme by morphology. The LAMP detection results of these 17 samples were all positive for Fusarium moniliforme. The two results were completely consistent.
[0015] Conclusion: The LAMP rapid detection technology for Fusarium verticillata established in this invention is not only highly specific and sensitive, but also provides visual detection results, providing a basis for early monitoring, rapid diagnosis, and timely and effective prevention and control of the disease.
[0016] Furthermore, in step (1) above, the initial system of the LAMP reaction is as follows: a 25 μL system containing 2.5 μL of 10×Thermolpol buffer, 1 μL of 8000 U / mL Bst polymerase, 2.5 μg of DNA template, 3.5 μL of dNTPs with a final concentration of 1.6 mM, 1.5 μL of MgSO4 with a final concentration of 8 mM, 4 μL each of inner primer FIP and BIP, 2 μL each of outer primer F3 and B3, and the remainder is ultrapure water.
[0017] Furthermore, the primer concentrations of the aforementioned inner primers FIP and BIP are 10 μmol / L.
[0018] Furthermore, the concentration of the outer primers F3 and B3 is 10 μmol / L.
[0019] Furthermore, in step (1) above, the temperature of the LAMP reaction is 65°C and the time is 60 min.
[0020] Furthermore, in step (2) above, the reaction settings of the LAMP turbidimeter are: 65℃ reaction for 60 min; 80℃ inactivation for 5 min.
[0021] Furthermore, in step (2) above, the SYBR Green I visual observation method is as follows: add 1 μL of SYBR Green I to the product for staining and observation.
[0022] As can be seen from the above technical solution, compared with the prior art, the beneficial effects of the present invention are as follows: Compared with PCR detection, the LAMP detection primers and detection method of this invention can amplify the target pathogen in a shorter time and more easily, enabling rapid and accurate detection of disease pathogens. It can also monitor the occurrence of diseases in real time during corn planting, and achieve real-time monitoring and early accurate diagnosis of pathogens in the early stage of corn stem rot caused by Fusarium oxysporum. Thus, through monitoring and detection, early prediction and forecasting can be carried out, enabling early prevention and early treatment, greatly reducing the occurrence, spread and outbreak of diseases, and providing direction and basis for early disease control. Attached Figure Description
[0023] Figure 1 Screening for the optimal temperature of the LAMP reaction (Note: LAMP product color reaction, 1: 60℃; 2: 61℃; 3: 62℃; 4: 63℃; 5: 64℃; 6: 65℃; 7: 66℃; 8: 67℃). Figure 2 Determination of the optimal time for the LAMP reaction (Note: LAMP product color reaction, 1: 30 min; 2: 40 min; 3: 50 min; 4: 60 min; 5: 70 min). Figure 3 LAMP product for specificity validation in LAMP detection (Note: 1: Fusarium verticillatum) Fusarium whorl-shaped ;2: Large-spotted umbelliferous worms Turkish sedge 3: Corn umbelliferous spirochetes Bipolar Mayday ;4: Anthrax of Gramineae Colletotrichum graminicola 5: Alternaria alternata Alternaria alternata 6: Fusarium graminearum Fusarium gramineae ;7: Erectile broom broom Sarocladium strictum ;8: Blank control); Figure 4 Amplification curves for LAMP detection specificity validation (Note: A1: Fusarium verticillata) Fusarium whorl-shaped A2: Large-spotted umbelliferous worms Turkish sedge A3: Corn spores Bipolaris maydis A4: Anthrax graminearum Colletotrichum graminicola A5: Alternaria alternata Alternaria alternata A6: Fusarium graminearum Fusarium gramineae A7: Erectorhynchus Sarocladium strictum (A8: Blank control) Figure 5 LAMP products used for LAMP sensitivity detection validation (Note: DNA concentration, 1:1 ng·μL) -1 ; 2: 100 pg·μL -1 3:10 pg·μL -1; 4:1 pg·μL -1 5:100 fg·μL -1 6:10 fg·μL -1 7:1 fg·μL -1 ;8:0.1fg·μL -1 ); Figure 6 Amplification curves validated for LAMP sensitivity detection (Note: DNA concentration, A1: 1 ng·μL) -1 A2: 100 pg·μL -1 A3: 10 pg·μL -1 A4: 1 pg·μL -1 A5: 100 fg·μL -1 A6: 10 fg·μL -1 A7: 1 fg·μL -1 A8: 0.1 fg·μL -1 ). Detailed Implementation
[0024] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0025] Example 1: Establishment of the LAMP detection method (1) Experimental materials Test strain: Fusarium verticillatum Fusarium verticillium Large-spotted umbelliferous worms Exerohyl Turkish Corn umbelliferous spores Bipolaris maydis Anthrax of the Gramineae Colletotrichum graminicola Alternaria Alternaria alternata Fusarium graminearum Fusarium gramineae , erect broom-like spores Sarocladium strictum .
[0026] Test culture medium: Potato glucose liquid culture medium: 200 g potato, 20 g glucose, distilled water to a final volume of 1 L.
[0027] Reagents and instruments: SYBR Green I, Plant Genome Extraction Kit (Tiangen Biotech (Beijing) Co., Ltd.); Taq PCR Mix and agarose (Sangon Biotech (Shanghai) Co., Ltd.); NanoDrop 2000C spectrophotometer (Thermo Fischer Scientific, USA).
[0028] (2) Sample DNA extraction The tested pathogens were cultured in 250 mL Erlenmeyer flasks containing 100 mL of potato dextrose liquid medium at 28 °C and 180 r / min for 6 days. The mycelia of each strain were collected by filtration, ground in liquid nitrogen, and DNA was extracted from each strain using a DNA extraction kit. The DNA of Fusarium verticillatum was detected by spectrophotometer concentration and used as a template for LAMP detection, diluted with sterile double-distilled water as required.
[0029] (3) Primer design and synthesis DNAStar 6.0 software was used to analyze Fusarium verticillatum. F. verticillioides DNA sequences were compared, and the online LAMP primer design software Primer Explorer V4 (http: / / primerexplorer.jp / elamp4.0.0 / index.html; Eiken Chemical Co., Japan) was used to design primers for *Fusarium verticillatum*. EF -1 α Primers were designed for highly conserved gene regions. A specific LAMP primer set, consisting of one pair of outer primers F3 / B3 and one pair of inner primers FIP / BIP, was developed. The primer sequences (synthesized by Shanghai Sangon Biotech Co., Ltd.) are as follows: Table 1. Fusarium verticillata ( F. verticillioides LAMP-specific primer sequences
[0030] (4) Optimization of LAMP reaction system A 25 μL LAMP reaction system for Fusarium verticillatum was established. LAMP reaction temperature and time optimization: Substrate, primers, and template bacterial DNA were sequentially added to a PCR tube and mixed thoroughly. Sterile double-distilled water was added to a final volume of 25 μL, and the tube was divided into two groups. One group was used for the optimal temperature gradient experiment, with eight temperature gradients (60℃, 61℃, 62℃, 63℃, 64℃, 65℃, 66℃, and 67℃) and a reaction time of 60 min. The other group used the optimal reaction temperature from the first group, followed by five time gradients (30 min, 40 min, 50 min, 60 min, and 70 min). Both groups were heated at 80℃ for 10 min at the end of the experiment, and the reaction was terminated on ice. The experiment was repeated in triplicate.
[0031] Determination of LAMP amplification results: Before the reaction, add 2 μL of 1000×SYBR Green I to the inside of the PCR tube cap. After the reaction, centrifuge briefly to mix the 1000×SYBR Green I with the LAMP reaction product at the bottom of the tube. Observe the color of the LAMP reaction product to determine the amplification results.
[0032] Verification of the reliability of LAMP test results: Using Fusarium oxysporum DNA as a positive control and sterile double-distilled water as a negative control, the reaction results were observed simultaneously using a LAMP turbidimeter and the SYBR Green I visual observation method.
[0033] (5) Results The optimization results of LAMP reaction temperature and time showed that, among the eight temperature gradients, when the reaction temperature was 60-64℃, the LAMP product was orange-yellow when negative. As the reaction temperature increased, the LAMP product was green when positive for the first time at 65℃. Therefore, 65℃ was confirmed as the optimal reaction temperature. Figure 1 In the five time gradients, when the reaction time was 30-50 min, the LAMP product was negative and orange-yellow. As the reaction time increased, the LAMP product became positive for the first time and turned green at 60 min. Therefore, 60 min was confirmed as the optimal reaction time. Figure 2 Experimental results show that the LAMP reaction temperature and time are 65℃ and 60 min, respectively.
[0034] Example 2: LAMP Specificity Validation Selected Fusarium pseudovermiculosum F. verticillioides Large-spotted umbelliferous worms E. turcicum Corn umbelliferous spores B. maydis Anthrax of the Gramineae C. graminicola Alternaria A. alternata Fusarium graminearum F. grasses , erect broom broom S. strictum Using DNA as a template, sterile double-distilled water was used as a negative control instead of DNA template. The specific LAMP primers screened in this experiment were used for the reaction. The reaction results were observed simultaneously using a LAMP turbidimeter and the SYBR Green I visual observation method.
[0035] LAMP reaction system and procedure: (1) Initial LAMP reaction system: The 25 μL system contains 2.5 μL of 10×Thermolpol buffer, 1 μL of 8000U / mL Bst polymerase, 2.5 μg of DNA template, 3.5 μL of dNTPs with a final concentration of 1.6 mM, 1.5 μL of MgSO4 with a final concentration of 8 mM, 4 μL each of inner primers FIP and BIP (primer concentration 10 μmol / L), 2 μL each of outer primers F3 and B3 (primer concentration 10 μmol / L), and the remainder is ultrapure water.
[0036] (2) The reaction was carried out in a real-time turbidimeter, and the reaction settings were: 65℃ for 60 min; 80℃ for 5 min for inactivation; (3) Add 1 μL of SYBR Green I to the product for staining and observation.
[0037] Specific detection results showed that only *Fusarium verticillatum* showed a positive LAMP reaction in the tested strains, while the other six pathogens showed negative LAMP reactions. Figure 3 The LAMP turbidimetric assay showed that only *Fusarium verticillatum* A1 produced a curve, while the other six pathogens and the blank control did not produce curves. Figure 4 This demonstrates that the LAMP detection method established in this invention is specific and can only detect Fusarium verticillatum. F. verticillioides .
[0038] Example 3: LAMP Sensitivity Verification DNA from *Fusarium verticillatum* was diluted to concentration gradients of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, and 1 fg / μL. Two μL of template from each dilution was used for LAMP assays. Sterile double-distilled water was used as a negative control instead of DNA template. Amplification was performed using the established optimal LAMP reaction system and conditions. The reaction results were simultaneously observed using a LAMP turbidimeter and the SYBR Green I visual inspection method to determine the sensitivity of the LAMP reaction. The initial LAMP reaction system and procedure were the same as in "LAMP Reaction System Optimization".
[0039] Sensitivity verification results showed that when Fusarium verticillatum... F. verticillioides The sample DNA concentration was 10 fg·μL -1 At this time, the LAMP product turns green, indicating a positive reaction. Figure 5 The corresponding LAMP turbidimeter reaction curve ( Figure 6 This demonstrates that the LAMP detection method established in this invention has high sensitivity.
[0040] Example 4: LAMP detection of diseased samples from the field The established LAMP detection method was used to test 35 samples of maize stalk base rot collected in the field. At the same time, combined with morphological identification technology, the pathogen isolated from the samples was verified to be Fusarium verticillatum through strain isolation and purification, morphological characteristic observation and phenotypic analysis.
[0041] LAMP analysis of field samples showed that among 35 tissue samples suspected of being naturally infected with maize stalk rot in the field, 17 samples were isolated from Fusarium tumefaciens, and the pathogens isolated from these samples were morphologically identified as Fusarium tumefaciens. The LAMP analysis results of these 17 samples were all positive for Fusarium tumefaciens, and the results of the two identification methods were completely consistent.
[0042] Examples 1-4 above illustrate that the present invention is based on Fusarium verticillata. F. verticillioides Target gene sequence EF -1 α A specific LAMP primer set was designed for region 6-8, and through LAMP system optimization, a model of Fusarium verticillatum was established. F. verticillioides The LAMP rapid detection method yielded results consistent with tissue isolation methods for suspected maize stalk rot samples, and can be used for detection of Fusarium wilt. F. verticillioides Rapid field detection of corn stalk rot.
[0043] Specificity is an important indicator in LAMP detection technology. EF -1 α Genes are highly conserved among Fusarium species and are associated with rDNA- IT , β-tubulin Compared to other gene types, it is better able to distinguish closely related species (such as *Fusarium verticillatum* and *Fusarium graminearum*). This invention uses... EF -1 α Primers designed for the target gene can only amplify Fusarium verticillatum, but cannot amplify closely related or common pathogens such as Fusarium graminearum and Anthracnose graminearum, further confirming the high specificity of this method.
[0044] Sensitivity is another core indicator of LAMP detection technology, and improving the sensitivity of the LAMP system is a key research focus. The LAMP method established in this invention has a detection limit of 10 fg·μL. -1 It has high sensitivity. Furthermore, it is targeted at… F. verticillioides Research shows that EF -1 α The high conservation of the gene enables it to be stably amplified even at low template concentrations, which supports the high sensitivity of this invention.
[0045] The LAMP rapid detection technology for Fusarium verticillatum established in this invention has high specificity and sensitivity, and the detection results are visualized with low false positives. It can be used to quickly detect stem base rot caused by Fusarium verticillatum in the field, and has good application prospects.
[0046] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A LAMP primer for detecting *Cephalotaxus fortunei*, characterized in that, It includes one pair of outer primers F3 / B3 and one pair of inner primers FIP / BIP, with the primer sequences as follows: FvF3-1:TCTCCCATTCCACATCCTCA; FvB3-1:CGGAGTAAGAGCGACAACAT; FvFIP1:CGAGCTCAGCGGCTTCCTATTG-GAGCTCATCGTCACGTGTC; FvBIP1: GCGTGAGCGTGGTATCACCA-ACGGTGACATAGTAGCGAGG.
2. The application of the LAMP detection primers for maize stalk rot fungus as described in claim 1 in the detection of maize stalk rot fungus.
3. The application of the LAMP detection primers for maize stalk rot fungus as described in claim 1 in the preparation of a kit for detecting maize stalk rot fungus.
4. A LAMP detection method for *Corn stalk rot*, characterized in that, Specifically, the following steps are included: (1) The LAMP detection primers for the corn stalk rot pathogen as described in claim 1 were used to perform a LAMP reaction on the test sample to obtain the LAMP product; (2) The reaction results were observed simultaneously using a LAMP turbidimeter and the SYBR Green I visual observation method.
5. The LAMP detection method for *Corn Stem Rot* according to claim 4, characterized in that, In step (1), the initial system of the LAMP reaction is as follows: a 25 μL system containing 2.5 μL of 10×Thermolpol buffer, 1 μL of 8000 U / mL Bst polymerase, 2.5 μg of DNA template, 3.5 μL of dNTPs with a final concentration of 1.6 mM, 1.5 μL of MgSO4 with a final concentration of 8 mM, 4 μL each of inner primers FIP and BIP, 2 μL each of outer primers F3 and B3, and the remainder is ultrapure water.
6. The LAMP detection method for maize stalk rot fungus according to claim 5, characterized in that, The concentration of the inner primers FIP and BIP is 10 μmol / L.
7. The LAMP detection method for maize stalk rot pathogen according to claim 5, characterized in that, The concentrations of the outer primers F3 and B3 were 10 μmol / L.
8. The LAMP detection method for maize stalk rot fungus according to claim 4, characterized in that, In step (1), the LAMP reaction is carried out at a temperature of 65°C for 60 min.
9. The LAMP detection method for *Cephalomyces cerevisiae* according to claim 4, characterized in that, In step (2), the reaction settings of the LAMP turbidimeter are: 65℃ reaction for 60 min; 80℃ inactivation for 5 min.
10. The LAMP detection method for *Cephalomyces cerevisiae* according to claim 4, characterized in that, In step (2), the SYBR Green I visual observation method is as follows: add 1 μL of SYBR Green I to the product for staining and observation.