Genetically engineered bacteriophage hydrogel for fat ablation treatment as well as preparation method and application of genetically engineered bacteriophage hydrogel
The genetically engineered M13 phage hydrogel, utilizing adipocyte targeting sequences and the pro-apoptotic protein Bax, addresses the safety concerns and insufficient precision of existing localized fat reduction techniques, achieving safe and efficient adipocyte removal.
Patent Information
- Application Number
- CN202511892658.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-16
- Publication Date
- 2026-03-10
AI Technical Summary
Existing localized fat reduction techniques have safety risks (such as viral vectors triggering immune responses and off-target infections) and insufficient precision, leading to side effects and the risk of weight regain.
Using genetically engineered M13 phage, an adipocyte-targeting sequence ATS was inserted into its capsid protein, and the gene encoding the pro-apoptotic protein Bax was integrated to prepare a phage hydrogel for targeting adipocytes and inducing apoptosis.
It achieves efficient and safe specific identification and removal of adipocytes, reduces inflammatory response and tissue damage, and improves treatment safety and compliance.
Smart Images

Figure CN121628849A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of bacteriophages, and particularly relates to a genetically engineered bacteriophage hydrogel for fat ablation treatment and a preparation method and application thereof. BACKGROUND
[0002] Local fat accumulation, such as abdominal obesity and subcutaneous fat masses, is not only an important factor affecting the appearance, but also closely related to the occurrence and development of many metabolic diseases. At present, the demand for local fat reduction in the clinical and cosmetic fields is increasing, which has promoted the development and application of various technologies.
[0003] The current mainstream technical means mainly include physical therapy and injection therapy. Physical therapy such as cryolipolysis, radiofrequency and ultrasound, etc. is mainly through extreme temperature or physical energy to induce fat cell necrosis; and injection therapy (such as fat-dissolving needles) mainly injects deoxycholic acid, phosphatidylcholine and other chemical drugs to damage the fat cell membrane, also leading to necrotic death of cells. However, these existing technologies generally have the following inherent defects: the range of action is difficult to accurately control, and normal tissues (such as skin, muscle, nerve) around the target area are easily damaged, resulting in side effects such as pain, swelling, and burns. Since all of them remove fat by inducing cell necrosis, a large amount of cell contents will be released, causing significant acute inflammatory reactions, and further leading to long-term complications such as tissue fibrosis and induration, long recovery period and poor experience for patients. At the same time, the above methods can only temporarily reduce the volume of fat cells or remove part of the fat cells, but cannot reduce the number of fat cells from the root, so there is a high risk of obesity, and the curative effect is difficult to maintain.
[0004] In the more advanced field of gene therapy, some studies have tried to use viral vectors (such as adenovirus, lentivirus) to deliver pro-apoptotic genes to fat cells, in order to achieve more accurate and complete removal by starting the internal apoptosis program of cells. However, such mammalian viral vectors have serious safety hazards: the viral vector itself and the exogenous proteins it carries can easily cause the body's strong immune rejection reaction, leading to treatment failure and possibly endangering patient safety. Moreover, the specific recognition ability of the viral vector to fat cells is limited, and off-target infection is easy to occur, which can mistakenly damage other normal tissue cells, limiting its clinical application. SUMMARY
[0005] The present application aims to provide a genetically engineered bacteriophage hydrogel for fat ablation treatment and a preparation method and application thereof, in order to solve the problem of the existing current local fat reduction by using viral vectors to deliver pro-apoptotic genes to remove fat cells, but these carriers have safety hazards (such as possible integration, strong immune reaction, and insufficient targeting accuracy to mistakenly damage normal cells, which hinders their application.
[0006] To achieve the above object, the present application provides the following technical solutions.
[0007] An engineered bacteriophage for fat ablation therapy, the bacteriophage is a M13 bacteriophage with a fat cell targeting sequence ATS inserted in gene VIII of the M13 bacteriophage, and a coding gene of a pro-apoptotic protein Bax integrated in the genome of the M13 bacteriophage; wherein the nucleotide sequence of the fat cell targeting sequence ATS is TGTAAAGGTGGCCGTGCTAAAGACTGT.
[0008] Preferably, the coding gene of the pro-apoptotic protein Bax is an ORF with the sequence shown in SEQ ID NO: 1.
[0009] A method for constructing an engineered M13 bacteriophage, comprising the following steps:
[0010] 1) Constructing a M13-ATS plasmid: using site-directed mutagenesis technology, the ATS sequence is inserted into gene VIII of the M13 bacteriophage plasmid;
[0011] 2) Constructing a M13-ATS-Bax plasmid: by homologous recombination or enzyme digestion and ligation, the ORF sequence of the Bax is inserted into the M13-ATS plasmid obtained in step 1);
[0012] 3) Obtaining and purifying the bacteriophage: the M13-ATS-Bax plasmid obtained in step 2) is transformed into a competent cell, and after cultivation, amplification, centrifugation and PEG purification, the purified engineered M13 bacteriophage is obtained.
[0013] A bacteriophage hydrogel, a constructed bacteriophage, and a sodium alginate hydrogel matrix wrapping the bacteriophage, the sodium alginate hydrogel matrix is made by mixing and cross-linking a sodium alginate aqueous solution with a concentration of 2.5 wt% to 4 wt% and a calcium gluconate aqueous solution with an equal concentration range in a volume ratio of 2:1 to 4:1.
[0014] A method for preparing a bacteriophage hydrogel, comprising the following steps: preparing a sodium alginate aqueous solution with a concentration of 2.5 wt% to 4 wt%; preparing a calcium gluconate aqueous solution with a concentration of 2.5 wt% to 4 wt%; under stirring conditions, the calcium gluconate solution is added to the sodium alginate solution in a volume ratio of 1:2 to 1:4, and the stirring is continued to form a hydrogel; the purified engineered M13 bacteriophage is mixed with the obtained hydrogel in a volume ratio of 1:2 to 1:4 to prepare the bacteriophage hydrogel composite material.
[0015] The bacteriophage hydrogel material is used for preparing a drug or a cosmetic preparation for local fat reduction, and the local fat reduction drug is achieved by inducing apoptosis of fat cells.
[0016] Compared with the prior art, the present application has the following advantages:
[0017] The present application uses genetically engineered M13 bacteriophage as a vector, by precisely inserting adipocyte targeting sequence (ATS) in its coat protein (gene VIII), it is endowed with the ability to actively recognize and specifically bind to the membrane surface receptors of adipocytes. At the same time, M13 bacteriophage is a virus that only infects bacteria, absolutely safe to human cells, does not infect, replicate, and integrate into the human genome, completely avoiding the potential carcinogenic risk of traditional mammalian viral vectors. At the same time, the present application is to express pro-apoptotic protein Bax in adipocytes by bacteriophage, to start the programmed cell death (i.e. apoptosis) pathway from the inside. It does not cause cell membrane rupture and content leakage, so it does not cause severe inflammatory reactions like cell necrosis. This significantly reduces post-treatment adverse reactions such as pain, redness, and tissue fibrosis, and patients recover faster and have a better experience.
[0018] The present application creatively uses recombinant bacteriophage-loaded sodium alginate hydrogel as a local sustained-release system, which can release biologically active genetically engineered bacteriophage slowly and long-term, allowing it to act on surrounding adipocytes continuously. This greatly improves the convenience of treatment and patient compliance. At the same time, the gene carried by the bacteriophage is transiently expressed rather than permanently integrated, and its effect is controllable and self-limiting, further enhancing the safety of treatment. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 M13 plasmid map of the present application;
[0020] Figure 2 M13-ATS-Bax plasmid map of the present application;
[0021] Figure 3 Western Blot detection results of M13-ATS-Bax bacteriophage hydrogel promoting Bax protein expression in adipocytes. DETAILED DESCRIPTION
[0022] The technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.
[0023] Example 1:
[0024] Construction of targeted pro-apoptotic bacteriophage plasmid M13-ATS-Bax
[0025] 1. Material Preparation
[0026] Strains and plasmids: M13 phage original bacteria liquid, E. coli ER2738 competent cells.
[0027] Kit: MolPure® Plasmid Mini Kit, Novagen Mut Express Universal Fast Mutagenesis Kit, DNA gel recovery kit.
[0028] Primers: Specific primers were designed and synthesized according to the adipocyte targeting sequence ATS (TGTAAAGGTGGCCGTGCTAAAGACTGT) and the pro-apoptotic gene Bax (mouse origin, ORF sequence shown in SEQ ID NO: 1), both synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd.
[0029] Culture medium: LB liquid medium, LB solid plate (containing tetracycline antibiotic).
[0030] 2. M13 original plasmid extraction
[0031] 10 μL of M13 phage bacteria liquid was inoculated into 10 mL of LB medium and cultured at 37°C with 220 rpm shaking for 12 hours. Then, using MolPure® Plasmid Mini Kit, the plasmid extraction was performed according to the instructions, and finally 50 μL of eluent was used to obtain high-purity M13 original plasmid DNA, which was stored at -20°C for standby.
[0032] 3. Construction of targeting plasmid M13-ATS
[0033] Using the extracted M13 original plasmid as a template, the ATS sequence was inserted into M13 gene VIII by using the primer pair shown below using the site-directed mutagenesis kit.
[0034] Primer sequences for constructing M13-ATS
[0035] Primer name ATS-forward aaggtggccgtgctaaagactgtGCTGAGGGTGACGATCCCG
[0036] Primer name ATS-reverse tttagcacggccacctttacaAGCGAAAGACAGCATCGGAA
[0037] PCR reaction system and procedure refer to the kit instruction. PCR amplification: using Novozyme MutExpress Universal Fast Mutagenesis Kit, extracted M13 plasmid as template, PCR amplification, introduce ATS sequence. Reaction procedure: 95℃ pre-denaturation 3 minutes; 35 cycles (95℃ denaturation 15 seconds, 68℃ annealing 15 seconds, 72℃ extension 5 minutes); 72℃ thorough extension 7 minutes.
[0038] DpnI digestion: PCR product is treated with DpnI enzyme to degrade the template plasmid, incubated at 37℃ for 90 minutes.
[0039] Gel recovery purification: after digestion, the product is subjected to agarose gel electrophoresis, the target band is cut and the linear DNA fragment is purified using a gel recovery kit.
[0040] In vitro recombination and circularization: under the catalysis of Exnase II, the purified linear DNA fragment is subjected to efficient recombination and circularization, 37℃ reaction for 30 minutes, to obtain the circularized M13-ATS plasmid.
[0041] Transformation and verification: the recombination product is transformed into competent cells, coated on LB plate containing corresponding antibiotic, and cultured at 37℃ for 12 hours. After single colony is picked and expanded, the plasmid is extracted for sequencing verification. The plasmid with correct sequencing is the required M13-ATS plasmid.
[0042] The pro-apoptotic plasmid M13-ATS-Bax was constructed to amplify the complete ORF sequence of Bax gene by high-fidelity PCR using the following primers with mouse cDNA as template. The pro-apoptotic gene Bax (ORF sequence: atgaagacaggggcctttttgctacagggtttcatccaggatcgagcagggaggatggctggggagacacctgagctgaccttggagcagccgccccaggatgcgtccaccaagaagctgagcgagtgtctccggcgaattggagatgaactggacagcaatatggagctgcagaggatgattgctgacgtggacacggactccccccgagaggtcttcttccgggtggcagctgacatgtttgctgatggcaacttcaactggggccgcgtggttgccctcttctactttgctagcaaactggtgctcaaggccctgtgcactaaagtgcccgagctgatcagaaccatcatgggctggacactggacttcctccgtgagcggctgcttgtctggatccaagaccagggtggctgggaaggcctcctctcctacttcgggacccccacatggcagacagtgaccatctttgtggctggagtcctcaccgcctcgctcaccatctggaagaagatgggctga) was inserted into M13-ATS plasmid, and the phage would express Bax protein efficiently, targeting to promote adipocyte apoptosis.
[0043] Primer name Bax-forward ctagtactggatccactacgATGAAGACAGGGGCCTTTTTG
[0044] Primer name Bax-reverse ttttacttgtcgactatacgTCAGCCCATCTTCTTCCAGATG
[0045] The specific steps are as follows:
[0046] Bax gene ORF sequence amplification: Prepare a 50 μL PCR reaction system containing 25 μL of 2×Taq Master Mix, 1 ng of mouse cDNA, 2 μL of Bax-forward primer, 2 μL of Bax-reverse primer, and make up the remaining volume with ddH2O; the reaction program is set to 35 cycles, with pre-denaturation at 95℃ for 3 min, followed by denaturation at 95℃ for 15 s, annealing at 60℃ for 15 s, extension at 72℃ for 1 min, and a final extension at 72℃ for 7 min;
[0047] Gel recovery of Bax amplification products: Perform gel recovery according to the method in step 4 of 3.1.2 to obtain purified DNA fragments containing Bax ORF sequences;
[0048] M13-ATS plasmid digestion: Prepare a 50 μL digestion system containing 2 μg of M13-ATS plasmid, 2 μL of MluI restriction enzyme, and 5 μL of 10× Buffer R. Make up the remaining volume with ddH2O. After incubation at 37°C for 2 h, purify the fragment using the gel extraction method described above to obtain the linearized M13-ATS plasmid fragment.
[0049] Homologous recombination: Prepare a 20 μL recombination system containing 50 ng of Bax ORF sequence DNA fragment, 200 ng of linearized M13-ATS plasmid fragment, 4 μL of 5×CE II Buffer, and 2 μL of Exnase II. Make up the remaining volume with ddH2O. Incubate at 37°C for 30 min and then immediately cool on ice. The product is the M13-ATS-Bax plasmid.
[0050] Recombinant product conversion: Perform the conversion according to step 6 in section 3.1.2;
[0051] Recombinant product identification: After picking a single clone and shaking it for 4 hours, it was sent to Sangon Biotech for sequencing. The bacterial culture with the correct sequencing results was selected as the phage strain containing the M13-ATS-Bax plasmid.
[0052] Amplification and purification of M13-ATS-Bax phage
[0053] The correctly sequenced M13-ATS-Bax engineered bacteria were inoculated into 200 mL of LB medium (containing tetracycline) at a ratio of 1:1000, and 2 mL of ER2738 host bacteria in the logarithmic growth phase (OD600 ≈ 0.6) were added at the same time.
[0054] Incubate at 37°C and 220 rpm with vigorous shaking for 18 hours to allow for sufficient phage amplification. Centrifuge the culture at 4°C and 7500 rpm for 15 minutes, carefully collect the supernatant, and filter through a 0.22 μm filter to remove residual cells. Add 1 / 4 volume of NaCl / PEG-6000 precipitation buffer (containing 20% PEG-6000 and 2.5 M NaCl) to the supernatant, gently mix, and incubate overnight at 4°C to allow for complete phage precipitation. The next day, centrifuge at 4°C and 12000 rpm for 20 minutes, discard the supernatant, and obtain the phage precipitate. Gently resuspend the precipitate in 1 mL of PBS buffer (pH 7.4), then centrifuge at 4°C and 8000 rpm for 5 minutes, and collect the supernatant to remove insoluble impurities. Add 1 / 4 volume of NaCl / PEG-6000 to the supernatant again, incubate on ice for 1 hour, and then centrifuge at 4°C and 12000 rpm for 15 minutes. Discard the supernatant and resuspend the final precipitate with an appropriate amount of PBS buffer to obtain a high-purity, concentrated M13-ATS-Bax phage stock solution. After aliquoting, store at 4°C or -80°C.
[0055] Preparation of M13-ATS-Bax phage-hydrogel composite material
[0056] Accurately weigh 231.95 mg of sodium alginate, dissolve it in 7.5 mL of ultrapure water, and stir magnetically until completely dissolved to obtain a clear, viscous solution with a concentration of 3 wt% ①.
[0057] Accurately weigh 77.32 mg of calcium gluconate, dissolve it in 2.5 mL of ultrapure water, and vortex until completely dissolved to obtain a solution with a concentration of 3 wt% ②.
[0058] Under continuous magnetic stirring, solution ② is slowly and evenly added to solution ① using a syringe, with a volume ratio of 1:3.
[0059] Continue stirring for 10 minutes. The solution will gradually thicken and form a uniform, transparent calcium alginate hydrogel (Gel).
[0060] Take 1 mL of the M13-ATS-Bax phage stock solution prepared in Example 2 and gently stir it with 3 mL of the freshly prepared hydrogel in a sterile container to mix evenly, avoiding the generation of air bubbles.
[0061] Approximately 4 mL of M13-ATS-Bax phage-hydrogel composite material was obtained. This material can be stably stored at 4°C for later use in local injection.
[0062] In vitro efficacy verification of M13-ATS-Bax phage hydrogel
[0063] To verify the adipocyte apoptosis-inducing effect of the material of the present invention, the following in vitro experiments were conducted:
[0064] Cell culture: Mouse preadipocyte line 3T3-L1 was cultured using a standard induction differentiation protocol (medium containing insulin, dexamethasone, and IBMX) to fully differentiate it into mature adipocytes.
[0065] Experimental Groups:
[0066] Experimental group: M13-ATS-Bax phage-hydrogel composite material extract was added to differentiated and mature adipocytes.
[0067] Negative control group: PBS or empty hydrogel were added.
[0068] Blank control group: No treatment was performed.
[0069] Detection and Results: After 24-48 hours of treatment, the expression level of Bax protein in cells was detected by Western blotting. Results are as follows: Figure 3 As shown, the expression level of Bax protein in the adipocytes of the experimental group was significantly higher than that in the two control groups.
[0070] Conclusion: These results demonstrate that M13-ATS-Bax phage can successfully infect adipocytes and efficiently express the pro-apoptotic protein Bax, thereby initiating the apoptosis program. Even after being bound to a hydrogel, the active ingredients are still effectively released and exert their effects, proving that the composite material described in this invention has a significant ability to kill adipocytes.
[0071] It should be understood that numerous specific implementation decisions can be made during the development of any practical implementation, such as in any engineering or design project. Such development efforts may be complex and time-consuming, but for those skilled in the art who benefit from this disclosure, the development effort will be a routine work of design, manufacturing, and production without requiring much experimentation.
[0072] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A genetically engineered bacteriophage for use in fat ablation therapy, characterized in that, The phage is a M13 phage with a fat cell targeting sequence ATS inserted in gene VIII of the M13 phage, and a coding gene of a pro-apoptosis protein Bax integrated in the genome of the M13 phage; wherein the nucleotide sequence of the fat cell targeting sequence ATS is TGTAAAGGTGGCCGTGCTAAAGACTGT.
2. The M13 bacteriophage of claim 1, wherein: The coding gene of the pro-apoptosis protein Bax is an ORF with the sequence shown in SEQ ID NO:
1.
3. A method of constructing genetically engineered M13 bacteriophage for fat ablation therapy according to any one of claims 1-2, characterized in that, The method comprises the following steps: 1) Constructing a M13-ATS plasmid: using a site-directed mutagenesis technique, the ATS sequence is inserted into gene VIII of a M13 phage plasmid; 2) Constructing a M13-ATS-Bax plasmid: by homologous recombination or enzyme digestion and ligation, the ORF sequence of the Bax is inserted into the M13-ATS plasmid obtained in step 1); 3) Obtaining and purifying the phage: the M13-ATS-Bax plasmid obtained in step 2) is transformed into a competent cell, and after cultivation, amplification, centrifugation and PEG purification, a purified genetically engineered M13 phage is obtained.
4. A bacteriophage hydrogel, characterized in that: The phage constructed by the construction method of claim 3, and a sodium alginate hydrogel matrix wrapping the phage.
5. The bacteriophage hydrogel of claim 4, wherein, The sodium alginate hydrogel matrix is prepared by mixing and cross-linking a sodium alginate aqueous solution with a concentration of 2.5 wt% to 4 wt% and a calcium gluconate aqueous solution with an equal concentration range at a volume ratio of 2:1 to 4:
1.
6. The method of claim any one of claims 4-5, wherein the bacteriophage hydrogel is prepared by: The method comprises the following steps: Preparation of a sodium alginate aqueous solution with a concentration of 2.5 wt% to 4 wt%; preparation of a calcium gluconate aqueous solution with a concentration of 2.5 wt% to 4 wt%; under stirring conditions, the calcium gluconate solution is added dropwise to the sodium alginate solution at a volume ratio of 1:2 to 1:4, and continuous stirring forms a hydrogel; the purified genetically engineered M13 phage is mixed with the obtained hydrogel at a volume ratio of 1:2 to 1:4 to prepare the phage hydrogel composite material.
7. Use of the phage hydrogel material of claim 4 in the preparation of a drug or a cosmetic preparation for local fat reduction.
8. Use of a bacteriophage hydrogel material according to claim 7, wherein, The local fat reduction drug is achieved by inducing apoptosis of fat cells.