Cell model and animal model for neurodevelopmental diseases caused by function acquisition type mutation of GABAAR as well as construction method and application of cell model and animal model for neurodevelopmental diseases caused by function acquisition type mutation of GABAAR

By introducing the GABRB3 L235A mutation into human neural stem cells and animal models, a GOF-type neurodevelopmental disease model was constructed, which solved the problem of insufficient understanding of the GABAA receptor subunit cleavage processing mechanism, realized an efficient neurodevelopmental disease model, and provided a reliable tool for drug screening and validation.

CN121628831APending Publication Date: 2026-03-10ARTIFICIAL INTELLIGENCE RES INST OF HEFEI COMPREHENSIVE NAT SCI CENT (ANHUI ARTIFICIAL INTELLIGENCE LAB)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511742374.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-25
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Current technologies have limited understanding of the role of GABAA receptor subunit cleavage and processing mechanisms in neurodevelopment, and there is a lack of stable disease models, especially insufficient research on the association between acquired functional enhancement mutations (GOF) of the GABAA receptor β3 subunit and neurodevelopmental diseases.

Method used

By introducing the L235A point mutation of the GABRB3 gene into human neural stem cells and animal models using gene editing technology, GOF-type neurodevelopmental disease cell and animal models were constructed. CRISPR/Cas9 technology was used to ensure high efficiency and specificity, simulate the neurodevelopmental defect phenotype caused by the mutation, and phenotype reversal was achieved through pharmacological intervention.

Benefits of technology

It provides long-term, reliable cell and animal models that can stably express pluripotency markers, simulate neurodevelopmental defects caused by mutations, and is used for drug screening and validation, with significant value in mechanism research and clinical relevance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121628831A_ABST
    Figure CN121628831A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and provides a cell model and an animal model for neurodevelopmental diseases caused by GOF (Gain of Function) mutation of GABAAR, and a construction method and application of the cell model and the animal model. The neurodevelopmental disease cell model and the animal model comprise GABRB3 gene point mutation cells, and the point mutation is that leucine at the 235th site is mutated into alanine. The neurodevelopmental disease cell model constructed by the invention has high disease relevance and stable expression, and can be used as a humanized cell model for in-vitro drug screening.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and in particular to a GABA A The present application relates to the field of biotechnology, and in particular to a GABA BACKGROUND

[0002] Neurodevelopmental Disorders (NDDs) are a group of diseases that are characterized by abnormal development of the central nervous system, which usually manifests as defects in brain structure or function, involving key regions such as the cerebral cortex, white matter, and neuronal migration pathways, and often accompanied by severe neurological dysfunction, including intellectual disability, epilepsy, and motor abnormalities.

[0003] With the development of genomics and molecular biology technologies, a number of CE-related pathogenic genes have been discovered, providing important means for prenatal diagnosis, family screening, and individualized intervention. However, most of the pathogenic sites are currently concentrated in traditional pathways such as transcription factors, cell adhesion molecules, or ion channels, and the role of neurotransmitter receptor cleavage processing mechanisms in neural development is still limited. Recent studies have shown that Gain of Function (GOF) mutations in GABA A Receptor subunits can lead to abnormal enhancement of GABA excitatory signals during embryonic development, affecting neuronal proliferation, migration, and network development, and are believed to be closely related to a variety of congenital encephalopathy and severe neurodevelopmental disorders. SUMMARY

[0004] Therefore, in order to solve the above technical problems, the present application provides a GABA A R Gain of Function (GOF) neurodevelopmental disease cell model, animal model, and construction method and application.

[0005] According to an embodiment of the present application, a new GABA A R Gain of Function (GOF) site mutation neurodevelopmental disease cell model is provided, which includes a GABRB3 gene point mutation cell, and the point mutation is that the coding leucine at position 235 is mutated to coding alanine.

[0006] According to another aspect of the present invention, an animal model of a neurodevelopmental disease is provided, wherein the GABRB3 gene of the animal model has a homozygous mutation, the homozygous mutation being a GABRB3 p.L235A point mutation.

[0007] According to another aspect of the present invention, a novel GABA is provided. A A method for constructing a neurodevelopmental disease cell model with a GOF (Gain of Function) site mutation in R, comprising: providing an in vitro human neural stem cell; and introducing a point mutation into the GABRB3 gene of the in vitro human neural stem cell using gene editing technology, wherein the point mutation is a mutation from encoding leucine at position 235 to encoding alanine.

[0008] According to another aspect of the present invention, a method for constructing an animal model of a neurodevelopmental disease is provided, the method comprising: providing a target animal; and using gene editing technology to induce a homozygous mutation in the GABRB3 gene of the target animal, wherein the homozygous mutation is a GABRB3 p.L235A point mutation.

[0009] According to another aspect of the present invention, an application of a cell model or animal model of a neurodevelopmental disease in screening therapeutic drugs for neurodevelopmental diseases is provided.

[0010] According to another aspect of the present invention, an application of the GABRB3 mutant gene in the preparation of reagents for diagnosing human neurodevelopmental diseases is provided, wherein the GABRB3 mutant gene is a GABRB3 gene with an introduced point mutation, wherein the point mutation is a mutation from encoding leucine at position 235 to encoding alanine. Preferably, the gene sequence of the GABRB3 mutant gene is shown in SEQ ID No. 1.

[0011] According to embodiments of the present invention, the novel GABA of the present invention AThe neurodevelopmental disease cell model with the GOF (Gain of Function) site mutation of R is obtained by gene point mutation of human induced pluripotent stem cells (iPSCs). The human induced pluripotent stem cell (iPSC) model carrying GABRB3 gene point mutation cells reproduces the phenotype of neurodevelopmental disorders and retains the typical pluripotent stem cell morphology. It can stably express pluripotency markers such as NESTIN and SOX2, showing that its stemness is not affected and it can achieve unlimited expansion. Thus, it is possible to continuously and stably obtain high-purity and phenotypically stable neurodevelopmental disease cells, providing a long-term and reliable cell source for research and application. Moreover, the cell model carrying GABRB3 gene point mutation can further differentiate into neurons, which can be used to study the regulatory mechanism of amino acid 235 (L235) of GABRB3 gene on neuronal development, as well as the screening and validation of related drugs. For example, the human L235A mutant iPSC cell model constructed in this invention can not only simulate the neurodevelopmental defect phenotype caused by the mutation, but also reverse the phenotype through pharmacological intervention. Therefore, it can be used as a humanized cell model for in vitro drug screening and has important application value in the drug development of epilepsy and related neurodevelopmental congenital brain diseases. Attached Figure Description

[0012] The above and other objects, features and advantages of the present invention will become more apparent from the following description of embodiments of the invention with reference to the accompanying drawings, in which:

[0013] Figure 1 This is a schematic diagram illustrating the birth / mortality rate statistics and Mendelian proportion deviation of P0 generation L235A / A newborn mice in Example 1 of the present invention. Figure A shows the mortality rate statistics of mice with different genotypes according to the number of days after birth; Figure B shows the birth rate statistics; Figure C shows the GABA composed of the L235A mutant β3 subunit transfected into the HEK293T human embryonic kidney 293T cell line. A R;

[0014] Figure 2 Example 2 of this invention uses mouse L235. A / A Schematic diagram of genotype identification results;

[0015] Figure 3 The above image shows the electroencephalogram (epileptic-like discharge) of P0 generation mice in Example 3 of this invention. The upper part of the image (A) is the EEG recording of cortical field potentials of P0 WT mice, and the lower part of the image (A) is the EEG recording of cortical field potentials of P0 L235A / A mice. The horizontal axis represents time, and the vertical axis represents the recording channel location.

[0016] Figure 4 This is a schematic diagram of HE staining of the brains of mice with different genotypes (reduced number of brain cells) in Example 4 of the present invention; the horizontal axis of the statistical graph represents the mouse genotype, and the vertical axis represents the relative number of cells;

[0017] Figure 5 This is a schematic diagram illustrating the construction of a cell model for screening drugs for congenital encephalopathy in Example 5 of the present invention;

[0018] Figure 6 This is a diagram showing the wild-type sequencing results of Example 5 of the present invention;

[0019] Figure 7 This is a diagram showing the sequencing results of the mutant strain in Example 5 of the present invention;

[0020] Figure 8 This is an image showing the immunofluorescence staining results of differentiation stage markers in Example 5 of the present invention;

[0021] Figure 9 This is a diagram showing the developmental abnormalities in iPSCs of the L235A mutant group in Example 5 of the present invention.

[0022] Figure 10 This is a diagram showing the experimental results of drug intervention in Example 5 of the present invention. Detailed Implementation

[0023] Hereinafter, embodiments of the present invention will be described with reference to the accompanying drawings. However, it should be understood that these descriptions are exemplary only and are not intended to limit the scope of the invention. In the following detailed description, numerous specific details are set forth to provide a thorough understanding of the embodiments of the invention for ease of explanation. However, it will be apparent that one or more embodiments may be practiced without these specific details. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention.

[0024] In the process of realizing the concept of this invention, it was discovered that GABA... A The β3 subunit of receptor GABAergic receptor (GABRB3), as an important component regulating the excitation-inhibition balance in the brain, is associated with various neurological diseases; β-secretase 1 (BACE1) not only participates in the pathogenesis of Alzheimer's disease but also plays an important role in neural development during the embryonic period, regulating axonal guidance and synapse formation. However, the role of BACE1 in GABAergic reactions remains unclear. A There is currently a lack of direct evidence and stable disease models regarding the functional effects of receptor subunit splicing and whether mutations at this site can lead to neurodevelopmental disorders.

[0025] Specifically, according to one embodiment of the present invention, a cell model of a neurodevelopmental disease is provided, the cell model comprising GABRB3 gene point mutation cells, wherein the point mutation is a mutation from encoding leucine at position 235 to encoding alanine.

[0026] In some specific embodiments of the present invention, the neurodevelopmental disease cell model is obtained by gene point mutation of human induced pluripotent stem cells (iPSCs). The human induced pluripotent stem cell (iPSC) model carrying GABRB3 gene point mutation cells reproduces the neurodevelopmental disorder phenotype, which has abnormal characteristics of premature differentiation and reduced cell number, and this phenotype can be regenerated through GABA... A The receptor blocker provides partial remission and has a high disease association. It also retains the typical pluripotent stem cell morphology, stably expressing pluripotency markers such as NESTIN and SOX2, indicating that its stemness is unaffected and it can achieve unlimited expansion. This allows for the continuous and stable acquisition of high-purity and phenotypically stable cells for neurodevelopmental diseases, providing a long-term and reliable cell source for research and application. Furthermore, cell models carrying GABRB3 gene point mutations can further differentiate into neurons, enabling the study of the regulatory mechanism of amino acid 235 (L235) of the GABRB3 gene on neuronal development, as well as the screening and validation of related drugs. For example, the human L235A mutant iPSC cell model constructed in this invention can not only simulate the neurodevelopmental defect phenotype caused by the mutation but also achieve phenotype reversal through pharmacological intervention. Therefore, it can serve as a humanized cell model for in vitro drug screening and has significant application value in the drug development of epilepsy and related neurodevelopmental congenital brain diseases.

[0027] In some specific embodiments of the present invention, the above-mentioned neurodevelopmental disease cell model is a developmental epileptic encephalopathy cell model.

[0028] In some specific embodiments of the present invention, the cell model includes GABRB3 gene point mutant cells, and the mutated gene sequence is shown in SEQ ID No. 1. Specifically, the human GABRB3 gene sequence number is NM_000814.5, and the mutation site is located at exon 7.

[0029] SEQ ID No. 1 (the underlined 907bp~909bp is the mutation site, i.e., CTG mutates to GCG): AGGCTGAGGCAAGAGAATCGCCTGAACCAGGGAGGTGGAGGTTGCAGTGAGCCAAGATCGTGCCACTGCCCTCCAGCCTGGGTGACAGAGCGAGACTCCATCTCAAAAAAAAAAAAAAAAAAGAAAGGAAAACAAAATAAGACAGAAAAGGCAAATATAGCGCTGAATGTGGCATGATAAAT GGCATATTTTCTCACTCTGTCATGGTGGTGGTGGTAGGATTCCAAAATGTGTTGAGTGGAATGTTCACATCCGAGAATTAACACTGGGACTCATGGGCAAGAAGGCAGACAGGTGCTCCTTTGAGACTCTCGTTAATGCCTCTTCTGTGGCCGAAGCAGAAGCCCTCAGTGTGCACCACTGCTTTCTCCGGGACTGGACTTGCTTCTCTGCCTCTCTCATTCTTAGGGTGCCCCTGAGCTAGCCCAGTCACTCTAGGGGCAATGCCTCTAACATCTGTATTCAGGGCTGAACTCCAGGTGGGCTGAAAGGACAACTGGTAAAAGCCTTTCTTGCCCAGTAAAGCCTTGAGCCACATCTCCGCTGTCTACAAGGAAGAAGGGGATAATCATTCATTAAAGAATAAACAAGGTATTTGGCATTATTCTGGATTCTAAGCTAAAAACTAATACGTTTTTCCAAGTTCTCAACCGAGCGTTTAGCCTTAGAAGAGCATCCTCATCACTATCTTATAAATAGACCGAAAAGCACCCCCCTCCTAATTCTTCTATAAATACCGCTAGCAGACAGAAGCAAACTGCTTGGTGGTGGGTCACCCCTTTATTCGCAGACTTTTCCATTGCCTGTTGTTGACCTATGGAAGTCAAAGCAAACTCTTTAGTCTGCCATGTTGTTTCTCCAGTGTAATATCCTTGTCTGTTTCCCATAGGTGCCTATCCTCGACTGTCA GCG AGCTTTCGGTTGAAGAGGAACATTGGATACTTCATTCTTCAGACTTATATGCCCTCTATACTGATAACGATTCTGTCGTGGGTGTCCTTCTGGATCAATTATGATGCATCTGCTGCTAGAGTTGCCCTCGGTATGTGCTATTTTTAAGTGATATTTAAATGTAAAGTAACCGTATCATTACAGTATTAAGAGAGTTCAAAGGCTGTAGTTCAACTACCATTTTTTGACAGCGTGACA CAAG CATTGCCTGTATAGTCACT.

[0030] According to another embodiment of the present invention, a GABA is provided. A A method for constructing a cell model of neurodevelopmental disease caused by GOF mutation of R, the method comprising: providing an in vitro human neural stem cell; and introducing a point mutation into the GABRB3 gene in the in vitro human neural stem cell using gene editing technology, wherein the point mutation is a mutation from encoding leucine at position 235 to encoding alanine.

[0031] The aforementioned gene editing technology is selected from at least one of CRISPR / Cas9, ZFN, and TALEN technologies, with CRISPR / Cas9 being the preferred option. Gene editing technologies such as the CRISPR / Cas9 system have the advantages of high efficiency and specificity, reducing off-target effects on other parts of the cellular genome, ensuring that the observed phenotype is indeed caused by the target mutation, and efficiently obtaining neurodevelopmental disease cell models with high disease association while preserving typical pluripotent stem cell morphology.

[0032] Another embodiment of the present invention provides an animal model of a neurodevelopmental disease, wherein the GABRB3 gene in the animal model has a homozygous mutation, the homozygous mutation being a GABRB3 p.L235A point mutation.

[0033] According to an embodiment of the present invention, a Gabrb3 L235A transgenic mouse (C57BL / 6J) was constructed by mutating leucine at position 235 of the β3 subunit of the GABAA receptor to alanine, preventing it from being cleaved by BACE1. This established an animal model capable of exhibiting severe brain development defects and high mortality rates in embryos and early infancy. The phenotypes of this model, including birth mortality, reduced brain cell number, and sex differences, highly correlate with the clinical characteristics of some human congenital encephalopathy, demonstrating good clinical relevance. This model can be used to study the causal relationship between GABAA receptor dysfunction and neurodevelopmental disorders, possessing significant mechanistic research value. Furthermore, the model has a clear phenotype and strong reproducibility, making it widely applicable for gene screening, pathological mechanism research, and evaluation of drug intervention effects in congenital encephalopathy.

[0034] In some specific embodiments of the present invention, the above-mentioned neurodevelopmental disease animal model is a developmental epileptic encephalopathy animal model.

[0035] In some specific embodiments of the present invention, the mutated gene sequence of the mouse neurodevelopmental disease animal model is shown in SEQ ID No. 2.

[0036] SEQ ID No. 2 (the underlined 383bp~385bp is the mutation site, i.e., TTG mutates into GCG):

[0037] CAGCATGATTTGTAACAGCCATTTTGCCTAGGAACATCCCAAATTTTCTTTCTATACTAAGGATAAACAAAGAGACAACCATCGATGAAAAACTGAACATCACATTTACTGTTACTCTGTGCTCCATGCCTAAAACCTCCCCAGAAACTGCTCTCACCTAAGCTTTAGCCTTAGAACAACGCTCTTATCTT GCAAACTGATATACTCCTTCCTCCTGTACTCTATAAATCACACGCCGACCTGCATAGTAGTGGGTGGCTCCCCAGTTTATGGAGTTTTCCAGGTGCAAGCTGTTGACTCTTGAATGCTGGAGCAGATTGCCCATCATGGCTCCTCACTGTGCCCTTGTGTGTTTCCTGTAGGTGCCTATCCTCGACTTTCA GCG AGTTTTCGGTTGAAGAGAAATATCGGGTACTTCATTCTTCAGACGTATATGCCCTCAATCCTGATCACAATCCTCTCGTGGGTGTCCTTCTGGATCAATTACGATGCATCTGCTGCTCGAGTTGCCCTTGGTATGTGCTACTGTTAAGTCCTATCTAAAATGTAAAGTGACCACATCACTTCAGTGTTCAGGAAAATTTAAAGGCCAGA GAGCAACTAGGAATTCTGGGTGTCATTACATCAGCCTCAGTCACATAGTCACACTTTATCTTTAAACAGTAATTTCATGCATGAATCTCTGGATGCACTAATTTAATTATAAGACTGAAATGTGAGTTTTCATGTCTATGAAAGAGAAAAAATGTCTTCTGAATATTTGTATCACATAAGTATTTTTGATACATAATTTTAAAGTTG.

[0038] In some specific embodiments of the present invention, the mutated gene sequence of the rat neurodevelopmental disease animal model is shown in SEQ ID No. 3.

[0039] SEQ ID No. 3 (the underlined 193bp~195bp is the mutation site, i.e. TTG mutates to GCG):

[0040] CTTGCAAACGGATATGCACTCCTTCTTCCTGTCCCCTATAAATATGTCAAATTGCACAGTAGTGGGTGGCTCCCAAGTTCATGGAGTTTCCAGGTGCATGCTGTTGACGCTTGGATGTTGGAGCAGACTGCCTGCCACGGTTCTTCACTGTTCCCTTGTGTGTTTACTGTAGGTGCCTACCCTCGACTCTC GCG AGTTTTCGGTTGAAGAGAAACATTGGGTACTTCATACTTCAGACGTATATGCCCTCAATACTGATCACAATCCTCTCATGGGTGTCCTTCTGGATCAATTATGATGCATCTGCTGCTCGAGTTGCCCTAGGTA.

[0041] According to another embodiment of the present invention, a method for constructing an animal model of a neurodevelopmental disease is provided, the method comprising: providing a target animal; and using gene editing technology to induce a homozygous mutation in the GABRB3 gene of the target animal, wherein the homozygous mutation is a GABRB3 p.L235A point mutation.

[0042] The target animal of the present invention is a non-human mammal; preferably, the non-human mammal is selected from any one of mice, rats, horses, pigs, monkeys, dogs and apes; preferably, the target animal is a mouse.

[0043] In implementing the construction method of this invention, a point mutation can be introduced at the L235 site of the GABRB3 gene in the target animal using CRISPR / Cas9 technology to obtain F0 generation heterozygous target animals. The F0 generation heterozygous target animals are then identified to obtain positive F0 target animals. The positive F0 target animals are then mated with wild-type target animals to obtain F1 generation heterozygous positive target animals. The F1 generation heterozygous positive target animals are then mated with each other, and the resulting F2 generation positive target animals are identified to obtain homozygous mutant target animals, which are the true neurodevelopmental disease animal models.

[0044] According to an embodiment of the present invention, by introducing a point mutation at the L235 site of the GABRB3 gene in non-human mammals, the complex behavioral phenotypes associated with human neurodevelopmental diseases can be better simulated, and complex, quantifiable behavioral abnormalities can be exhibited, thereby ensuring that the constructed animal model can be effectively used for subsequent pathological mechanism research and drug screening.

[0045] Another embodiment of the present invention provides the application of a cell model or animal model of a neurodevelopmental disease in screening therapeutic drugs for neurodevelopmental diseases.

[0046] According to an embodiment of the present invention, through GABA A An artificial mutation was introduced at the L235 site of the receptor β3 subunit to establish a mouse disease model and a human iPSC cell model closely related to congenital encephalopathy (CE). This allows for the simultaneous study of the role of this site in neural development at both the systemic and cellular levels. GABA was then applied. A Receptor blockers (SR95531 and Bicuculline) can partially alleviate the phenotypes of related neurodevelopmental disorders, indicating that the gain-of-function enhancement effect caused by this mutation can be intervened through pharmacological means, thereby providing a basis for the validation of potential treatment strategies. It also proves that the cell and animal models constructed in this invention can be used in screening drugs for the treatment of neurodevelopmental disorders. It provides reproducible and evaluable animal and cell models that can be used for mechanism research of congenital encephalopathy and epilepsy, drug target validation, and early diagnostic technology development.

[0047] Another embodiment of the present invention provides the application of the GABRB3 mutant gene in the preparation of reagents for diagnosing human neurodevelopmental diseases, wherein the GABRB3 mutant gene is a GABRB3 gene with an introduced point mutation, wherein the point mutation is a mutation from encoding leucine at position 235 to encoding alanine. Preferably, the gene sequence of the GABRB3 mutant gene is shown in SEQ ID No. 1.

[0048] In some specific embodiments of the present invention, point mutations in the human GABRB3 gene can be identified by identifying primers SEQ ID No. 4 and SEQ ID No. 5 (corresponding to the double-underlined positions in SEQ ID No. 1).

[0049] hGABRB3-F:GGCATATTTTCTCACTCTGTCATG (SEQ ID No. 4).

[0050] hGABRB3-R:AGTGACTATACAGGCAATGCTTG (SEQ ID No. 5).

[0051] In some specific embodiments of the present invention, point mutations in the mouse GABRB3 gene (SEQ ID No. 2) can be identified using identification primers SEQ ID No. 6 and SEQ ID No. 7.

[0052] F1:5'-TGCCTAGGAACATCCCAAATTTTC-3' (SEQ ID No. 6).

[0053] R1:5'-ATTAGTGCATCCAGAGATTCATGC-3' (SEQ ID No. 7).

[0054] The present invention will be further described in detail below through embodiments, but the scope of protection of the present invention is not limited to the content. Unless otherwise specified, the methods in the embodiments are conventional methods, and the reagents used are conventional commercial reagents or reagents prepared by conventional methods unless otherwise specified.

[0055] Example 1: Construction of CE mouse model and statistics of birth and mortality rates and identification of site mutations as receptor-enhancing mutations.

[0056] Using CRISPR / Cas9 gene editing technology, a point mutation was introduced at the L235 site of the mouse GABRB3 gene to obtain Gabrb3 p.L235A (TTG to GCG) heterozygous mice.

[0057] During mouse breeding, it was found that using L235... A / + (♂)×L235 A / + (♀) Offspring were produced using a hybridization strategy; mouse genotyping showed that the homozygous mutant mouse L235 A / A The number of mice is small, does not conform to Mendelian inheritance laws, shows significant differences, and is a homozygous mutant mouse L235. A / A They exhibited a high mortality rate within 3 days of birth. Subsequently, upon dissecting the brains of P0 neonatal mice, L235 was found. A / A The mice exhibited brain development defects such as a reduction in the number of brain cells, thus successfully constructing a CE mouse model.

[0058] Figure 1 This is an example of embodiment 1 of the present invention, P0 replacing L235. A / A Schematic diagram of birth / mortality rate statistics and Mendelian proportion deviation in newborn mice. Figure A shows the mortality rate statistics of mice with different genotypes according to the number of days after birth; Figure B shows the birth rate statistics; Figure C shows the GABA composed of the L235A mutant β3 subunit transfected into the HEK293T human embryonic kidney 293T cell line. A R.

[0059] according to Figure 1 As can be seen, each point in A represents the percentage of mice with different genotypes in each litter, L235. A / AThe birth rate of homozygous mutant mice was significantly reduced, with most dying between P0 and P3. The birth rate deviated significantly from Mendelian inheritance patterns, suggesting that this mutation severely affects embryonic survival. Whole-cell current recordings were performed in HEK293T cell lines transfected with α5 and β3 subunits. The results showed that when the β3 subunit undergoes L235... A / A During mutation, receiving the same concentration of GABA puff activates GABA. A The whole-cell current induced by R was significantly enhanced compared to the wild-type (WT group), proving that this mutation is GABA. A Functional enhancement mutations of R.

[0060] GABA in HEK293T cell line A Detection of receptor L235A mutation-related functions

[0061] I. Materials and Methods

[0062] 1. Culture of HEK293T cells

[0063] The HEK293T cell line derived from human embryonic kidney was cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco). Cells were maintained for growth in a 37°C, 5% CO2 incubator.

[0064] 2. Transfection and protein extraction of HEK293T cells

[0065] GABA A The receptor α5 subunit and β3 (L235A) subunit, along with the BACE1 knockout vector or empty vector (control), were transfected into HEK293T cells using Lipofectamine 2000 reagent, following the instructions in the reagent's manual.

[0066] Cell lysates were collected 24 hours after transfection.

[0067] The lysis buffer was used for subsequent Western blot analysis.

[0068] 3. Whole-cell patch-clamp recording

[0069] HEK293T cells were used for whole-cell patch-clamp experiments 36–48 hours after transfection.

[0070] Cell co-transfection with GABA A The receptor subunit is added to GFP and co-expressed with the BACE1 knockout expression vector or an empty vector.

[0071] GABA-induced currents were recorded to analyze receptor function. Results showed that β3 (L235A) could enhance GABA-induced currents. A R accepts the amplitude of whole-cell currents induced by GABA, proving that the mutation is GABA. A R-function-gaining GOF mutation.

[0072] II. Construction of the BACE1 gene knockout HEK293T cell line

[0073] 1. sgRNA design and plasmid construction

[0074] To knock out the human BACE1 gene, three targeting sequences were designed:

[0075] sgBACE1-1:ggatccggagcccgctacat (SEQ ID No.9)

[0076] sgBACE1-2: cgggctcttcgtcggtctcc (SEQ ID No. 10)

[0077] sgBACE1-3:tactacgtggagatgaccgt (SEQ ID No. 11)

[0078] The annealed double-stranded oligonucleotides were cloned into the double BbsI restriction sites of pX458M (derived from pX458, Addgene #48138) and pX459M (derived from pX459 V2.0, Addgene #62988), respectively.

[0079] Subsequently, the U6::sgBACE1-1 and U6::sgBACE1-3 fragments were subcloned into pX458M-sgBACE1-1 and pX459M-sgBACE1-3, respectively.

[0080] Example 2 L235 A / A Mouse genotyping

[0081] (1) Cut off a toe from a newborn mouse (P15 or less) or a small segment of a tail from an adult mouse, place it in a 1.5 mL EP tube, add 80 µL of 50 mM NaOH solution, and heat in a 95°C metal bath for 60 min to lyse. After cooling, add 40 µL of 1 M Tris-HCl (pH 7.5), mix well, and then proceed to the next step of the PCR reaction.

[0082] (2) PCR reaction to amplify the target fragment

[0083] Add an appropriate amount of ddH2O to prepare a 100 µM stock solution of the synthesized primers (powder). Then, prepare a Primer Mix containing all the primers required for genotyping.

[0084] The PCR primer sequences are as follows:

[0085] Primer Sequence L235A-F 5'-TGCCTAGGAACATCCCAAATTTTC-3' (SEQ ID No. 6) L235A-R 5'-ATTAGTGCATCCAGAGATTCATGC-3' (SEQ ID No. 7)

[0086] Next, prepare the Master mix according to the following reaction system, then add 1 µL of the crude mouse genomic DNA extract from the previous step, and place it in a PCR instrument for reaction.

[0087] Master mix for 1 reaction (total 20 µL):

[0088] ddH2O 8 µL

[0089] 2× Taq Master Mix 10µL

[0090] Primer Mix (2 µM) 1 µL

[0091] The PCR procedure is as follows:

[0092] 94 °C for 3 min

[0093] 94 °C 30 sec

[0094] 60 °C 30 sec

[0095] 65 °C 30 sec

[0096] 65 °C for 10 min

[0097] 25 cycles to identify L235 A / A Mice:

[0098] The PCR products were subjected to one-way DNA sequencing. The sequencing primers were:

[0099] 5'-CCAGAAACTGCTCTCACCTAAGC-3' (SEQ ID No. 8).

[0100] Sequencing results as follows Figure 2 As shown, Figure 2 Example 2 of this invention uses mouse L235. A / A A diagram illustrating the genotype identification results.

[0101] from Figure 2It can be seen that by using software to find the first seven amino acids (ACTTTCA) of the mutation site, and observing the three amino acids following these seven, the wild type is TTG, L235. A / A For GCG, L235 A / + It is TTG, but the first two amino acids TT have overlapping peaks.

[0102] Example 3 L235 A / A Epilepsy-related death phenotypes in newborn mice

[0103] Observations revealed that the mutant newborn mice exhibited frequent generalized convulsive-like behaviors on the day of birth, suggesting that they died from epileptic seizures.

[0104] To verify GABRB3 L235 A / A The effect of the mutation on the brain function of newborn mice was investigated by performing in vivo electroencephalography (EEG) on newborn mice born on the day of birth (P0). Experimental animals included wild-type (WT) and homozygous mutant (L235). A / A Mice, 3–6 per group.

[0105] Electroencephalography (EEG) was performed using microelectrode implantation, with electrodes placed above the parietal cortex of newborn mice. Recording times ranged from 10 to 30 minutes, with simultaneous video recording for behavioral control. All data were analyzed using LabChart Pro software (version 7, ADInstruments Ltd.).

[0106] The criteria for diagnosing epileptic discharges are: bilateral EEG showing multi-peak discharges (frequency ≥ 5 Hz), amplitude exceeding twice the baseline EEG, and duration ≥ 5 seconds. Further spectral analysis of the recorded segments was performed, dividing the EEG signal into frequency bands such as δ (0–3.99 Hz), θ (4–7.99 Hz), α (8–12.99 Hz), β (13–29.99 Hz), and γ (30–80 Hz). The power variation in each frequency band was calculated and normalized to the baseline level. The detection results are as follows: Figure 3 As shown.

[0107] Figure 3 The above image shows the electroencephalogram (EEG) of P0 generation mice in Example 3 of this invention (epilepsy-like discharges). Image A (top) is the cortical EEG of P0 WT mice, and image A (bottom) is the EEG of P0 L235 mice. A / A Mouse cortical electroelectrokinetic (EEG) map (horizontal axis represents time, and vertical axis represents the epileptic pathway sites recorded by electrode insertion into the cortex).

[0108] according to Figure 3 It can be seen that L235 A / ANewborn mice exhibited epileptiform EEG activity, including high-frequency discharges and sharp-slow-wave complex high-frequency discharges, on the day of birth, accompanied by pronounced generalized tonic-clonic seizures. This suggests a severe neurodevelopmental disorder and an epileptic phenotype. These results indicate that L235... A / A The mutation caused newborn mice to exhibit epileptic seizures immediately after birth and die rapidly, thus establishing a CE epilepsy animal model that can be used for research on the pathological mechanisms of congenital encephalopathy and drug screening.

[0109] Example 4 Example 4: L235 A / A Phenotypic analysis of newborn mice

[0110] Preparation of L235 A / A Paraffin sections of fetal mouse tissue; the process is as follows: tissue sampling - fixation - embedding - sectioning - spreading - drying - dewaxing and rehydration - staining - dehydration - clearing - mounting.

[0111] (1) Tissue sampling:

[0112] Newborn mice were anesthetized on ice and then perfused with PBS via the heart, followed by perfusion with 4% paraformaldehyde solution. Brain tissue was removed by cervical dislocation and fixed in 4% paraformaldehyde solution for approximately 12 hours. The fixed samples were then sent to the company for paraffin embedding.

[0113] (2) Slices and slides

[0114] The embedded paraffin block is fixed on a microtome and cut into thin sections, which are then labeled and typically 5 micrometers thick. The cut sections are often wrinkled, so they can be flattened by placing them in warm water at 37°C, then attached to a glass slide, and dried overnight in a 37°C oven.

[0115] (3) Dewaxing and rehydration:

[0116] Xylene 10 min × 2

[0117] Anhydrous ethanol: 10 min × 2

[0118] 95% ethanol: 5 min

[0119] (4) Staining

[0120] Soaking in tap water: 5 minutes

[0121] Staining in hematoxylin for 5 min

[0122] Rinse repeatedly with tap water for 10 minutes to remove the hematoxylin stain (do not spray water directly onto the sample);

[0123] After 2-5 seconds in hematoxylin differentiation solution, rinse several times with tap water.

[0124] Hematoxylin blueing solution will turn blue in 2-5 seconds, then rinse with tap water.

[0125] 95% ethanol: 3 min

[0126] Anhydrous ethanol: 3 min x 2

[0127] Eosin (alcohol-soluble) staining for 4 min

[0128] (4) Dehydration and staining to clear

[0129] Anhydrous ethanol: 4 min x 3

[0130] Xylene, 5 min x 2, to make the slices transparent.

[0131] (5) Sealing

[0132] Apply a drop of neutral resin to the transparent section, cover with a coverslip to seal; after the resin has dried slightly, examine the section specimen under a microscope.

[0133] Figure 4 This is a schematic diagram of HE staining (reduced number of brain cells) of mice with different genotypes in Example 4 of the present invention.

[0134] according to Figure 4 HE staining results show that, compared to wild-type mice, L235 A / A In male mice, the entire brain (including the midbrain and hindbrain) showed a significant reduction in cell number at P0, resulting in death within 3 days of birth. This suggests that mutations at the p.L235 site of the GABRB3 gene-encoded protein may cause abnormal cell proliferation and differentiation, leading to congenital encephalopathy. This finding enriches the pathogenesis of neuronal developmental defects, provides new biomarkers for clinical screening of neurodevelopmental defects, offers new targets for the prevention and treatment of neurodevelopmental defects, and demonstrates the successful construction of a CE mouse model.

[0135] Example 5: Establishment of a Cell Model for Drug Screening of Congenital Brain Disease

[0136] The process of establishing a cell model is as follows: Figure 5 As shown, the cell line was derived from peripheral blood mononuclear cells from healthy male donors and was reprogrammed to obtain iPSCs. Subsequently, a point mutation was introduced at amino acid position 235 (L235) of the GABRB3 gene using CRISPR / Cas9 technology, changing it from leucine (Leu) to alanine (Ala).

[0137] Verify the correctness of the mutation using Sanger sequencing (e.g.) Figure 6 and Figure 7 (As shown) and the cell line was found to retain typical pluripotent stem cell morphology. Immunofluorescence staining results for differentiation stage markers are shown below. Figure 8 As shown.

[0138] Figure 6 This is a diagram showing the wild-type sequencing results of Example 5 of the present invention; Figure 7 This is a diagram of the mutant sequencing results from Example 5 of the present invention.

[0139] Figure 8 This is an image showing the results of immunofluorescence staining of differentiation stage markers in Example 5 of the present invention.

[0140] from Figure 6 , Figure 7 and Figure 8 It can be seen that DNA sequencing confirmed the correct mutation site in the iPSC cell line. The constructed cell model can stably express pluripotency markers such as NESTIN and SOX2, indicating that its stemness is not affected. This mutant iPSC can further differentiate into neurons, which can be used to study the regulatory mechanism of amino acid 235 (L235) of the GABRB3 gene on neuronal development, as well as the screening and validation of related drugs.

[0141] Figure 9 This is a schematic diagram of the early differentiation results of iPSCs in the L235A mutant group in Example 5 of the present invention; Figure 10 This is a diagram showing the experimental results of drug intervention in Example 5 of the present invention.

[0142] from Figure 9 and Figure 10 It can be seen that during the culture process, the L235A mutant iPSC cell line showed abnormal development, with cells detaching from rosette aggregates at the D18 neural progenitor cell (NPC) stage compared to the WT group; and GABA was added to the GABRB3 L235A mutant iPSCs at D17. A The R-blocker SR95531 can delay the abnormal development of mutant cells detaching from the rosette. The above results indicate that the human L235A mutant iPSC cell model established in this invention can not only simulate the neurodevelopmental defect phenotype caused by the mutation, but also reverse the phenotype through pharmacological intervention. Therefore, it can be used as a humanized cell model for in vitro drug screening and has important application value in the drug development of epilepsy and related neurodevelopmental congenital brain diseases.

[0143] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A cell model of a neurodevelopmental disease, wherein, the cell model comprises a GABRB3 gene point mutation, and the point mutation is a mutation from encoding leucine at position 235 to encoding alanine.

2. A GABA A A method for constructing a cell model of a neurodevelopmental disease caused by a gain-of-function mutation of R, the method comprising: providing an ex vivo human neural stem cell; introducing a point mutation in the GABRB3 gene of the ex vivo human neural stem cell by a gene editing technology, and the point mutation is a mutation from encoding leucine at position 235 to encoding alanine. 3.The construction method of claim 2, wherein the gene sequence of the mutated GABRB3 gene is shown in SEQ ID No.

1. 4.A construction method of an animal model of a neurodevelopmental disease, the method comprising: providing a target animal; introducing a homozygous mutation in the GABRB3 gene of the target animal by a gene editing technology, and the homozygous mutation is a GABRB3 p.L235A point mutation.

5. The construction method of claim 4, wherein, the target animal is a non-human mammal; preferably, the non-human mammal is selected from any one of a mouse, a rat, a horse, a pig, a monkey, a dog, and an ape. 6.The construction method of claim 5, wherein, the target animal is a mouse. 7.The construction method of claim 3 or 5, wherein, the gene editing technology is selected from at least one of a CRISPR / Cas9 technology, a ZFN technology, and a TALEN technology, preferably the CRISPR / Cas9 technology.

8. The neurodevelopmental disease cell model of claim 1, the neurodevelopmental disease animal model of claim 2 or 7, wherein, the neurodevelopmental disease is developmental and epileptic encephalopathy. 9.Use of the cell model of a neurodevelopmental disease of claim 1 in screening a therapeutic drug for a neurodevelopmental disease. 10.Use of a GABRB3 mutant gene in preparing a reagent for diagnosing a human neurodevelopmental disease, wherein the GABRB3 mutant gene is a GABRB3 gene with a point mutation, and the point mutation is a mutation from encoding leucine at position 235 to encoding alanine, preferably the gene sequence of the GABRB3 mutant gene is shown in SEQ ID No. 1.