Novel hyaluronidase and preparation method of hyaluronic acid with specific molecular weight
By mutating the amino acid sequence of hyaluronidase and optimizing the enzymatic hydrolysis reaction conditions, the problems of low enzyme activity and poor stability were solved, and high-precision control was achieved for the efficient preparation of hyaluronic acid of specific molecular weights, especially ultra-low molecular weight products of 10 kDa.
Patent Information
- Application Number
- CN202511932760.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-19
- Publication Date
- 2026-03-10
AI Technical Summary
Existing technologies for preparing hyaluronic acid of specific molecular weights suffer from problems such as low enzyme activity, poor stability, and uncontrollable molecular weight of degradation products, resulting in high energy consumption, high costs, and serious environmental pollution during the production process.
A novel hyaluronidase was developed by specifically mutating the amino acid sequence of wild-type hyaluronidase, and hyaluronic acid of a specific molecular weight was prepared by enzymatic hydrolysis. Escherichia coli BL21(DE3) was used as the host cell, and the enzymatic hydrolysis reaction conditions, including parameters such as temperature, pH and enzyme amount, were optimized.
It increased the specific enzyme activity by nearly 2.4 times, achieved high-precision control of molecular weight distribution, and prepared hyaluronic acid with a specific molecular weight distribution range with a narrow range, especially the hard-to-obtain 10 kDa ultra-low molecular weight product, which has high pH and temperature stability.
Smart Images

Figure CN121628880A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of bioengineering and enzyme engineering, and particularly relates to a novel hyaluronidase and a preparation method of specific molecular weight hyaluronic acid. BACKGROUND
[0002] Hyaluronic acid is a natural glycosaminoglycan widely existing in the human body. Due to its excellent water retention, lubrication and biocompatibility, it is widely used in medicine (such as ophthalmic surgery, arthritis treatment), cosmetics (moisturizing agent) and functional food. Hyaluronic acid with different molecular weights has different biological functions and application values. For example, high molecular weight HA (>1000 kDa) has strong moisturizing and barrier functions; medium molecular weight HA (100-1000 kDa) is used for lubrication and space filling; low molecular weight HA (10-100 kDa) has anti-inflammatory, pro-angiogenic and other activities; and ultra-low molecular weight HA (<10 kDa) shows the potential to promote wound healing and enhance immune response.
[0003] At present, the industrial production of specific molecular weight HA mainly depends on physical methods (such as thermal degradation, ultrasonic degradation) or chemical methods (such as acid hydrolysis, oxidative degradation). These methods have many shortcomings: 1. Poor specificity: the degradation process is difficult to control, the product molecular weight distribution range is wide, and the uniformity is low.
[0004] 2. Severe conditions: usually need to be carried out under high temperature, strong acid or strong oxidation conditions, which may cause HA structure damage, introduce impurities, and produce environmental pollution.
[0005] 3. High energy consumption: high energy consumption and high cost in production process.
[0006] Enzymatic hydrolysis using hyaluronidase is an ideal alternative because of its mild reaction conditions, strong specificity and environmental protection. However, naturally derived hyaluronidases (such as from bovine testis or microorganisms) often have low enzyme activity, poor stability (especially thermal stability), and uncontrollable degradation product molecular weight range, which limits their industrial application.
[0007] Therefore, there is an urgent need in the art for a novel hyaluronidase with high activity, high stability, and the ability to precisely control the molecular weight of the degradation product, which can be used to prepare hyaluronic acid with good stability and controllable molecular weight through enzymatic hydrolysis. SUMMARY
[0008] The present application provides a novel hyaluronidase and a preparation method of specific molecular weight hyaluronic acid to solve the problems in the related art. The technical solution is as follows: In a first aspect, the embodiments of the present application provide a novel hyaluronidase, which comprises an amino acid sequence as follows: The amino acid sequence shown in SEQ ID No. 1 has at least one mutation site in N266R, K349R, S180P, V417I and T488A.
[0009] In an embodiment, the novel hyaluronidase comprises an amino acid sequence as shown in SEQ ID No. 2.
[0010] In a second aspect, the embodiments of the present application provide a nucleotide, which encodes the novel hyaluronidase described above.
[0011] In an embodiment, the sequence of the nucleotide molecule is shown in SEQ ID No. 3.
[0012] In a third aspect, the embodiments of the present application provide a recombinant plasmid, which comprises the nucleotide described above.
[0013] In an embodiment, the plasmid vector is PH20-pET-30a(+).
[0014] In a fourth aspect, the embodiments of the present application provide a high-efficiency expression host cell, which comprises the nucleotide described above; or the recombinant plasmid described above.
[0015] In an embodiment, the high-efficiency expression host cell is Escherichia coli BL21(DE3).
[0016] In a fifth aspect, the embodiments of the present application provide a preparation method of hyaluronic acid with a specific molecular weight, which utilizes the novel hyaluronidase described above to degrade high-molecular-weight hyaluronic acid through an enzymatic reaction, so as to obtain the hyaluronic acid with the specific molecular weight.
[0017] In an embodiment, the hyaluronic acid with the specific molecular weight has a molecular weight ranging from 1 kDa to 120 kDa. In an embodiment, the hyaluronic acid has a molecular weight of 10 kDa or 100 kDa.
[0018] The advantages or beneficial effects of the above technical solutions at least include: The hyaluronidase of the present application is based on wild-type hyaluronidase, and the mutation of the site related to enzyme activity and stability is carried out, so that the specific enzyme activity of the mutant hyaluronidase of the present application is increased by nearly 2.4 times compared with the wild type. And by using the mutant enzyme of the present application, by simply adjusting the reaction time, temperature, enzyme amount and other parameters, specific molecular weight hyaluronic acid with narrow molecular weight distribution range (polydispersity coefficient PDI can be less than 1.5) can be prepared with high precision, especially 10 kDa ultra-low molecular weight product which is difficult to obtain; The product has high quality, high pH and temperature stability; and provides a use basis for the wide application of hyaluronic acid.
[0019] The above summary is intended to illustrate only and is not intended to limit the application in any way. Further aspects, implementations, and features of the application will be apparent from the drawings and the following detailed description. BRIEF DESCRIPTION OF DRAWINGS
[0020] In the drawings, like reference numerals refer to like elements throughout the various drawings. The drawings are not necessarily to scale, the emphasis instead being placed upon illustrating the principles of the application. It should be understood that the drawings are merely depictions of some embodiments of the application and should not be construed as limiting the scope of the application.
[0021] Figure 1 Map of recombinant expression vector PH20-pET-30b(+) for E. coli Figure 2 Map of enzyme digestion verification of recombinant plasmid of positive clone Figure 3 Sds-page electrophoresis detection result map of unpurified recombinant hyaluronidase Figure 4 Sds-page electrophoresis detection result map of recombinant hyaluronidase after purification DETAILED DESCRIPTION
[0022] In the following, only some exemplary embodiments are described in brief. As will be appreciated by those skilled in the art, the described embodiments can be modified in various different ways without departing from the spirit or scope of the application. The drawings and the description are therefore to be considered in an illustrative, rather than a restrictive, sense.
[0023] The present application provides a new type of hyaluronidase, which comprises an amino acid sequence as follows: There are at least one mutation sites in N266R, K349R, S180P, V417I and T488A in the amino acid sequence shown in SEQ ID No. 1.
[0024] The amino acid sequence shown in SEQ ID No. 1 is a wild-type hyaluronidase. Based on the wild-type hyaluronidase amino acid sequence, the present application selects a mutation site that plays a key role in enzyme activity and stability, mutates at least one site, and obtains a mutant hyaluronidase.
[0025] As one of the embodiments, the mutation site that plays a key role in enzyme activity and stability is N266R; K349R; S180P; V417I or T488A.
[0026] As one of the embodiments, the present application mutates at least one of N266R; K349R; S180P; V417I or T488A in SEQ ID No. 1; so that the specific activity of the mutant hyaluronidase is significantly higher than that of the wild-type hyaluronidase. Preferably, the above five sites are simultaneously mutated.
[0027] As one of the embodiments, the above five sites are simultaneously mutated, and the amino acid sequence of the mutant hyaluronidase after mutation is shown in SEQ ID No. 2.
[0028] The present application also provides a nucleotide encoding the above-mentioned new type of hyaluronidase; further, the nucleotide is shown in SEQ ID No. 3.
[0029] The present application also provides an expression vector carrying the above-mentioned nucleic acid molecule, which is a recombinant plasmid containing the above-mentioned nucleotide.
[0030] The present application also provides a host cell expressing the above-mentioned new type of hyaluronidase. The host cell is selected from E. coli BL21 (DE3) competent cells.
[0031] The present application also provides a preparation method of a specific molecular weight hyaluronic acid, which utilizes the above-mentioned new type of hyaluronidase to degrade high molecular weight hyaluronic acid through enzymatic reaction to obtain the specific molecular weight hyaluronic acid.
[0032] In the present embodiment, the ratio of the new type of hyaluronidase to the high molecular weight hyaluronic acid in the enzymatic reaction is 0.1-100 U / g substrate.
[0033] In the present embodiment, the temperature of the enzymatic reaction is 30-70℃, the reaction pH is 5.0-7.5; the reaction time is 0.5-24h.
[0034] As one of the embodiments, the specific molecular weight hyaluronic acid has a molecular weight range of 1 kDa to 120 kDa. Preferably, the molecular weight of the hyaluronidase is 10 kDa, 100 kDa.
[0035] Example 1 The protein sequence of human hyaluronidase SEQ ID NO: 1 was retrieved in the uniprot database.
[0036] The SEQ ID No. 1 is: MGVLKFKHIFFRSFVKSSGVSQIVFTFLLIPCCLTLNFRAPPVIPNVPFLWAWNAPSEFCLGKFDEPLDMSLFSFIGSPRINATGQGVTIFYVDRLGYYPYIDSITGVTVNGGIPQKISLQDHLDKAKKDITFYMPVDNLGMAVIDWEEWRPTWARNWKPKDVYKNRSIELVQQQNVQLSLTEATEKAKQEFEKAGKDFLVETIKLGKLLRPNHLWGYYLFPDCYNHHYKKPGYNGSCFNVEIKRNDDLSWLWNESTALYPSIYLNTQQSPVAATLYVRNRVREAIRVSKIPDAKSPLPVFAYTRIVFTDQVLKFLSQDELVYTFGETVALGASGIVIWGTLSIMRSMKSCLLLDNYMETILNPYIINVTLAAKMCSQVLCQEQGVCIRKNWNSSDYLHLNPDNFAIQLEKGGKFTVRGKPTLEDLEQFSEKFYCSCYSTLSCKEKADVKDTDAVDVCIADGVCIDAFLKPPMETEEPQIFYNASPSTLSATMFIVSILFLIISSVASL.
[0037] The present application is mutated in SEQ ID No. 1 N266R; K349R; S180P; V417I or T488A; A new hyaluronidase is designed, the sequence is shown as SEQ ID NO: 2.
[0038] SEQ ID No. 2: MGVLKFKHIFFRSFVKSSGVSQIVFTFLLIPCCLTLNFRAPPVIPNVPFLWAWNAPSEFCLGKFDEPLDMSLFSFIGSPRINATGQGVTIFYVDRLGYYPYIDSITGVTVNGGIPQKISLQDHLDKAKKDITFYMPVDNLGMAVIDWEEWRPTWARNWKPKDVYKNRSIELVQQQNVQLPLTEATEKAKQEFEKAGKDFLVETIKLGKLLRPNHLWGYYLFPDCYNHHYKKPGYNGSCFNVEIKRNDDLSWLWNESTALYPSIYLRTQQSPVAATLYVRNRVREAIRVSKIPDAKSPLPVFAYTRIVFTDQVLKFLSQDELVYTFGETVALGASGIVIWGTLSIMRSMRSCLLLDNYMETILNPYIINVTLAAKMCSQVLCQEQGVCIRKNWNSSDYLHLNPDNFAIQLEKGGKFTIRGKPTLEDLEQFSEKFYCSCYSTLSCKEKADVKDTDAVDVCIADGVCIDAFLKPPMETEEPQIFYNASPSALSATMFIVSILFLIISSVASL.
[0039] According to the design, a new hyaluronidase nucleotide sequence is obtained, and the codon is optimized according to the codon preference of E. coli, and the obtained gene sequence is named C7; the nucleotide sequence is shown as SEQ ID No. 3.
[0040] SEQ ID No. 3:
[0041] Example 2, Construction and purification of a new recombinant hyaluronidase high expression engineering bacteria The present embodiment provides a method for constructing a high expression engineering bacteria, comprising the following steps: 1) Construction of E. coli recombinant expression vector: After adding enzyme cutting sites Nde I and Xho I to both ends of the optimized C7 sequence, the whole gene was synthesized and cloned into E. coli expression vector pET-30b (+) to obtain E. coli recombinant expression vector PH20-pET-30b (+) (schematic diagram as shown in Figure 1 ).
[0042] 2) Plasmid transformation; First, prepare E. coli LTHINK (DE3) competent bacteria: ① Pick a single colony of E. coli and inoculate it into 5 mL of LB liquid medium without antibiotics and incubate it at 37°C for 13 h with shaking until the late logarithmic growth phase. Then inoculate the bacterial suspension into 100 ml of LB liquid medium at a ratio of 1:50 and incubate it at 37°C for 2-3 h with shaking until the OD 600 = 0.5; ② Under sterile conditions, transfer the culture medium into a centrifuge tube, place it on ice for 10 min to cool the culture to 0°C, then centrifuge it at 4°C at 4000 rpm for 10 min; ③ Discard the supernatant and invert it for 1 min to allow the culture medium to flow out; ④ Gently suspend the cells with 10 mL of ice-precooled 0.1 mol / L CaCl2 solution, mix thoroughly, and place it on ice for 30 min, then centrifuge it at 4°C at 4000 rpm for 10 min; ⑤ Discard the supernatant and invert it for 1 min to allow the last trace of culture medium to flow out; ⑥ Add 4 mL of pre-cooled 0.1 mol / L CaCl2 solution containing 15% glycerol, gently suspend the cells, and place it on ice for a few minutes to obtain the competent cell suspension; ⑦ Divide 100 μL of E. coli BL21 (DE3) competent cells and store them at -70°C for future use.
[0043] Transformation: ① Take one tube (100 μl) of LTHINK (DE3) competent bacteria from the ultra-low temperature freezer at -80°C, melt it, and insert it into ice, and place it in an ice bath for 5-10 min.
[0044] ② Add 50 ng of the constructed E. coli recombinant expression vector PH20-pET-30b (+), gently shake, and then place it on ice for 30 min.
[0045] ③After shaking gently, insert into 42℃ water bath for 1-2 min for heat shock, then put back into ice quickly, stand for 3-5 min.
[0046] ④In the clean bench, add 800 μl LB medium (without antibiotic) into each tube respectively, shake gently, then fix on the spring frame of the shaker, shake at 37℃ for 1 h.
[0047] ⑤In the clean bench, take 100-300 μl of the above transformation mixture, drop into solid LB plates containing appropriate antibiotic respectively, and spread evenly with a glass spreader burned by alcohol lamp.
[0048] ⑥Label the spread plates, first place in 37℃ incubator for 30-60 min until the liquid on the surface penetrates into the medium, then put upside down into 37℃ incubator overnight.
[0049] 3) Screening of positive clones: The recombinant quality of positive clones was verified by enzyme digestion map. The used endonuclease was MluI and XhoI, and the reaction system was shown in Table 1: Table 1
[0050] The reaction condition was 37℃, reaction for 30 min. The detection was carried out by 1% agarose gel electrophoresis, as shown in Figure 2 .
[0051] Figure 2 The recombinant plasmid of positive clones can be verified. Among them, Figure 2 1 indicates: DNA of the uncut recombinant expression vector PH20-pET-30b (+); Figure 2 2 indicates: Plasmid digested by MluI and XhoI; Figure 2 M indicates: DNA Marker.
[0052] 4) PCR positive clone verification: The single colony grown on the plate after 37℃ overnight culture after transformation was inoculated into 10 mL LB liquid medium, and the antibiotic was added, and the culture was incubated at 37℃ overnight. Whether it is a positive clone was identified by broth PCR. The broth PCR system was shown in Table 2: Table 2
[0053] Forward primer: GATTAAAAAGGCGGCGAACAAA (SEQ ID NO: 4); Reverse primer: TCAAAGCCTTCTTTCGGGCT (SEQ ID NO: 5).
[0054] PCR program as follows: initial denaturation 94°C, 4 min; denaturation 94°C, 30 s, 34 cycles; annealing 50-54°C, 30 s; extension 72°C 30 s; end extension 72°C 10 min; save 4°C. After PCR amplification, sequencing was performed, and by comparison, it was consistent with the synthetic sequence.
[0055] 5) Expression of recombinant protein: A tube of preserved bacteria was taken from -80°C, and freeze-thawed at room temperature. The above bacteria were inoculated into 600 mL of LB culture solution containing 50 μg / mL Kan at a ratio of 1:1000, and shaken at 37°C and 220 rpm until the OD 600 of the bacteria was 0.8-1.0. IPTG was added to the 600 mL fermentation medium (LB culture solution) to a final concentration of 0.1 mM, and the culture was incubated at 25°C and 220 rpm for 4 h and at 16°C for 8 h. The culture was centrifuged at 5000 rpm and 4°C for 5 min, and the fermentation bacteria were collected by removing the supernatant and stored at -20°C. Protein expression detection: the bacteria were broken, and the breaking conditions were 150 W power, breaking for 1 s, interval 1 s, for a total of 15 min. The breaking buffer was TBS, pH 7.4.
[0056] sds-page electrophoresis detection was performed, and the results are shown in Figure 3 Figure 3 M represents Marker; 1 represents before induction; 2 represents whole bacteria after induction at 25°C; 3 represents supernatant after induction at 25°C; 4 represents precipitate after induction at 25°C; 5 represents whole bacteria after induction at 16°C; 3 represents supernatant after induction at 16°C; 4 represents precipitate after induction at 16°C.
[0057] 6) Purification of recombinant hyaluronidase: Bacterial cell disruption: 10 g of bacteria were resuspended in 100 mL of lysis buffer (20 mM PB, pH 6.0) at a ratio of 1:10, and high-pressure homogenization was performed at 200 bar once, 800 bar twice, 9000 rpm, and 4°C for 30 min. The centrifuged supernatant was collected.
[0058] Chromatography purification: Equilibrate the chromatography column with binding buffer (such as 20 mM Tris-HCl, pH 8.0, 300 mM NaCl) to ensure that the packing is fully wetted.
[0059] Load: Load the sample into the chromatography column at a certain flow rate, so that the retention time of the sample in the column bed is greater than 5 min, and the His-tag protein binds to the Ni2+ Combined, collected flow-through liquid.
[0060] Washing: The chromatography column was washed with washing buffer (e.g. 20 mM Tris-HCl, pH 8.0, 300 mM NaCl, 20 mM imidazole) to remove unbound impurities, and the washing volume was usually 5-10 times of the column volume.
[0061] Elution: The bound target protein was eluted with elution buffer (e.g. 20 mM Tris-HCl, pH 8.0, 300 mM NaCl, 300 mM imidazole), and the eluate was collected. SDS-PAGE electrophoresis detection was performed, and the results are shown in Figure 4 Figure 4 M represents Marker; 1: loading liquid; 2: flow-through sample; 3: washing liquid; 4: elution peak.
[0062] Example 3, Enzymatic property determination 1. Enzyme activity determination: DNS method was used to determine the hyaluronidase activity. DNS was reduced to an amino compound by the reducing sugar in the HAase-degraded HA product in an alkaline solution, and color development was performed in a boiling water bath for 5 min. After cooling, the absorbance at 540 nm A540was immediately determined. 0.5 mL of 0.5% HA solution was mixed with 0.5 mL of sample liquid, and incubated at 37°C for 30 min. The reaction was stopped by boiling for 5 min. The denatured protein was precipitated by centrifugation, and 0.4 mL of supernatant was taken and added with 0.8 mL of DNS solution. DNS was reduced to an amino compound by the reducing sugar in the HAase-degraded HA product, and color development was performed by boiling for 5 min. After cooling, the absorbance was immediately determined. The blank group used phosphate buffer instead of sample liquid.
[0063] Results: The specific enzyme activity of the mutant enzyme was 941 U / mg, which was 2.36 times of the specific enzyme activity of the wild-type enzyme (398 U / mg).
[0064] 2. Thermal stability determination: The enzyme liquid was incubated in a 40°C, 60°C, and 80°C water bath, and the residual enzyme activity was determined at different time points. The results are shown in Table 3.
[0065] Table 3
[0066] The enzyme activity of the wild-type PH20 enzyme decreased significantly at 60°C, and it basically lost activity at 80°C. The enzyme activity of the mutant PH20 enzyme of the present application decreased less at 60°C, and even at 80°C, the enzyme activity was still relatively high, which was higher than the initial enzyme activity of the wild-type. This indicates that the mutant PH20 enzyme of the present application has excellent high-temperature resistance.
[0067] 3. pH stability assay: The enzyme activity was measured by reducing sugar method or viscosity method under the condition of pH 3, 4, 5, 6, 7, 8, 9, 10 at 37°C with sodium hyaluronate as substrate. The results are shown in Table 4.
[0068] Table 4
[0069] The specific enzyme activity of the mutant PH20 enzyme of the present application is at least higher than that of the wild-type PH20 enzyme in the pH range of 3-10, and the specific enzyme activity is 880-976 U / mg between pH 5-8. It shows that the mutant PH20 enzyme of the present application has excellent enzyme activity in a wider pH range.
[0070] Example 4: Preparation of 100 kDa molecular weight hyaluronic acid 1. Prepare a 10 g / L high molecular weight sodium hyaluronate (>1000 kDa) solution as a substrate; 2. In the reaction system at pH 6.0 and 40°C, add the purified mutant hyaluronidase, and the enzyme addition amount is 5 U / g of substrate; the wild-type hyaluronidase under the same conditions is used as a control group; 3. Take samples after 2 h of reaction, and immediately terminate the reaction by boiling water bath for 10 min; 4. Use hollow fiber with 100 kDa cutoff to separate hyaluronic acid. Calculate the recovery rate and molecular weight distribution; the results are shown in Table 5.
[0071] The viscosity method is used to determine the molecular weight of hyaluronic acid, and the specific method and calculation steps are as follows: 1. Experimental preparation Prepare hyaluronic acid samples, appropriate solvents (such as water or specific organic solvents), Ubbelohde viscometer, constant temperature water bath, stopwatch, etc. Prepare a series of hyaluronic acid solutions with different concentrations, and the concentration range should be determined according to the sample and experimental conditions, generally between 0.01% and 1%.
[0072] 2. Viscosity determination Place the Ubbelohde viscometer in the constant temperature water bath, adjust the temperature to constant (25°C), and measure the outflow time of the pure solvent and each concentration of hyaluronic acid solution in the Ubbelohde viscometer, repeat 3-5 times to take the average value to reduce the error.
[0073] 3. Calculate the relative viscosity, and calculate the viscosity average molecular weight according to the Mark-Houwink equation.
[0074] Table 5
[0075] As can be seen from Example 4, the yield of hyaluronic acid with a molecular weight distribution of 91 kDa can reach 87.1% by controlling the enzymolysis time to be 2 h and mutant enzymolysis, which is 2.67 times higher than the yield of 23.7% by wild-type PH20 enzymolysis under the same conditions. This is consistent with the specific enzyme activity described above.
[0076] Example 5: Preparation of 10 kDa molecular weight hyaluronic acid 1. Prepare a 10 g / L solution of high molecular weight hyaluronic acid sodium (>1000 kDa) as a substrate; 2. Add the purified mutant hyaluronidase to the reaction system at pH 6.0 and 40°C, and the enzyme addition amount is 5 U / g of substrate; 3. Sample at 12 h of reaction, and immediately terminate the reaction by boiling in a water bath for 10 min; 4. Separate the hyaluronic acid by using hollow fiber with a 10KDa cutoff. Calculate the recovery rate and molecular weight distribution; the results are shown in Table 6.
[0077] The viscosity method of Example 4 is used to determine the molecular weight of hyaluronic acid.
[0078] Table 6
[0079] As can be seen from Example 5, the yield of hyaluronic acid with a molecular weight distribution of 7.6 kDa can reach 79.7% by controlling the enzymolysis time to be 12 h and mutant enzymolysis, which is 1.47 times higher than the yield of 32.3% by wild-type PH20 enzymolysis under the same conditions.
[0080] Therefore, by using the mutant enzyme of the present application, specific molecular weight hyaluronic acid with a narrow molecular weight distribution (the polydispersity coefficient PDI can be less than 1.5) can be prepared with high precision by simply adjusting the reaction time, especially the ultra-low molecular weight product less than 10 kDa which is difficult to obtain.
[0081] In the description of the present specification, the description of the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, the person skilled in the art can combine and combine the different embodiments or examples described in the present specification and the features of the different embodiments or examples without contradiction.
[0082] In addition, the terms "first", "second", etc. are used only for the purpose of description, and should not be understood as indicating or implying relative importance or an indicated number of technical features. Therefore, the features defined as "first", "second" can explicitly or implicitly include at least one of the features. In the description of the present application, the meaning of "a plurality of" is two or more, unless otherwise specifically limited.
[0083] The above description is merely a specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any person skilled in the art can easily think of various changes or replacements within the technical scope disclosed by the present application, and these should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.
Claims
1. A novel hyaluronidase, characterized in that, The novel hyaluronidase comprises an amino acid sequence as shown in SEQ ID No.
1. The novel hyaluronidase comprises an amino acid sequence as shown in SEQ ID No.
1.
2. The novel hyaluronidase according to claim 1, wherein, The novel hyaluronidase comprises an amino acid sequence as shown in SEQ ID No.
2.
3. A nucleotide, characterized in that, The nucleotide acid encodes the novel hyaluronidase according to claim 1 or 2.
4. The nucleotide of claim 3, wherein, The sequence of the nucleotide acid is shown in SEQ ID No.
3.
5. A recombinant plasmid, characterized in that, The recombinant plasmid comprises the nucleotide acid according to claim 3 or 4.
6. The recombinant plasmid of claim 5, wherein, The plasmid vector is PH20-pET-30a(+).
7. A host cell for efficient expression, characterized in that, The host cell for high-efficiency expression comprises the nucleotide acid according to claim 3 or 4; or the recombinant plasmid according to claim 5 or 6.
8. The host cell of claim 7, wherein, The host cell for high-efficiency expression is Escherichia coli BL21(DE3).
9. A preparation method of hyaluronic acid with a specific molecular weight, wherein, The novel hyaluronidase according to claim 1 or 2 is used to degrade high-molecular-weight hyaluronic acid through an enzymatic reaction to obtain the hyaluronic acid with a specific molecular weight.
10. The process for the preparation of hyaluronic acid of a specific molecular weight according to claim 9, characterized in that, The hyaluronic acid with a specific molecular weight has a molecular weight ranging from 1 kDa to 120 kDa. Preferably, the hyaluronic acid has a molecular weight of 10 kDa or 100 kDa.