Molecular marker closely linked with wheat powdery mildew resistance gene PmNJ3930 and application of molecular marker

By developing dCAPS molecular markers that are closely linked to the wheat powdery mildew resistance gene PmNJ3930, and using WGRC6877-F and WGRC6877-R primer pairs for PCR amplification and enzyme digestion electrophoresis, the problems of resistance loss and low efficiency of marker-assisted selection in existing technologies have been solved, enabling rapid and accurate screening and shortening the breeding cycle.

CN121629079APending Publication Date: 2026-03-10NANJING AGRICULTURAL UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512025086.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-30
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

In existing technologies, the powdery mildew resistance genes Pm3 and Pm8 have almost lost their resistance in most wheat-growing areas, leading to the loss of resistance in resistant varieties. Furthermore, the lack of molecular markers closely linked to the wheat powdery mildew resistance gene PmNJ3930 affects the efficiency of marker-assisted selection and prolongs the breeding process.

Method used

A dCAPS molecular marker tightly linked to the wheat powdery mildew resistance gene PmNJ3930 was developed. PCR amplification was performed using primer pairs WGRC6877-F and WGRC6877-R, and wheat powdery mildew resistance was identified by NcoI restriction enzyme digestion and electrophoresis. Products and methods for identifying wheat powdery mildew resistance were designed.

Benefits of technology

This study enabled precise localization and map-based cloning of the PmNJ3930 gene, allowing for rapid screening of wheat varieties highly resistant to powdery mildew, shortening the breeding cycle, improving selection efficiency and variety quality, and reducing the workload of blind backcrossing and field trials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121629079A_ABST
    Figure CN121629079A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of crop breeding science, in particular to a molecular marker closely linked with a wheat powdery mildew resistance gene PmNJ3930 and application of the molecular marker. The marker closely linked with the PmNJ3930 is a dCAPS molecular marker, and an upstream primer sequence and a downstream primer sequence for amplifying the molecular marker are provided. A product amplified by the primer is 354 bp after being subjected to NcoI enzyme digestion, which indicates that the wheat to be detected contains the PmNJ3930 gene and is a wheat variety with high powdery mildew resistance. When the primer pair provided by the invention is used for detecting the PmNJ3930 gene, whether the PmNJ3930 gene exists or not and the existence state of the PmNJ3930 gene can be determined, and the powdery mildew resistance of wheat is predicted, so that plants carrying the PmNJ3930 gene are quickly screened and are used for breeding disease-resistant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of crop breeding technology, and in particular to a molecular marker closely linked to the wheat powdery mildew resistance gene PmNJ3930 and its application. Background Technology

[0002] Powdery mildew, caused by the wheat-specific strain *Blumeria graminis* f. sp. Tritici (Bgt), poses a significant threat to wheat production. Breeding and promoting resistant varieties is one of the most economical, effective, and environmentally friendly measures for controlling this disease. However, due to the rapid evolution of the pathogen, large-scale promotion and use of single resistant varieties can easily lead to the loss of resistance genes; for example, Pm3 and Pm8 have almost lost their resistance in most wheat-growing areas. Therefore, continuously discovering new powdery mildew resistance genes to provide abundant resistance sources for disease-resistant breeding is particularly important.

[0003] Wheat relatives, both close and distant, are valuable genetic resources for wheat breeding. To date, over 60 powdery mildew resistance genes have been identified from wheat relatives, including 12 from diploid A-genome wheat (Erinus spp.) and *Wheat urartu*. Some of these genes have been successfully transferred to hexaploid cultivated wheat. Discovering and utilizing *Erinus spp.* disease resistance genes can help broaden the relatively narrow genetic diversity of common wheat, providing important genetic resources for breeding high-yielding, disease-resistant new wheat varieties.

[0004] Cultivated wheat variety TA2032 exhibits good resistance to powdery mildew. Genetic analysis and gene mapping of powdery mildew resistance were performed on a recombinant inbred line population constructed from cultivated wheat TA2032 and susceptible cultivated wheat M389. A novel powdery mildew resistance gene, PmNJ3930, was identified on chromosome 7AL of cultivated wheat TA2032 (this gene is published in the literature "Identification and Mapping of Three Powdery Mildew Resistance Genes in Cultivated Wheat 2223409", and is identified as Pm409-7A in that literature). Addressing the issues of long genetic distance and low accuracy of existing markers for PmNJ3930, it is urgent to develop molecular markers closely linked to the powdery mildew resistance gene PmNJ3930 to improve the efficiency of marker-assisted selection, promote the transfer of the PmNJ3930 gene to common wheat, and shorten the breeding process for new powdery mildew-resistant wheat varieties. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker closely linked to the wheat powdery mildew resistance gene PmNJ3930 and its application, in order to solve the problems existing in the prior art.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a dCAPS molecular marker that is closely linked to the wheat powdery mildew resistance gene PmNJ3930. The nucleotide sequence of the dCAPS molecular marker is shown in SEQ ID No.3, and a T / A mutation exists at the 358th base of the sequence.

[0008] The present invention provides primer pairs for amplifying the above-mentioned dCAPS molecular marker, the primer pairs comprising WGRC6877-F nucleotide sequence as shown in SEQ ID No. 4 and WGRC6877-R nucleotide sequence as shown in SEQ ID No. 5.

[0009] This invention provides the application of the above-mentioned primer pairs in the preparation of products for identifying the level of wheat powdery mildew resistance.

[0010] Preferably, the product includes reagents, reagent kits, and chips.

[0011] This invention provides a product for identifying the level of resistance to wheat powdery mildew, the product comprising the primer pair described above.

[0012] This invention provides the application of the above-mentioned primer pairs or the above-mentioned products in identifying the level of wheat powdery mildew resistance.

[0013] This invention provides a method for identifying the level of resistance to powdery mildew in wheat, comprising the following steps:

[0014] Using the genomic DNA of the wheat sample to be tested as a template, PCR amplification was performed using the primer pairs mentioned above. The obtained PCR amplification products were then digested with enzymes and electrophoresed. The wheat powdery mildew resistance was determined based on the electrophoresis results.

[0015] Preferably, a wheat variety is highly resistant to powdery mildew when the wheat sample to be tested has only one 354 bp band; a wheat variety is highly susceptible to powdery mildew when the wheat sample to be tested has only one 374 bp band; and a wheat variety is moderately resistant to powdery mildew when the wheat sample to be tested contains both 354 bp and 374 bp bands.

[0016] This invention provides the application of the above-mentioned primer pairs or products in screening wheat varieties with high resistance to powdery mildew.

[0017] This invention provides the application of the above-described primer pairs or the above-described products in wheat molecular breeding.

[0018] The present invention discloses the following technical effects:

[0019] 1. The WGRC6877 molecular marker of the wheat powdery mildew resistance gene PmNJ3930 provided by this invention was closely linked to the PmNJ3930 gene after genetic segregation population detection, indicating that the PmNJ3930 gene can be accurately detected, which is helpful for the fine localization and map-based cloning of the PmNJ3930 gene.

[0020] 2. This invention provides primers for amplifying this molecular marker and their applications. The product amplified using these primers, after digestion with NcoI, is 354 bp, indicating that the wheat being tested contains the PmNJ3930 gene, making it a wheat variety highly resistant to powdery mildew. Using the primer pairs provided by this invention to detect the PmNJ3930 gene can determine its presence and state, predict wheat powdery mildew resistance, and rapidly screen plants carrying the PmNJ3930 gene for breeding resistant varieties, providing guidance for selecting new wheat varieties resistant to powdery mildew. Using the markers provided by this invention for marker-assisted selection can quickly and accurately screen target varieties carrying the PmNJ3930 gene, reducing the workload of blind backcrossing and field trials, shortening the breeding cycle, saving production costs, and improving the selection efficiency and quality of powdery mildew-resistant wheat varieties or lines. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The response of the recombinant inbred line X06671 (carrying PmNJ3930) constructed for cultivating emmer wheat TA2032 and the susceptible emmer wheat M389, the susceptible material M389, and the F1 hybrid of X06671 and M389 to strain Bgt2; the number of spores on the leaves of the F1 plants was between that of the parents, showing moderate resistance.

[0023] Figure 2 Genotypes of some individuals in the PmNJ3930 F2 genetic segregating population constructed from the resistant family X06671 (carrying PmNJ3930) and the susceptible material M389 using the WGRC6877 primer pair; X06671 contains a specific band of 354 bp, and M389 contains a specific band of 374 bp; M: molecular weight standard, the number on the left indicates the molecular weight (bp), 1-28 are 28 individuals in the PmNJ3930 F2 genetic segregating population; R represents high resistance, S represents high susceptibility, and M represents moderate resistance. Detailed Implementation

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0026] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0027] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0028] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0029] Example 1: Development of the tightly linked molecular marker WGRC6877 for the wheat powdery mildew resistance gene PmNJ3930

[0030] (1) Genetic analysis of seedling resistance to powdery mildew

[0031] Genetic analysis and gene mapping of powdery mildew resistance were performed on a recombinant inbred line population constructed from cultivated einkorn wheat TA2032 and susceptible cultivated einkorn wheat M389 (using the same methods as in the literature "Identification and Mapping of Three Powdery Mildew Resistance Genes in Cultivated Einkorn Wheat 2223409"). A novel powdery mildew resistance gene, PmNJ3930, was identified on chromosome 7AL of cultivated einkorn wheat TA2032, which is Pm409-7A in the literature "Identification and Mapping of Three Powdery Mildew Resistance Genes in Cultivated Einkorn Wheat 2223409". Among them, the disease-resistant family X06671 in the recombinant inbred line contained the PmNJ3930 resistance locus. This family was used to cross with susceptible cultivated einkorn wheat M389 to construct a PmNJ3930 F2 genetic segregating population. The F1 hybrids obtained from crossing the disease-resistant family X06671, the susceptible cultivated wheat M389, and the F2 genetic segregating population of PmNJ3930 (obtained by self-pollination of the aforementioned F1 hybrids to obtain the PmNJ3930 F2 genetic segregating population) were planted in 72-cell trays. After sowing, the growth conditions were controlled as follows: 16 h light / 8 h dark cycle, daytime temperature 22℃ / nighttime temperature 18℃, and relative humidity above 70%. When the seedlings reached the one-leaf stage, they were inoculated with wheat powdery mildew physiological race Bgt2 (disclosed in the literature "Identification and marker-assisted transfer of a new powdery mildew resistance gene at the Pm4 locus in common wheat," with the applicant committing to distributing it for 20 years from the date of application). Five to seven days after inoculation, when the surface of the first leaf of the susceptible material M389 was covered with 80% spores, resistance phenotype identification was performed. Resistance assessment was conducted according to a 0-5 grade standard. Grade 0-1 represents high resistance, indicating no visible symptoms and necrotic spots on leaves without spore production; grades 2-3 represent moderate resistance, indicating a small amount of mycelium on leaves and a small amount of spore production; grades 4-5 represent susceptibility, indicating abundant spore production and abundant spore production with 80% of the leaf surface covered by mycelium. The resistance phenotype assessment results showed that the F1 individual plants exhibited a moderately resistant phenotype, with a small amount of spores on the leaves, and resistance intermediate between the parents. Figure 1 In the PmNJ3930 F2 genetic segregating population, 56 plants had a resistance grade of 0-1, identified as highly resistant; 111 plants had a resistance grade of 2-3, identified as moderately resistant; and 53 plants had a resistance grade of 4-5, identified as susceptible. The segregation ratio of highly resistant, moderately resistant, and susceptible plants was 1:2:1 (χ²). 2 =0.1, P=0.951). This result indicates that the resistance of the PmNJ3930 gene to strain Bgt2 is semi-dominantly inherited.

[0032] (2) Development of molecular markers closely linked to the PmNJ3930 gene

[0033] To develop polymorphic markers closely linked to the PmNJ3930 gene, homozygous resistant and susceptible plants from the PmNJ3930 F2 genetic segregating population were selected using flanking markers for pooled RNA sequencing. Based on RNA-seq data analysis from the resistant and susceptible pools, a SNP was found in the genome sequences of susceptible cultivated wheat M389 and X06771 at the Chr7A:723,675,167 bp position within the PmNJ3930 region, corresponding to the Chinese Spring (v2.1) reference genome. The SNP in the susceptible cultivated wheat M389 is CC. T TGTCATTTCAAACAGACA (SEQ ID No. 1); the nucleotide sequence at X06671 is CC. A TGTCATTTCAAACAGACA (SEQ ID No. 2); where the underlined part is the SNP site.

[0034] (3) Development of dCAPS molecular markers

[0035] Using the SNP differences between the parents in (2), a dCAPS molecular marker—WGRC6877—was designed using dCAPS Finder 2.0 software. Its nucleotide sequence is shown in SEQ ID No. 3, specifically:

[0036] The sequence GTAACAACTGGAACACATGCTTCAAAATAATCAAGGGGATTTGCCAGGGTTTACTTTTTCTACACAAGCAGTTAGATAATAATCCCATTACCCATATGGATCTTAACCTGAAAAATATATGGTTGGATAAAACAATGGTGCCCAAAATTGCCAATGTTGAACTCTCCAGAATCTTTAGCCATGAACAGATCACAAAGGAATCATGGTAAGCTAATCACAAATTTTGACATTATTAGTTTGTTCCTTTATTGTTGTAAATGACGGTTTCACCTCTTTGTAATTCATTCTAACTCTCGGTGCCAATAATATTCAGTGGATACATGGCTCCAGAATATATAAACGACACTCGCAATGCCWTGTCATTTCAAACAGACA contains a T / A mutation at base position 358, meaning W is either T or A.

[0037] (4) Development of primer pairs for amplifying dCAPS molecular markers

[0038] Based on the dCAPS molecular marker obtained in step (3), the WGRC6877 primer pair was designed, and the specific primer sequences are shown below:

[0039] WGRC6877-F: 5'-GTAACAACTGGAACACATG-3', SEQ ID No. 4;

[0040] WGRC6877-R: 5'-TGTCTGTTTGAAATGCCA-3', SEQ ID No. 5 (The reason why the downstream primer cannot match perfectly is that an SNP was introduced during primer synthesis so that NcoI can recognize and digest it).

[0041] (5) PCR reaction system and procedure

[0042] The PCR reaction system included 10×Buffer, 0.2 μmol / L each of forward and reverse primers, 2.5 mmol / L dNTPs, 2 U of DNA polymerase, and 30 ng of DNA template.

[0043] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 50℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles; 72℃ extension for 10 min.

[0044] (6) Result determination

[0045] The enzyme digestion products were separated using an 8% non-denaturing polyacrylamide gel, stained with silver, and finally photographed using a gel imaging system. Samples with only one 354 bp band were considered highly resistant to wheat powdery mildew; samples with only one 374 bp band were considered susceptible to wheat powdery mildew; and samples containing both 354 bp and 374 bp bands were considered moderately resistant to wheat powdery mildew.

[0046] Example 2: Application of the WGRC6877 primer pair for amplifying the tightly linked dCAPS molecular marker of the wheat powdery mildew resistance gene PmNJ3930.

[0047] To further verify the accuracy of the WGRC6877 primer pair developed in Example 1, this example extracts genomic DNA from the recombinant inbred line X06671 (a disease-resistant family constructed from cultivated wheat TA2032 and susceptible cultivated wheat M389), susceptible cultivated wheat M389, and the PmNJ3930 F2 genetic segregating population from Example 1. The above DNA samples are amplified using the WGRC6877 primer pair. The specific steps are as follows:

[0048] 1. DNA was extracted using the SDS alkaline lysis method:

[0049] (1) Take about 0.3 g of fresh leaves and place them in a 2.0 mL Eppendorf centrifuge tube. Add glass beads, freeze in liquid nitrogen for 1 min, and then grind into powder using a ball mill.

[0050] (2) Add 250 μL of DNA extraction buffer (containing 0.1 M Tris pH 8.0, 0.05 M EDTA pH 8.0, 1.25% SDS, 0.5 M NaCl, and 3.8 g / L NaBisufite) to the tube, shake well to mix, and incubate in a water bath at 65°C for 30 min.

[0051] (3) Add 250 μL of chloroform-isoamyl alcohol (24:1, v / v) and shake gently on a shaker for 15 min.

[0052] (4) Centrifuge at 12,000 rpm for 15 min, take the supernatant into a new 1.5 mL centrifuge tube, add an equal volume of pre-cooled anhydrous ethanol, and precipitate white flocculent DNA.

[0053] (5) Discard the supernatant, keep the DNA precipitate, and wash twice with pre-cooled 75% ethanol.

[0054] (6) After the DNA is dried, add an appropriate amount of ddH2O or TE to dissolve it, and then store it at -20℃.

[0055] 2. PCR amplification:

[0056] The extracted DNA was amplified by PCR. The PCR reaction system and procedure are as follows:

[0057] The PCR reaction system included 10×Buffer, 0.2 μmol / L each of forward and reverse primers, 2.5 mmol / L dNTPs, 2U of DNA polymerase, and 30 ng of DNA template.

[0058] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 50℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles; 72℃ extension for 10 min.

[0059] 3. Results:

[0060] The PCR product amplified using the WGRC6877 primer pair was digested with NcoI. The digestion reaction volume was 10 μL (5 μL PCR product; 0.05 μL NcoI; 1 μL NEB CutSmart Buffer; 3.95 μL deionized water). The digestion reaction was performed at 37℃, and all other procedures were performed according to the manufacturer's instructions. The digested products were separated using an 8% non-denaturing polyacrylamide gel, stained with silver, and finally photographed using a gel imaging system. The detection results are shown below. Figure 2 As shown in the figure. The results showed that the band size of the disease-resistant material X06771 carrying PmNJ3930 was 354 bp, and the band size of the disease-susceptible material M389 was 374 bp; the band size of all highly resistant individuals in the PmNJ3930 F2 genetic segregating population was 354 bp, consistent with X06771; the band size of all highly susceptible individuals in the PmNJ3930 F2 genetic segregating population was 374 bp, consistent with the M389 band pattern; the individual individuals in the PmNJ3930 F2 genetic segregating population exhibiting moderate resistance contained two bands, 354 bp and 374 bp, i.e., exhibiting both the X06771 and M389 band patterns. This result indicates that the WGRC6877 molecular marker of this invention is closely linked to the PmNJ3930 gene.

[0061] The wheat powdery mildew resistance gene PmNJ3930 originates from cultivated emmer wheat TA2032. Currently, there are no reports of its localization and map-based cloning. Using the WGRC6877 primer pair provided in this invention to detect wheat varieties facilitates the fine localization and map-based cloning of the PmNJ3930 gene, and is of great significance for the efficient transfer of the PmNJ3930 gene to common wheat.

[0062] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A dCAPS molecular marker closely linked to the wheat powdery mildew resistance gene PmNJ3930, characterized in that, The nucleotide sequence of the dCAPS molecular marker is shown as SEQ ID No. 3, and a T / A mutation exists at the 358th base of the sequence.

2. A primer pair for amplifying the dCAPS molecular marker of claim 1, characterized in that, The primer pair comprises WGRC6877-F with the nucleotide sequence shown as SEQ ID No. 4 and WGRC6877-R with the nucleotide sequence shown as SEQ ID No.

5.

3. Use of the primer pair of claim 2 in the preparation of a product for identifying the resistance of wheat powdery mildew.

4. Use according to claim 3, characterized in that, The product comprises reagents, kits and chips.

5. A product for identifying the level of resistance to wheat powdery mildew, characterized by, The product comprises the primer pair of claim 2.

6. Use of the primer pair of claim 2 or the product of claim 5 in identifying the resistance of wheat powdery mildew.

7. A method for identifying the level of resistance to wheat powdery mildew, characterized by, The method comprises the following steps: Using the genomic DNA of the wheat sample to be tested as a template, the primer pair of claim 2 is used for PCR amplification, and the obtained PCR amplification product is subjected to enzyme digestion and electrophoresis, and the resistance of wheat powdery mildew is determined according to the electrophoresis result.

8. The method of claim 7, wherein, When the wheat sample to be tested has only one band of 354 bp, it is a wheat variety with high resistance to powdery mildew; when the wheat sample to be tested has only one band of 374 bp, it is a wheat variety with high susceptibility to powdery mildew; and when the wheat sample to be tested contains two bands of 354 bp and 374 bp, it is a wheat variety with medium resistance to powdery mildew.

9. Use of the primer pair of claim 2 or the product of claim 5 in screening wheat varieties with high resistance to powdery mildew.

10. Use of the primer pair of claim 2 or the product of claim 5 in wheat molecular breeding.