Cancer marker and application

By identifying ICAM1/ICAM1-AS as cancer biomarkers, we developed early diagnosis and prediction products, which solved the problem of the lack of efficient early cancer diagnosis and individual variability in the efficacy of immunotherapy in existing technologies, and achieved optimization of cancer diagnosis and treatment plans with high specificity and sensitivity.

CN121653252APending Publication Date: 2026-03-13SOUTHEAST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511862045.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-11
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Current technologies lack efficient and specific biomarkers for early cancer diagnosis, and the efficacy of cancer immunotherapy varies significantly among individuals, with a lack of effective tools for predicting treatment effectiveness.

Method used

ICAM1 and its inverse complementary strand ICAM1-AS were identified as cancer biomarkers. Early cancer diagnostic and predictive products were developed by detecting ICAM1/ICAM1-AS mRNA expression and using products containing ILF2 or ILF3 antibodies. The interaction between ICAM1/ICAM1-AS and ILF3 proteins and their effects on cell proliferation and gene regulation were revealed.

Benefits of technology

It provides a highly specific and sensitive early cancer diagnostic tool, optimizes immunotherapy regimens, and inhibits tumor cell proliferation by affecting EIF4E gene expression and downstream target protein translation processes through the expression level of ICAM1/ICAM1-AS and the binding of ILF2/ILF3 protein complex.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121653252A_ABST
    Figure CN121653252A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and discloses a cancer marker and application, and the cancer marker is ICAM1 and a reverse complementary chain ICAM1-AS thereof. Experiments prove that ICAM1 / ICAM1-AS can be specifically bound with an ILF2 / ILF3 protein compound, tumor cell proliferation is affected by regulating and controlling the genome binding capacity of ILF2 / ILF3 and an EIF4E-mediated translation process, and the ICAM1 / ICAM1-AS has remarkable down-regulated expression in tumor tissues such as lung cancer. Based on the characteristics, a reagent for detecting ICAM1 / ICAM1-AS mRNA expression can be used for preparing an early-stage cancer diagnosis or prediction product, a product containing the ILF2 / ILF3 antibody can be used for predicting the cancer immunotherapy effect, and a new technical means and a potential target are provided for early-stage screening and treatment scheme optimization of cancers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a cancer biomarker and its application. Background Technology

[0002] Cancer is a major disease threatening human life and health globally, placing a heavy burden on public health systems and socioeconomic systems. Statistics show that cancer accounts for 22.8% of deaths from non-communicable diseases (NCDs) worldwide, and approximately one-fifth of the population is at risk of developing cancer at some point in their lives. The probability of dying from cancer is 1 in 9 for men and 1 in 12 for women. Lung cancer became the most common type of cancer globally in 2022, with nearly 2.5 million new cases, accounting for 12.4% of all cancer cases worldwide, and its mortality rate accounts for 18.7% of all cancer deaths, making it a key focus in cancer prevention and control.

[0003] Currently, there is a lack of efficient and specific biomarkers for early cancer diagnosis, and most patients are diagnosed at an advanced stage, limiting treatment effectiveness. Furthermore, the efficacy of cancer immunotherapy varies significantly among individuals, and effective tools for predicting treatment outcomes are lacking. Therefore, identifying highly specific and sensitive cancer biomarkers and developing diagnostic and predictive products based on these biomarkers is crucial for improving early cancer diagnosis rates and optimizing immunotherapy regimens. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the objective of this invention can be achieved through the following technical solutions: I. Determination of Cancer Markers This invention, through extensive experimental research, has identified ICAM1 (intercellular adhesion molecule 1) and its reverse complementary strand ICAM1-AS as cancer biomarkers. These biomarkers can participate in cancer development and progression through the following mechanisms: ICAM1 / ICAM1-AS can form double-stranded RNA (dsRNA), which specifically binds to the ILF2 / ILF3 protein complex, and the binding ability of double-stranded RNA is significantly stronger than that of single-stranded RNA. The dsRBD2 domain of ILF3 is a key region for binding to ICAM1 / ICAM1-AS, and the two are co-localized in the cell nucleus. ICAM1 / ICAM1-AS inhibits tumor cell proliferation by regulating the genome-wide binding capacity of ILF2 / ILF3, affecting the expression of the EIF4E gene and the translation of downstream target proteins such as CDK2 and c-MYC. In tumor tissues such as lung cancer, the expression level of ICAM1 / ICAM1-AS is significantly lower than that of adjacent normal tissues, and the expression of the two is significantly positively correlated.

[0005] II. Application of Markers Based on the above characteristics, the present invention provides the following applications: Application of reagents for detecting ICAM1 / ICAM1-AS mRNA expression in the preparation of early cancer diagnostic or predictive products, including lung cancer; The application of products containing ILF2 or ILF3 antibodies in predicting the efficacy of cancer immunotherapy, wherein the products are kits or chips.

[0006] III. Relevant Reagents and Sequences Primer sequences for detecting ILF2: Upstream primer (SEQ ID NO.1): TCGACAGAATCATTCTCGAT Downstream primer (SEQ ID NO.2): ATCGAGATGATTCTGTCGA Primer sequences for detecting ILF3: Upstream primer (SEQ ID NO.3): AGCATTCTTCCGTTTATCCAACA Downstream primer (SEQ ID NO.4): GCTCGTCTATCCAGTCGGAC The beneficial effects of this invention: This invention, through the study of ICAM1 and its reverse complementary strand ICAM1-AS, delves into the mechanisms of action of ICAM1 in cell proliferation, gene regulation, and its clinical significance in tumors. Through a series of experiments, it reveals the interaction between ICAM1 / ICAM1-AS and ILF3 protein, and their regulatory effects on cell proliferation, whole-genome assembly, and translation, providing new insights and potential targets for tumor research. Attached Figure Description

[0007] To more clearly illustrate the technical solutions in the embodiments of this disclosure or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, those skilled in the art can obtain other drawings based on these drawings without creative effort.

[0008] Figure 1This invention demonstrates how the ICAM1 / ICAM1-AS interaction affects cell proliferation; (A) Silver-stained gels show proteins pulled down by ICAM1-AS RNA, with clearly visible specific bands identified as NF45 and NF90 / NF110. (B) A Venn diagram shows the overlap between the ILF3 binding site (detected by eCLIP in the ENCODE database) and genes with sense / antense pairs found in this study. (C) A schematic diagram of the ICAM1 / ICAM1-AS loci on chromosome 19, highlighting the ILF3 binding site.

[0009] Figure 2 To enhance the binding of ICAM1 / ICAM1-AS dsRNA to ILF2 / 3 in this invention: (A) Immunoblot analysis of RNA pull-down assays in A549 and Calu-1 cells using ICAM1 / ICAM1-AS single-stranded probes and dsRNA probes. (B) EMSA showed a direct interaction between NF90 and ICAM1 / ICAM1-AS RNA duplexers, exhibiting a significant change in band migration rate. (C) RIP assays showed that ILF2 (left) and ILF3 (right) bind to ICAM1 / ICAM1-AS, and qPCR results showed the relative binding efficiencies.

[0010] Figure 3 This invention focuses on ILF3RBD2's key role in dsRNA binding and nuclear localization. (A) RIP detection results used flag-labeled NF90 and NF110 structures with selectively deleted RNA-binding domains (RBDs), and qPCR results showed relative binding efficiency. (B) Immunoblotting analysis confirmed the efficiency of protein precipitation in the RIP experiment using flag-labeled RBD-deleted NF90 and NF110 structures. (C) Immunofluorescence images showed that ILF3 co-localized with total dsRNA in the cell nucleus, regardless of the presence of ICAM1KD. Scale bar, 10 μm.

[0011] Figure 4 To ensure that ICAM1KD does not affect the co-localization and binding of ILF3 with dsRNA, the following methods were employed: (A) Immunoblotting analysis of the effect of ILF2 and ILF3 protein levels on ILF3 and ICAM1KD; (BC) qRT-PCR analysis of the relative levels of ILF3 and ICAM1 mRNA under ICAM1 or ILF3KD; and (D) RNA pull-down assay and immunoblotting analysis showing the effect of ILF3 knockdown on the binding of ILF2 and ILF3 to the ICAM1 / ICAM1-AS complex.

[0012] Figure 5This invention demonstrates how ICAM1 / ICAM1-ASdsRNA regulates cell proliferation via ILF3; (A) Proliferation of ILF3KO and WTHCC827 cells. (B) Cell proliferation assays in ICAM1KD / KOCalu-1 cells with or without ILF3KD. (C) Cell proliferation assays in ILF3KOHCC827 cells, showing the effects of ICAM1 (left) and ICAM1-AS (right) KD. Data are mean ± SD. NS, no statistical significance. p<0.05, p<0.01, p<0.001 (two-tailed unpaired t-test).

[0013] Figure 6 In this invention, ICAM1 inhibits the genome-wide binding ability of ILF2 / ILF3; (A) The peak plot shows the distribution of ILF2 and ILF3 binding sites relative to the peak center in ICAM1KD (sh#1) and control (shNC) cells. The x-axis represents the distance to the peak center (-2.0 kb to +2.0 kb), and the y-axis represents the binding strength. (B) The heatmap shows the genome-wide binding patterns of ILF2 and ILF3 in ICAM1KD (sh#1) and control (shNC) cells.

[0014] Figure 7 This invention provides ILF2 / 3 motif analysis and genomic binding sites; (A) Distribution of ILF2 and ILF3 binding sites in genomic features under ICAM1KD. The pie chart shows the percentage of peak values ​​for ILF2 (top) and ILF3 (bottom) in different genomic regions (left) and gene types (right) under ICAM1KD control conditions. (B) Motif analysis of ILF3 (left) and ILF2 (right) binding sites. The top 5 enriched motifs for each protein and their corresponding p-values ​​are shown.

[0015] Figure 8 To verify the binding of NF90 to the ILF3 motif in this invention: (A) EMSA shows NF90 (ILF3) binding to the predicted DNA motif. Different lanes represent different experimental conditions. (B) Dual-luciferase reporter gene assay using the ATTGG motif sequence and its mutant version.

[0016] Figure 9 This invention provides a comparison of the binding efficiency of NF90 with DNA and RNA, as well as interference experiments. (A) EMSA shows the binding ability of dsDNA and dsRNA probes containing the ATTGG and AUUGG core sequences, respectively, at different concentrations of NF90 protein. (B) EMSA compares the binding ability of dsDNA and dsRNA probes with mutant probes at two different protein concentrations.

[0017] Figure 10 This invention relates to the effect of ICAM1 dsRNA on NF90 binding to DNA and its length dependence; (A) DNA pull-down experiments were performed using biotin-labeled DNA probes, competing with full-length ICAM1 / ICAM1-AS or dsRNA probes, followed by immunoblotting analysis to detect NF90 protein levels. (B) DNA pull-down experiments were performed using biotin-labeled DNA probes, competing with ICAM1 / ICAM1-AS dsRNA or dsRNA probes of different lengths, followed by immunoblotting analysis to detect NF90 protein levels. IntDen (overall density) values ​​are shown at the bottom. (C) Competitive EMSA experiments showed the binding ability of dsDNA probes in the presence of ICAM1 / ICAM-AS dsRNA of different lengths at a certain NF90 protein concentration.

[0018] Figure 11 Enrichment analysis of genes and their functional pathways regulated by the ICAM1 / ICAM1-AS and ILF2 / ILF3 complexes in this invention; (A) Volcano plot showing differential gene expression under ICAM1 knockdown (KDsh#2) and ICAM1-ASKD (ICAM1-ASsg#1 and sg#2) conditions. Red dots represent upregulated genes, blue dots represent downregulated genes, and gray dots represent genes with no significant changes. (B) Pathway enrichment analysis of differentially expressed genes in Kyoto Encyclopedia of Genes and Genomes (KEGG) (left) and Gene Ontology Bioprocesses (GOBP) (right). The size of the circle represents the gene count, and the color intensity represents the adjusted p-value. (C) Venn diagram showing the overlap of differentially expressed genes under ICAM1KD and ICAM1-ASKD conditions.

[0019] Figure 12 This invention relates to the effect of ICAM1KD on the binding mode of the ILF2 / ILF3 complex to the EIF4E gene; (A) CUT & Tag sequencing tracks show that ILF2 and ILF3 bind to the EIF4E gene site under both control (shNC) and ICAM1KD (sh#1) conditions. (B) ChIP-qPCR analysis of ILF2 and ILF3 binding to the EIF4E promoter region in control and ICAM1KD cells.

[0020] Figure 13To illustrate the regulation of EIF4E expression by NF90 in this invention: (A) 293T cells were transfected with a luciferase reporter gene containing an EIF4E promoter (R1, R1mut, and R2) co-constructed with NF90. Luciferase activity was measured to assess the effect of NF90 on EIF4E promoter activity. (B) RT-qPCR analysis of EIF4E mRNA levels. Left panel: EIF4E expression in WT and ILF3KO cells. Right panel: EIF4E expression in shNC, ICAM1KD, and ICAM1-ASKD cells. Figure 14 This invention relates to the effect of ICAM1 on translation efficiency via EIF4E; (A) Polymer analysis showing the distribution of ribosomes under control and ICAM1 or ICAM1-ASKD conditions. Absorbance at 254 nm of the sucrose gradient, with peaks corresponding to different ribosome moieties (left). Ratio of polysomes to monomers (right). (B) Immunoblotting analysis of puromycin-labeled proteins in control and ICAM1KD cells. (C) Immunoblotting analysis of EIF4E, CDK2, and c-MYC protein levels in WT and ILF3KO cells.

[0021] Figure 15 This invention relates to ICAM1's regulation of EIF4E and its downstream targets; (A) Immunoblotting analysis of EIF4E, CDK2, and c-MYC protein levels in ICAM1KOCalu-1 cells with ICAM1 and ICAM1-ASKD. (B) Immunoblotting analysis of EIF4E, CDK2, and c-MYC protein levels in ILF3KO cells carrying and not carrying ICAM1KD. (C) Immunoblotting analysis of EIF4E, CDK2, and c-MYC protein levels in ILF3KD cells carrying and not carrying ICAM1 and ICAM1-ASKD.

[0022] Figure 16 This invention enhances the translational activity of ICAM1 / ICAM1-AS; qRT-PCR analysis of monomeric (A) and multi-molecular (B) GAPDH, CDK2, and c-MYC mRNA distribution under (AB) control, ICAM1KD, and ICAM1ASKD conditions. Data are presented as mean ± SD. NS indicates no statistical significance. p<0.05, p<0.01, p<0.001 (two-tailed unpaired t-test).

[0023] Figure 17To illustrate the downregulation of ICAM1 and ICAM1-AS expression in lung cancer in this invention; (A) Analysis of ICAM1 (top) and ICAM1-AS (bottom) expression in LUSC and LUAD using TCGA data. FPKM, exon model fragments per thousand bases, mapped fragments per million. (B) TCGA analysis of ICAM1 (top) and ICAM1-AS (bottom) expression in different cancer types. Black dots and upper scales represent baseline expression levels (FPKM) in normal tissues. Bar charts show log2-fold changes, where color represents p-values. (C) Distribution of different transcript types in LUAD and LUSC samples. Pie charts show non-cis-antense transcripts, co-expressed cis-antense transcripts, and single-expressed cis-antense transcripts. Smaller pie charts break down the distribution of transcript lengths within the co-expressed cis-antense categories.

[0024] Figure 18 This invention relates to the co-regulatory role of ICAM1 / ICAM1-AS in lung cancer and its relationship with translation efficiency; (A) Comparative analysis of cissense and antisense gene pair expression changes in LUAD (left) and LUSC (right). Differential expression analysis of gene expression in LUAD and LUSC in tumor samples and adjacent normal tissues was performed, and then cissense and antisense gene pairs were identified and selected for visualization. The scatter plot highlights the top 10 coordinated regulatory gene pairs of ICAM1 / ICAM1-AS. (B) Correlation analysis of the top 5 differentially upregulated or downregulated gene pairs encoded by mRNA and protein in the public proteomics database (PDC000219). Figure 19 This invention provides an analysis of the expression levels and correlations of ICAM1 and ICAM1-AS in tumor tissues. (A) qPCR validation of ICAM1AS (left) and ICAM1 (right) expression in clinical samples. Box plots show that the CT values ​​of tumor tissues are higher than those of adjacent normal tissues (n=90 pairs, p<0.001). (B) Correlation analysis of ICAM1 and ICAM1-AS expression in clinical specimen B. (C) Correlation analysis of ICAM1 and ICAM1-AS expression in TCGA-LUAD (left) and TCGA-LUSC (right).

[0025] Figure 20This invention provides an analysis of the expression and correlation of ICAM1 protein and RNA in tumor tissues; (A) Representative images of ICAM1-AS, ICAM1 mRNA, and ICAM1 protein from tissue microarray analysis. (B) Stacked bar charts of ICAM1 H-scores in adjacent normal and tumor tissues (n=90 pairs). (C) Chi-square test of ICAM1, ICAM1 mRNA, and ICAM1-AS tissue array results. Correlation between ICAM1 mRNA and ICAM1 protein expression in adjacent normal tissues (top table) and cancerous tissues (bottom table). Figure 21 Correlation analysis of ICAM1 protein and ICAM1-AS expression for this invention; (A) Chi-square test of ICAM1 IHC and ICAM1-ASFISH tissue array results in adjacent normal tissue (left) and adjacent normal tissue (right). (B) Chi-square test of ICAM1, ICAM1 mRNA and ICAM1-AS results in tissue array detection. Correlation of ICAM1 and ICAM1-AS in adjacent normal tissue (top table) and cancer tissue (bottom table). Each table includes the distribution of expression levels and chi-square test results (chi-square value, degrees of freedom (df) and p-value).

[0026] Figure 22 To identify other double-stranded RNAs that may function in lung cancer according to this invention; (A) Correlation between proteins and mRNAs in the public protein database PDC000219. These mRNAs were selected from cissense and antisense transcripts of varying lengths. (BC) Selection Figure 18 The five gene pairs with the largest upregulation and downregulation in group A were amplified by PCR in Calu-1(B) and HCC827(C) cells. Primers were designed to target cissense and antisense transcription regions. RNA was amplified by digestion with RNAseA. GAPDH was used as a negative control, and ICAM1 / ICAM1-AS was used as a positive control. Data are presented as mean ± SD. p<0.05.

[0027] Figure 23For the present invention: (A) RNA expression analysis of ICAM1 and ICAM1-AS in different cell types (left figure) and immunoblotting analysis of ICAM1 protein (right figure). The expression level of ICAM1 mRNA in BEAS-2B cells was used as a reference (set as 1), and the expression levels of ICAM1 and ICAM1-AS in other cell lines were calculated relative to this reference. (B) Dose-response curves of ICAM1 ADC-monomethylaurestatin E (MMAE) treatment in three cell lines with low ICAM1-AS expression but different ICAM1 protein expression levels. The y-axis represents relative cell viability, and the x-axis represents the concentration of ICAM1 ADC-MMAE (ng / μl). The curves were fitted using nonlinear regression. (C) Effect of ICAM1 gene knockout on the sensitivity of Calu-1 cells to ICAM1 ADC-MMAE. Cells were treated with 1 ng / μl of ICAM1 ADC-MMAE and IgG-MMAE. (D) Immunoblot analysis of ICAM1 in HCC827 cells after treatment with IgG-MMAE and ICAM1 ADC-MMAE for 14 days (d) and 21 days. Data are expressed as mean ± standard deviation (SD). p<0.05. Detailed Implementation

[0028] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] Experimental materials 1.1 Cell lines and culture media The cell lines and culture media used in this experiment are shown in Table 1.

[0030] Epicellular cell lines and culture media 1.2 Experimental Reagents The reagents used in this experiment are listed in Table 2, and the protein antibodies used are listed in Table 3.

[0031] Table 2. Main reagents and consumables used in this study Table 3 List of Protein Antibodies 1.3 Primer and nucleic acid probe sequences All primers used in this experiment were synthesized by Qingke Company, and their specific sequences are shown in Tables 4 and 5 below. All nucleic acid probes were synthesized by Huzhou Hippo Company, and their specific sequences are shown in Table 6 below. Table 4 Primer sequences for q-PCR detection Table 5. Primer sequences for shRNA knockdown design Table 6 Nucleic Acid Probe Sequences 1.4 Experimental Apparatus Table 7 List of Main Experimental Instruments Experimental steps: 2.1 Cell Culture Specifically, this includes cell resuscitation, passage, and cryopreservation. For resuscitation, cells are removed from a -80°C freezer, thawed in a 37°C water bath, centrifuged, and resuspended in complete culture medium. For passage, when the cell density reaches 85-95% and the cells are in good condition, they are digested, centrifuged, and reseeded. For cryopreservation, when cells are in good condition, they are digested, centrifuged, resuspended in serum-free cryopreservation buffer, flash-frozen in liquid nitrogen, and stored at -80°C.

[0032] 2.2 Plasmid Construction (1) Prepare the target gene DNA fragment Total RNA was extracted from cell lines with high expression levels of the target gene and no mutations. The RNA was then reverse-engineered to obtain cDNA. Primers for the target gene were designed using the NCBI website, and corresponding restriction endonuclease sites and protective bases were added. The PCR system was prepared according to Table 8. After thorough vortexing and brief centrifugation, the mixture was placed in a PCR instrument for reaction. The PCR program was set as follows: 95℃, 5 min; 40 cycles (95℃, 30 s; 50-65℃, 30 s; 72℃, 40-100 s); 72℃, 5 min. The reaction extension time and annealing temperature need to be adjusted according to the product length and enzyme activity, generally 1 kb / min.

[0033] Table 8 PCR reaction system (2) DNA purification and recovery After PCR, the PCR products are subjected to nucleic acid gel electrophoresis. The appropriate gel concentration is selected according to the size of the target product. After electrophoresis, the target fragment is confirmed to be correctly amplified under UV imaging. Fragments of the same size are selected for gel cutting and recovery. The bands are kept as intact as possible and excess gel is removed. The cut gel pieces are collected in a clean 1.5ml centrifuge tube and weighed.

[0034] Add 500 μl of BL to the adsorption column CB2 to equilibrate the column. After centrifugation at 13000 rpm for 1 min, discard the waste liquid.

[0035] Turn on the metal bath and set it to 50°C. Depending on the mass of the gel block, add an equal amount of PC solution to the gel block. Then place the centrifuge tube in the metal bath and heat it. During this process, you can gently turn the centrifuge tube to ensure that the gel block is fully and evenly dissolved.

[0036] Add the melted gel to the equilibrated adsorption column CB2, centrifuge at 13000 rpm for 1 min, and discard the waste liquid.

[0037] Add washing solution PW (with anhydrous ethanol added) to the adsorption column CB2, centrifuge at 13000 rpm for 1 min, discard the waste liquid, and repeat this step once.

[0038] Place the adsorption column CB2 in the collection tube, centrifuge at 13000 rpm for 2 min to completely remove the washing solution, and air dry at room temperature.

[0039] Place the adsorption column CB2 in a new centrifuge tube, add an appropriate amount of DEPC water dropwise into the middle of the adsorption membrane, let it stand at room temperature for 2-5 minutes, and centrifuge at 13000 rpm for 2 minutes. To improve the recovery efficiency, the DEPC water can be preheated to 65°C, or the centrifuged DNA solution can be dropwise back into the middle of the adsorption membrane and the step can be repeated once.

[0040] The concentration of eluted DNA was measured using Nanodrop, and the date, gene name, concentration, and other information were marked before storage at -20°C.

[0041] (3) DNA enzyme digestion Select the corresponding restriction endonuclease based on the enzyme digestion sites of the designed primers. Add the required components to a 200 μl PCR tube according to Table 9, mix thoroughly, incubate briefly, and then place in a 37℃ constant temperature incubator for 1 h for enzyme digestion. After enzyme digestion, recover the enzyme digestion products of the corresponding size according to the DNA recovery steps.

[0042] Table 9 DNA digestion system (4) Plasmid enzyme chain The digested vector plasmid and target DNA fragment were purified and recovered separately. The enzyme ligation reaction system was prepared according to Table 10. The enzyme ligation system was added to a 200 μl PCR tube, mixed thoroughly, and incubated overnight at 4°C.

[0043] Table 10 DNA Enzyme Linking System (5) Plasmid transformation Before plasmid transformation, prepare LB agar plates corresponding to the appropriate antibiotic resistance. Remove the frozen DH5α competent *E. coli* cells from the -80°C freezer and thaw them in an ice pack. After complete thawing, sterilize the bacterial suspension and enzyme-linked product with alcohol, and proceed in a fume hood. Mix the enzyme-linked product with 30 μl of bacterial suspension thoroughly, and incubate the mixture on ice for 30 min. Preheat the water bath to 42°C. After 30 min, heat-shock the mixture in the water bath for 90 s, then immediately place it on ice for 2 min. Add 200 μl of LB medium without ampicillin to a centrifuge tube and shake at 200 rpm for 2-3 h at 37°C. After the LB agar becomes turbid, disinfect it with alcohol and place it in a clean bench. First, sterilize the spreader by burning it with the outer flame of an alcohol lamp and let it cool. Then, take 30 μl of bacterial solution and drop it onto the LB solid agar plate containing ampicillin resistance. Use the cooled spreader to spread the bacterial solution evenly on the surface of the plate. First, place it upright in a 37°C constant temperature incubator. After the bacterial solution is completely immersed in the plate, invert it and incubate for 10-12 hours to prevent water vapor from condensing and falling onto the plate, causing contamination. After the plate has grown evenly and sparsely distributed single-cell clones, it is disinfected with alcohol and placed in a fume hood. It is then sterilized by burning with an alcohol lamp using a sterilized 20μl pipette tip. After cooling, a single colony of suitable size is picked and pipetted into 15ml of LB medium containing ampicillin. The centrifuge tube is then capped and placed in a 37℃ constant temperature shaker at 200rpm for 4-5h. After the bacterial culture becomes turbid, 150μl is taken, labeled, and sent to a biotechnology company for sequencing. After the sequencing results are returned, the sequence is compared. If there are no errors, the bacterial culture can be preserved and expanded to extract plasmids for subsequent experiments.

[0044] (6) Preservation of glycerol bacteria After the sequencing results of the bacterial culture are returned and the comparison is correct, the bacterial culture with the correct sequencing is disinfected with alcohol and placed in a fume hood. Take 500 μl of bacterial culture and 500 μl of 50% sterilized glycerol, add them to a sterilized centrifuge tube, mix well, and mark the bacterial strain information and date. After quick freezing in liquid nitrogen, store in a -80℃ freezer for long-term storage.

[0045] 2.3 Plasmid Extraction All plasmid extractions in this article were performed using an endotoxin-free plasmid extraction kit, and the specific steps are as follows: (1) Take the bacterial culture that has been inoculated from the afternoon to evening of the previous day and cultured on a shaker at 37°C for 10-12 hours, preserve it as needed, and then centrifuge it at 8000 rpm for 3-5 minutes in a room temperature centrifuge. Discard the supernatant, invert the centrifuge tubes onto a flat absorbent paper, let them stand for a while, and thoroughly absorb any excess culture medium from the tubes. Keep the sink faucet running during the process to keep it rinsing. After the process, add 84 disinfectant to disinfect and sterilize, and wipe the work surface with alcohol to avoid contamination.

[0046] (2) Add 500 μl of Buffer P1 (with added RNase A) stored at 4°C to each centrifuge tube, mix well by pipetting, and resuspend the bacterial precipitate evenly. If the pipetting effect is not good, a vortex mixer can be used to shake it thoroughly. After fully resuspending and mixing, transfer the liquid to a 2 ml centrifuge tube.

[0047] (3) Add 500 μl of room temperature Buffer P2 to each centrifuge tube, and gently invert the tube 10 times after capping to ensure that the bacteria and Buffer are fully in contact and lysed. At this time, the liquid in the tube should be clear but viscous. Mix well and let stand at room temperature for 5 minutes.

[0048] (4) Add 500 μl of Buffer E3 to each centrifuge tube, tighten the cap and shake vigorously 20 times. At this time, white flocculent precipitate appears in the tube. Let it stand at room temperature for 5 minutes.

[0049] (5) Place the centrifuge tubes after settling in a room temperature centrifuge and centrifuge at 13,000 rpm for 5 minutes to allow the flocculent material to settle completely or separate from the liquid as much as possible.

[0050] (6) Each time, pipette 750 μl of liquid into the filter column FM, then seal the FM in the collection tube, label it, and centrifuge at 13000 rpm for 1 min in a room temperature centrifuge. Transfer the liquid in the collection tube to a new 2 ml centrifuge tube. Repeat the above steps until all the supernatant has been filtered and collected. During the process, be sure to label the tubes and keep the centrifuge tube, filter column, and collection tube in the correct order.

[0051] (7) Add isopropanol to the collected filtrate at a ratio of 450 μl isopropanol for every 500 μl of Buffer P1 to precipitate the plasmid DNA in the filtrate. After thorough mixing, let stand at room temperature for 15-20 min or in a refrigerator at 4°C for 2-24 h.

[0052] (8) When the standing time is about to end, take out the required number of adsorption columns DL, add 200 μl of Buffer PS to each DL column to balance the filter membrane, centrifuge at 13000 rpm for 2 min at room temperature, and discard the filtrate.

[0053] (9) Add the alcohol precipitation solution to the equilibrated adsorption column DL, adding 750 μl to each tube, centrifuge at 13000 rpm for 1 min at room temperature, discard the filtrate, and repeat this step until all liquid is filtered.

[0054] (10) Add 750 μl of BufferPW (with anhydrous ethanol added) to the adsorption column DL, centrifuge at 13000 rpm for 2 min at room temperature, discard the lower layer of filtrate, put it back into the centrifuge, centrifuge at 13000 rpm for 2 min, and thoroughly dry the filter membrane.

[0055] (11) Place the adsorption column DL in a centrifuge tube in a fume hood and blow air for 5-10 minutes until completely dry.

[0056] (12) Carefully add DEPC water to the middle of the filter membrane, let it stand for 5 minutes, and then centrifuge at 13000 rpm for 2 minutes at room temperature. To improve the plasmid concentration and extraction efficiency, the filtered liquid can be added back to the filter membrane and left to stand for 5 minutes before centrifuging again.

[0057] (13) Label the genes and dates on the centrifuge tubes, use Nanodrop to detect the concentration of the plasmid, and store the labeled concentrations in a -20°C freezer for later use.

[0058] 2.4 Virus Packaging and Infection (1) Prepare virus transfection reagent G according to Table 11, shake it on a vertical shaker overnight, filter it through a 0.22μm filter membrane, and then dispense it into containers and freeze it at -20℃.

[0059] Table 11 Formula for Virus Transfection Reagent (G) (2) Prepare a corresponding number of 10cm dishes of 293T cells according to the required number of virus cells to be packaged. Once the density reaches 50%-60%, prepare to package the virus.

[0060] (3) Prepare plasmid transfection mixture: The amount required to transfect one 10cm dish of 293T cells is: Mix solution A (150μl serum-free and antibiotic-free DMEM medium, 50μl large G) evenly, vortex for 10s, briefly detach and let stand at room temperature for 5min for later use; Mix solution B (200μl serum-free and antibiotic-free DMEM medium, 3μg MD2G plasmid, 6μg PAPAX2 plasmid, 8μg target plasmid), vortex for 10s, briefly detach and let stand. After solution A has been set, mix solution A and solution B evenly, vortex thoroughly, briefly detach and let stand for 15min.

[0061] (4) Discard the original complete culture medium of 293T and replace it with 5ml of serum-free and antibiotic-free DMEM culture medium. Add 400μl of the prepared plasmid packaging mixture to each dish, gently blow and mix evenly, then shake the culture dish to mix the liquid thoroughly. Finally, place it in a 37℃ 5% CO2 incubator for 6-8h.

[0062] (5) After transfection, discard the culture medium containing plasmid and replace it with fresh complete culture medium, adding 12-15 ml to each dish.

[0063] (6) After 48h and 72h of culture, the supernatant was collected respectively. At this time, the supernatant contained the virus produced by 293T cells. The virus solution was centrifuged at 45000rpm for 15min at 4℃. At this time, the precipitate was the detached 293T cells, and the supernatant was the required virus solution. If concentration is not required, it can be directly added to the target cells with a density of 50%-60% for infection.

[0064] (7) If the virus needs to be concentrated, add 5×PEG8000 to the virus solution after centrifugation, place it on a 4℃ rotator overnight to mix it thoroughly, place the overnight rotated virus in a 4℃ centrifuge, centrifuge at 4500rpm for 15min, discard the supernatant, and the precipitate is the concentrated virus. Resuspend it with 100-200μl of complete culture medium and add it to a sterilized 1.5ml centrifuge tube. Label the plasmid and the date, and freeze it in a -80℃ freezer for later use.

[0065] (8) Add virus supernatant or virus concentrate to the target cells for infection. Replace with fresh complete culture medium after 6-8 hours to avoid causing too much damage to the cells. Depending on the infection efficiency, the virus can be added 2-3 times.

[0066] 2.5 RNA Extraction and Reverse Transcription 1. Extract total RNA (1) Select appropriate cell density for RNA extraction according to different experimental needs. Aspirate the original culture medium in the culture dish, add 1-2 ml of 1×PBS, rinse the culture dish thoroughly and then aspirate. Repeat once to completely wash away the original culture medium, add 1 ml of Trizol, gently shake the culture dish to evenly cover the entire bottom surface, let stand for 5 min, and then transfer the mixture to a centrifuge tube. If RNA is not extracted immediately, it can be labeled, flash-frozen in liquid nitrogen and stored at -80℃ for a long time.

[0067] (2) If RNA is to be extracted immediately, turn on the centrifuge to cool down to 4°C, then add 200 μl of chloroform to the mixture of Trizol and cells, gently invert and mix 10-20 times to ensure that the chloroform and Trizol are fully mixed, let stand at room temperature for 5 min, and then centrifuge at 13000 rpm for 15 min at 4°C.

[0068] (3) After centrifugation, carefully aspirate the supernatant, trying not to aspirate the lower Trizol layer and the middle protein layer. Transfer the supernatant to a new enzyme-free centrifuge tube, add 450 μl of isopropanol, and immediately invert the centrifuge tube to mix it evenly. Let it stand at room temperature for 5 min or at 4℃ for 2 h.

[0069] (4) After standing, centrifuge at 13000rpm for 15min at 4℃. Small precipitate clumps appear at the bottom of the centrifuge tube. Discard the supernatant. Add 750μl of freshly prepared 75% ethanol to each tube. Gently tap the centrifuge tube and centrifuge at 13000rpm for 5min at 4℃. Repeat this step and wash the precipitate twice with 75% ethanol.

[0070] (5) To remove 75% ethanol, you can use a 1ml pipette tip with a 20μl pipette tip to remove it as cleanly as possible. Place it in a fume hood and blow it dry for 5-10 minutes to avoid ethanol contamination.

[0071] (6) Add an appropriate amount of DEPC water to dissolve the precipitate, mix thoroughly, and then use Nanodrop to determine the concentration. Place it on ice for later use or freeze it with liquid nitrogen and store it in a -80℃ refrigerator for long-term storage.

[0072] 2. Reverse transcription (1) Generally, take 1 μg of RNA and calculate the required volume of RNA based on the concentration measured above. Take out the required reagents and add them to 200 μl PCR tubes in sequence. The reaction system is shown in Table 12 below. Set the PCR program: 42℃, 2 min.

[0073] Table 12 Genomic DNA Reaction System (2) After the gDNA removal reaction is complete, remove the PCR tube and add 4 μl of 5×HiScriptIIIqRTSuperMix. Vortex the mixture repeatedly, then briefly transfer it to the bottom of the tube and perform the second step reaction in the PCR instrument. The specific program is set as follows: 37℃, 15 min; 85℃, 5 s. After the reaction, a total of 20 μl of cDNA is obtained. Dilute or freeze it as needed for the experiment. For short-term storage, it can be stored at 4℃, and for long-term storage, it should be stored at -20℃.

[0074] 2.6 Real-time quantitative PCR (qPCR) Primers can be designed using NCBI or PrimerBank for the gene being detected. Before qPCR, the primer and cDNA arrangement must be designed and arranged as regularly and compactly as possible. A commonly used qPCR system in the laboratory is 20 μl, with three replicates for each primer for each cDNA to ensure accuracy. qPCR instrument conditions are set as follows: 1 cycle: 95℃, 30 s; 40 cycles: 95℃, 15 s; 60℃, 30 s. Specific reaction systems are shown in Table 13.

[0075] Table 13 qRT-PCR reaction system 2.7 Protein Extraction (1) Place the prepared cell culture dish on ice, discard the original culture medium, add 1×PBS to rinse the cells twice, discard the PBS, rinse the cell scraper with distilled water and PBS respectively, gently scrape the cells in the dish, collect them in a centrifuge tube, centrifuge at 1000rpm for 3-5min at 4℃, discard the supernatant, and keep the cell clumps.

[0076] (2) Add 60-600 μl of RIPA lysis buffer (with added protease inhibitor) depending on the size of the cell pellet, resuspend and mix thoroughly, then place on ice for lysis for 20-30 min.

[0077] (3) After lysis, place the centrifuge tube in a centrifuge at 4°C and centrifuge at 13,000 rpm for 15 minutes. The supernatant is the protein lysis buffer.

[0078] (4) Prepare the BCA reagent required for protein concentration determination. Make 3 replicates for each sample. Add 200 μl of BCA reagent to each well. The ratio of solution A to solution B is 199:1. After thorough vortexing and mixing, add 200 μl to each well of a transparent 96-well plate. Add 1 μl of protein lysis buffer to each well. Gently vortex and mix. Incubate at 37°C for 30 min.

[0079] (5) Use an ELISA reader to measure the absorbance of each well. When setting the program, shake the plate for 3 seconds first, and then measure the absorbance at 562 nm. Calculate the concentration of each protein sample based on the absorbance and the standard curve.

[0080] (6) Based on the concentration calculation, add an appropriate amount of 5× Loading Buffer. For samples with high concentrations, some RIPA lysis buffer can be added to balance the concentration. After adjusting the concentration to be consistent, label the date, sample name, and concentration. Place the sample in a 95℃ metal bath and heat for 5-15 minutes. Be careful to weigh down the lid to prevent it from popping open due to heat and causing sample loss. The boiled sample can be used for WB experiments or frozen at -80℃ for long-term storage.

[0081] 2.8. Western blotting of proteins (1) Select a gel of appropriate concentration according to the size of the target protein, and prepare fresh electrophoresis buffer, transfer buffer, TBST and milk and other reagents.

[0082] (2) Determine the specific amount of sample to be loaded based on the level of expression of the target protein. Load the sample in equal mass. Before loading, the sample can be heated at 95°C for 2 minutes to dissolve it. Then, vortex it to mix it and then quickly transfer it to the bottom of the tube to ensure that the sample is uniform when loaded.

[0083] (3) When loading the sample, pay attention to following your sample order and be careful not to let the sample overflow from the loading well. First, run the electrophoresis at a low voltage of 70-80V until the bromophenol blue reaches the edge of the stacking gel and separating gel, about 20-30 minutes. Then, adjust the voltage to 120-130V and electrophore until the bromophenol blue indicator band reaches the bottom of the gel, then stop the electrophoresis.

[0084] (4) After electrophoresis, prepare for membrane transfer. Fill the tray with ddH2O or transfer buffer, open the transfer sandwich clamps and immerse them in the liquid. Place two sheets of filter paper on each sponge. Cut the PVDF membrane to the appropriate size and pore size, immerse it in methanol and shake for 2 minutes to activate it, then place it on the filter paper. Remove the gel from the glass plate, cut off the excess gel pores, and place it on the PVDF membrane. After each step, gently remove air bubbles with a scraper to ensure that there are no air bubbles or other impurities between the layers. The order should be black gel, white membrane, then clamp the transfer clamps and place it in the transfer tank according to the color direction. Place two ice packs frozen at -80℃ in the tank. After filling the tank with transfer buffer, select the transfer current and time according to the size of the target protein, usually around 250mA, 1KD / 1min. The entire transfer process should be conducted in an ice bath to prevent overheating and membrane curvature.

[0085] (5) After the transfer is completed, the PVDF membrane is clamped with tweezers into 5% skim milk prepared with 1×TBST for sealing. The membrane is sealed at 70 rpm on a shaker at room temperature for 1-2 hours. If necessary, it can also be sealed overnight at 4℃.

[0086] (6) After the PVDF membrane is sealed, use tweezers to place it into a clean TBST and wash it three times at 70 rpm on a shaker at room temperature for 5 minutes each time. After the three washes, place the PVDF membrane into a card holder and cut it according to the molecular weight of the target protein. Then incubate it with the primary antibody corresponding to the different proteins. The dilution concentration of the primary antibody should be selected according to the instructions, usually about 1:1500. Then incubate it overnight on a shaker in a 4°C refrigerator. If necessary, it can also be incubated at room temperature for 2 hours, but this will result in greater loss of the primary antibody.

[0087] (7) After the PVDF membrane has finished incubating with the primary antibody, use tweezers to place it into a clean TBST container and wash it three times at 70 rpm on a shaker at room temperature for 5 minutes each time. After washing, add the prepared secondary antibody of the corresponding species at a concentration of about 1:4000 and incubate it on a shaker at 70 rpm at room temperature for about 2 hours.

[0088] (8) After the secondary antibody incubation, place the PVDF membrane in a clean TBST container with tweezers and wash it three times at 70 rpm on a shaker at room temperature for 5 minutes each time. Immerse the washed PVDF membrane in a 1:1 developing solution (horseradish peroxidase chemiluminescence substrate, solution A: solution B = 1:1), and finally place it on the tray of the chemiluminescence imaging system with tweezers for computer operation, exposure, and development. Name the membrane according to the date and the name of the sample being tested for easy data processing later.

[0089] 2.9 RNA Immunoprecipitation (RIP) This experiment was conducted entirely on ice without enzymes. (1) Washing magnetic beads: Take out ChIP-Grade Protein A / G magnetic beads from a 4℃ refrigerator. According to the experimental calculation, take the corresponding volume of magnetic beads into a 1.5ml enzyme-free centrifuge tube and place it on a magnetic rack. After all the magnetic beads are adsorbed, discard the original solution used to store the magnetic beads, add 500μl of NT2 buffer stored at 4℃, remove the centrifuge tube from the magnetic rack, gently vortex, or gently blow and mix with a cut pipette tip, then place the centrifuge tube on the magnetic rack, discard the NT2 buffer, and repeat the washing 3 times. Add 150μl of NT2 buffer to resuspend the washed magnetic beads and divide them equally into new 1.5ml centrifuge tubes.

[0090] (2) Incubation of magnetic beads and antibodies: Add 2 μg of the corresponding antibody to each centrifuge tube, mix by pipetting, and then place it in a centrifuge at room temperature for 1-2 hours. After incubation, place the magnetic bead tube on a magnetic rack and wash it 3 times with pre-cooled NT2 buffer.

[0091] (3) Cell lysis: Wash the target cells three times with DEPC-PBS pre-cooled at 4℃, scrape off the cells and transfer them to a new enzyme-free centrifuge tube. Centrifuge at 1000 rpm for 3 min, discard the supernatant, and add 204 μl of lysis buffer (200 μl NT2 buffer, 2 μl RNase inhibitor, 2 μl cocktail) to the tube. Resuspend the cell pellet and mix well. Place the tube in an ice box for about 30 min to lyse. After lysis, centrifuge at 13000 rpm for 15 min at 4℃. Transfer the supernatant to a new centrifuge tube.

[0092] (4) Take Input Sample: Take 10% of the supernatant in the centrifuge tube as Input Sample and store it at -80℃.

[0093] (5) Mixing the sample with the magnetic beads: Mix the sample with the cleaned magnetic beads, add 900 μl NT2 buffer, 2 μl RNase inhibitor and 35 μl 0.5 MEDTA, resuspend and mix well, then place in a 4℃ rotator for about 3 hours, and wash the magnetic beads 5-6 times with NT2 buffer.

[0094] (6) Take out the Input sample, add 135 μl NT2 buffer, 17 μl 10% SDS and 1.8 μl proteinase K to each sample including the Input, place it in a preheated 55℃ metal bath and shake at 800 rpm for 30 min, then place it on a magnetic rack and take the supernatant into a new centrifuge tube.

[0095] (7) Purify RNA using an RNA purification kit or the Trizol method.

[0096] (8) Perform reverse transcription and qPCR detection according to the above steps.

[0097] 2.10 Cell proliferation To further observe the effect of knockdown on cell function, cell growth was assessed using the CellTiter-GloLuMinescent™ CellAssay (CTG) kit. The specific steps are as follows: (1) Before operation, the CTG reagent frozen at -20℃ can be taken out and thawed in the dark. Stable cell lines confirmed by qPCR or WB to have been successfully knocked down are digested with trypsin. The culture dish is gently shaken to completely cover the bottom surface. The cells are allowed to digest statically until they become round or detach in small areas. Then, 2 ml of fresh complete culture medium is added to stop the digestion to avoid damaging the cells. The cells are collected in a 15 ml centrifuge tube, centrifuged at 1000 rpm for 3 min, and the supernatant is discarded.

[0098] (2) Add an appropriate amount of culture medium to the precipitate in the tube and mix by pipetting. Take 20 μl of the cell suspension into a new sterilized centrifuge tube and add 180 μl of PBS to dilute the cell concentration to 1 / 10 of the original concentration. Gently invert and mix.

[0099] (3) After gently blowing and mixing, take 10 μl of the diluted cell suspension and drop it onto the edge of the hemocytometer slide covered with a glass slide to ensure that the cell suspension penetrates into the central counting chamber. Try not to generate air bubbles when dropping the cell suspension. Let it stand for 1-2 minutes to allow the cells to settle completely. Use an inverted microscope to observe the cells and count them. When counting, you can select the square grid in the four corners to read the cell density according to your habit.

[0100] (4) According to the dilution concentration, add an appropriate amount of fresh culture medium to the centrifuge tube to dilute the cells so that the final concentration of 100 μl of the centrifuge tube contains 1500 cells; add 100 μl of cell dilution to each well of the 96-well plate, and seed the cells for days 0, 3 and 5 according to the measurement time nodes. Add 100 μl of CTG to the cells on day 0. During the operation, the lights of the clean bench should be turned off. Take a black ELISA plate, gently mix the CTG and cell mixture in the 96-well plate, and add 100 μl to the black ELISA plate according to the seeding order. Wrap the plate with aluminum foil and take out the clean bench. Use an ELISA reader to measure the luminescence intensity of CTG. Each cell should be seeded in at least 3 replicates for each experiment.

[0101] (5) Read the data once on the day of plate laying, and once on the third and fifth days. Take the average value of the three replicates. Normalize the readings on the day of plate laying, calculate the proliferation rate of each group, and use GraphPad to draw the proliferation curve.

[0102] 2.11. In vitro transcription construction of secondary structures and RNA pulldown 1. In vitro transcription and construction of secondary structures (1) The target fragment was cloned into the pCDNA3.1 vector, digested with the corresponding restriction endonuclease, mixed and incubated in a 37°C oven for linearization.

[0103] (2) Add 3M sodium acetate to the enzyme digested product at a ratio of 1:0.1 and add anhydrous ethanol at a ratio of 1:2.2. After mixing, place at -80℃ for 2 hours for alcohol precipitation.

[0104] (3) After the alcohol precipitation is completed, transfer the liquid to a new enzyme-free centrifuge tube and centrifuge at 13,000 rpm for 15 min at 4°C. Discard the supernatant and add 800 μl of freshly prepared 75% ethanol to each tube. Centrifuge at 13,000 rpm for 5 min at 4°C and discard the supernatant. Repeat this step to wash the precipitate twice.

[0105] (4) Discard the supernatant, place it in a fume hood and blow for 10 minutes, then add an appropriate amount of DEPC water to dissolve it, depending on the size of the precipitate.

[0106] (6) Measure the DNA concentration with Nanodrop, place it on ice for later use or freeze it in liquid nitrogen and store it in a -80°C freezer.

[0107] (7) Prepare the in vitro transcription reaction system in an enzyme-free 200 μl tube according to Table 14. After mixing, incubate in a 37℃ oven for 2-4 h.

[0108] Table 14 In vitro transcription reaction system (8) To obtain biotin-labeled RNA, replace UTPSolution with Biotin-16-UTPSolution.

[0109] (9) Add 1 μl DNase I to the in vitro transcript, mix well and incubate in a 37°C oven for 15 min to digest the DNA template in the system.

[0110] (10) After incubation, add 2.3 times the volume of alcohol precipitation reagent and mix well. After alcohol precipitation, recover the RNA. Add an appropriate amount of DEPC water according to the size of the precipitate and use Nanodrop to determine the RNA concentration.

[0111] (11) Configure the nucleic acid secondary structure reaction system according to Table 15, and carry out the reaction in a PCR instrument. The reaction conditions are: 90℃ for 1 min; decrease the temperature by 0.1℃ every 5 seconds until it reaches 25℃ for about 60 min; maintain the temperature at 4℃ for a long time. The reactants can be stored at -80℃ for a long time.

[0112] Table 15 Nucleic Acid Secondary Structure Reaction System 2. RNAPulldown (1) Prepare 6 10cm dishes with a cell density of 95%, wash twice with DEPC-PBS pre-cooled at 4℃, discard DEPC-PBS, add 200μl RIPA lysis buffer (RNase inhibitor and protease inhibitor added) to each dish, collect the lysis buffer in enzyme-free centrifuge tubes, lyse on ice for 30min, and centrifuge at 13000rpm for 15min at 4℃.

[0113] (2) The protein concentration of the lysate was determined by the BCA method. 2 mg of protein and 5 pmol of biotinylated RNA that formed a secondary structure were incubated at room temperature for 1 h on a rotary instrument.

[0114] (3) Add streptavidin magnetic beads that have been washed 3 times with RIPA lysis buffer and incubate at 4°C for 3 hours in a rotary instrument. Wash 5 times with RIPA lysis buffer.

[0115] (5) Add 20 μl of 1×LoadingBuffer to the cleaned magnetic beads, mix well, heat in a 95°C metal bath for 5 min, and perform SDS-PAGE analysis on the proteins bound to the magnetic beads.

[0116] 2.12. Electrophoretic Migration Assay (EMSA) (1) Clean the gel casting plate and wipe it dry to ensure that there is no SDS or other impurities remaining. Prepare 10 ml of EMSA gel solution according to Table 16, vortex thoroughly, and sonicate in an ultrasonic cleaner for 30 seconds to remove air bubbles. Pour the solution into the gel casting plate, insert the comb, and wait for the gel to polymerize and solidify.

[0117] Table 16 EMSA Gel Formulation (2) Perform the EMSA binding reaction in an enzyme-free 200 μl PCR tube. Prepare the EMSA binding reaction system according to Table 17 as needed. After mixing, react at room temperature for 30 min. Different reaction temperatures and times can be selected depending on the sample.

[0118] Table 17 EMSA binding reaction system (3) After the reaction is complete, add 1 μl of EMSA / Gel-Shift loading buffer (colorless, 10×), mix well and load the sample immediately. It is recommended to use colorless loading buffer to avoid bromophenol blue interfering with the binding of protein and DNA.

[0119] (4) Use 0.5×TBE as the electrophoresis buffer and pre-electrophoresis for 10 min. Add the sample to the sample well, add the sample buffer (blue) to the empty well as an indicator, and electrophore at 10 V / cm in an ice bath, ensuring that the gel temperature does not exceed 30℃. The usual electrophoresis conditions are: 120V, 90 min, stop electrophoresis when the bromophenol blue reaches 1 / 4 of the bottom edge of the gel.

[0120] (5) Cut a positively charged nylon membrane to a suitable size, mark the corners, and soak it in 0.5×TBE for at least 10 minutes to activate the nylon membrane. After wetting two filter papers, place the nylon membrane, EMSA adhesive, and another filter paper in sequence, taking care to avoid air bubbles. Use a wet electrotransfer apparatus with 0.5×TBE as the transfer solution. Place an ice box frozen at -80°C in the transfer tank and place it in an ice bath. Transfer at 380mA for 90 minutes. After the transfer is complete, carefully remove the nylon membrane, gently blot off the surface liquid, and immediately proceed with crosslinking.

[0121] (6) Use an ultraviolet crosslinker or a portable ultraviolet lamp for crosslinking at 0.15 J / cm2 for 3-5 min.

[0122] (7) Dissolve the blocking and washing solutions. Place the crosslinked membrane in the blocking solution and shake for 15-30 minutes. Add Streptavidin-HRPConjugate at a ratio of 1:2000 and continue shaking for 15-30 minutes. After recovering the HRP staining solution, prepare the washing solution with ddH2O and rinse the nylon membrane four times, about 5 minutes each time. Finally, place the nylon membrane in the detection equilibration solution and shake for 5 minutes to equilibrate the nylon membrane. Prepare the BeyoECLMoon working solution at a ratio of solution A: solution B of 1:1 and perform detection in the developing instrument. Mark the date and sample name for subsequent data processing.

[0123] (8) If necessary, a biotin-free probe can be added to the binding reaction step for a competitive experiment or a specific antibody against the target protein can be added for a supermigration experiment.

[0124] 2.13 Dual-luciferase reporter assay (1) Digest 293T cells and seed them into 24-well plates. Incubate at 37°C for 24 hours until they are fully adhered and the density reaches 30%-40%.

[0125] (2) Add 50 μl of jetPRIME® buffer, 0.6 μg of firefly luciferase reporter gene construct, and Renilla luciferase control plasmid (1:1 ratio) to a sterile centrifuge tube. Vortex to mix, then add 1 μl of jetPRIME® reagent, mix well, and let stand at room temperature for 10 min. After standing, mix the transfection reagent with 500 μl of complete culture medium and gently add it along the wall of the tube into the well.

[0126] (3) After transfection, mark the transfected plasmid and the date on the well plate. Place the cells in an incubator and change the medium after 6-8 hours with fresh complete medium. Continue culturing for another 48 hours to ensure that the reporter gene has enough time to be expressed.

[0127] (4) After 48 hours, remove the 24-well plate from the incubator, place it on ice, discard the culture medium, gently rinse twice with 1×PBS, add 200 μl of lysis buffer to each well, gently shake to mix, and place on ice for lysis for 5 minutes. After lysis, subsequent experiments can be performed directly or the lysis buffer can be frozen and stored in a -80℃ freezer for long-term storage.

[0128] (5) Add 20 μl of lysis buffer to a white microplate. Dilute the firefly luciferase substrate to 1× working solution concentration using the corresponding buffer according to the instructions. Add 100 μl of firefly luciferase substrate to each well, shake to mix, and use a microplate reader to detect the activity of firefly luciferase.

[0129] (6) Then, according to the instructions, use the corresponding buffer to dilute the Renaissance luciferase substrate to 1× working solution concentration, add 100 μl of Renaissance luciferase substrate to each well, shake to mix, and use an ELISA reader to detect the activity of Renaissance luciferase.

[0130] (7) Using the activity of Renidae luciferase as an internal reference, the activity data of firefly luciferase were calibrated to correct for differences in transfection efficiency and cell number.

[0131] 2.14 Immunofluorescence (1) Select cells with high knockdown or overexpression efficiency. When the cells grow to 85%-95% density, passage them. After digestion and centrifugation, resuspend the precipitate with 1 ml of culture medium. Depending on the size of the precipitate, add 10-20 μl of cell suspension to a sterile 2 ml centrifuge tube. Add 1-2 ml of fresh complete culture medium to the centrifuge tube, mix well, and then add it to a confocal dish. Gently shake the dish to spread the culture medium evenly on the bottom surface. Then incubate at 37℃ for 12-24 h until the cells are completely adhered to the wall.

[0132] (2) When the cells adhere to the wall and the density is appropriate, take out the confocal dish, discard the original culture medium, add 1-2 ml of 1×PBS, soak for 5 min, discard the PBS after soaking, repeat the washing step 3 times, finally remove the excess PBS from the dish, add 500 μl of 4% paraformaldehyde, and fix at room temperature for 15 min.

[0133] (2) After fixation, discard paraformaldehyde, add 1-2 ml of PBS, and wash for 5 min. After washing, discard the PBS and repeat the washing step 3 times. After discarding the PBS, add 500 μl of 0.1% Triton X-100 to each dish to permeate the cells and let it stand at room temperature for 15 min.

[0134] (3) After discarding Triton X-100, add 1-2 ml of PBS and wash for 5 min. After washing, discard the PBS and repeat the washing step 3 times. After discarding the PBS, add 500 μl of 3% BSA to each dish and incubate the cells at room temperature for 1 h to block them.

[0135] (4) Recover 3% BSA, add 500 μl of diluted primary antibody to each dish, place on a shaker at 4°C and incubate overnight at 70 rpm. The dilution ratio of the primary antibody is recommended by the official website and is generally around 1:200.

[0136] (5) Recover the primary antibody, add 1-2 ml of PBS, and wash for 5 min. After washing, discard the PBS and repeat this step 3 times. After discarding the PBS, select a suitable fluorescent secondary antibody according to the species of the primary antibody and the required fluorescence band, dilute it according to the ratio, add 500 μl of the corresponding fluorescent secondary antibody to each dish, and incubate at room temperature on a shaker at 70 rpm for 1 h. From the time the secondary antibody is added, this experiment needs to be conducted in the dark to avoid fluorescence quenching caused by light exposure.

[0137] (6) Recover the secondary antibody, add 1-2 ml of PBS, and wash for 5 min. After washing, discard the PBS and repeat this step 3 times. After discarding the PBS, add 500 μl of prepared DAPI to each dish and let it stand at room temperature for 5 min to stain the cell nuclei.

[0138] (7) Recover DAPI, add 1-2 ml of PBS, soak for 5 min, discard the PBS after soaking, and repeat this step 3 times.

[0139] (8) Use a confocal microscope to obtain immunofluorescence images of cells, and label the genes, cell lines and dates for subsequent data processing and analysis.

[0140] 2.15. Ribosome isolation (1) Prepare two 15cm dishes for each sample. When the cell density reaches about 95%, add cycloheximine (CHX) to the culture medium to a final concentration of 100μg / ml. Gently shake the culture dish to distribute it evenly and incubate the cells at 37℃ for 10min.

[0141] (2) Use 4℃ pre-cooled DEPC-PBS containing 20μg / mlCHX to thoroughly rinse the cells, discard the DEPC-PBS, repeat this step to rinse the cells twice, scrape the cells and collect them in an enzyme-free centrifuge tube, centrifuge at 3000rpm for 5min at 4℃, and discard the supernatant.

[0142] (3) Add 600 μl of lysis buffer to the centrifuge tube, mix thoroughly with a pipette tip to completely resuspend the cell clumps, and place on ice for lysis for 30 min.

[0143] (4) Centrifuge the lysed cells at 13,000 rpm for 15 min at 4°C and collect the supernatant.

[0144] (5) Use the BCA method to measure the protein concentration in the supernatant and make adjustments to ensure that the concentration is consistent between samples. Alternatively, count the cells the day before seeding and conduct the experiment with equal cell counts.

[0145] (6) Prepare the sucrose base solution according to Table 18. Add 1 mMMDTT, RNase inhibitor, protease inhibitor, and CHX before use. Weigh 7.5 g and 22.5 g of sucrose into two labeled 50 ml centrifuge tubes, add the sucrose base solution to make up to 50 ml, and vortex thoroughly to promote sucrose dissolution. Prepare 15% and 45% sucrose solutions. If there are obvious bubbles in the tubes, they can be removed by sonication for 5-10 seconds. Prepare a 15%-45% sucrose gradient using a gradient generator.

[0146] Table 18 Sucrose-based solution formulation (7) Carefully add the cell lysis buffer to the top of the sucrose gradient and balance each centrifuge tube, controlling the mass difference to within 0.01g to prevent the centrifuge from reporting an error. Turn on the centrifuge beforehand to cool it down, and place the rotor and tube sleeves in a 4°C refrigerator for pre-cooling. After the samples are balanced, ultracentrifuge at 38,000 rpm for 3 hours at 4°C.

[0147] (8) After ultracentrifugation, 12 fractions were collected from top to bottom using a fractionation system, and the UV absorbance at 260 nm and 280 nm was monitored to detect RNA and protein peaks.

[0148] (9) Extract RNA from each fraction using an RNA extraction kit or Trizol.

[0149] (10) Measure RNA concentration and perform RT-qPCR analysis to determine the distribution of specific RNA in each component.

[0150] 2.16 Chromatin Immunoprecipitation (ChIP) (1) Place the target cells cultured to 85%-95% density on ice, add 2-5 ml PBS to each dish and gently shake the culture dish to thoroughly rinse the cells. Discard the PBS and repeat the washing process twice. Then discard the original PBS. At room temperature, add 1 ml PBS and 28 μl of 37% formaldehyde solution to each dish to make the final formaldehyde concentration 1%. Shake at 70 rpm for at least 10 min at room temperature to perform cross-linking, but the room temperature should not exceed 25°C.

[0151] (2) Add 125mM glycine to each petri dish to quench the formaldehyde crosslinking. After adding glycine, gently shake the petri dish to mix it evenly and let it stand at room temperature for 5 minutes to terminate the crosslinking reaction.

[0152] (3) Scrape the cells and collect them in a centrifuge tube. Centrifuge at 1000 rpm for 3-5 min at 4°C. After removing the supernatant, resuspend the cell pellet in 1 ml of pre-cooled PBS, wash once, and centrifuge again at 1000 rpm for 3-5 min. Discard the PBS completely, add 500 μl of RIPA lysis buffer to the centrifuge tube, resuspend the cell pellet and mix well, and lyse on ice for 30 min.

[0153] (4) Sonicate the lysate. To ensure uniform fragmentation after sonication, the same sample can be collected into one tube and sonicated simultaneously. Place the centrifuge tube in an ice bath, set the sonication power to below 50%, sonicate for 5 seconds, and then sonicate for 10 seconds to break the chromatin into DNA fragments of 200-500 bp. The specific sonication time and power can be determined by the user. After sonication, centrifuge at 13000 rpm for 10 minutes in a 4℃ centrifuge and remove the cell nuclear fragments and other insoluble substances from the sample.

[0154] (5) Take 5% or 10% of the lysate as the input control group and do not perform immunoprecipitation. Add specific antibody or IgG control to the lysate. The amount of antibody required for each precipitation reaction is 2-5 μg. Incubate at 4°C in a rotary vat for at least 3 hours or overnight to perform immunoprecipitation on the chromatin.

[0155] (6) Take an appropriate amount of protein A / G magnetic beads, wash them 3 times with PBS, discard the PBS, resuspend the magnetic beads with an appropriate amount of PBS and mix well, add the washed magnetic beads to the antibody-chromatin complex, and incubate at 4°C for at least 2 hours to capture the antibody-chromatin complex.

[0156] (7) Wash the magnetic beads 5 times with PBS to remove non-specifically bound substances, and then elute the chromatin.

[0157] (8) Perform reverse cross-linking treatment on the eluted chromatin to release DNA. Add 6 µL of 5M NaCl and 2 µL of LRNase A to all magnetic bead tubes and input tubes, respectively. Incubate at 37°C for 30 min. Then add 2 µL of proteinase K and heat in a 65°C metal bath with shaking at 300 rpm for at least 4 h. Purify the DNA in the supernatant using a universal DNA recovery kit.

[0158] (9) Perform qPCR analysis on the purified DNA to assess the enrichment of specific DNA regions. Calculate the enrichment percentage of the target DNA region based on the qPCR results.

[0159] 2.17, CUT & TAG (1) Place the target cells cultured to 85%-95% density on ice, add 2-5 ml PBS to each dish and gently shake the culture dish to thoroughly rinse the cells. Discard the PBS and repeat the washing process twice. Then discard the original PBS. At room temperature, add 1 ml PBS and 28 μl of 37% formaldehyde solution to each dish to make the final formaldehyde concentration 1%. Shake at 70 rpm for at least 10 min at room temperature to perform cross-linking, but the room temperature should not exceed 25°C.

[0160] (2) Add 125mM glycine to each petri dish to quench the formaldehyde crosslinking. After adding glycine, gently shake the petri dish to mix it evenly and let it stand at room temperature for 5 minutes to terminate the crosslinking reaction.

[0161] (3) Scrape the cells and collect them in a centrifuge tube. Centrifuge at 1000 rpm for 3-5 min at 4°C. After removing the supernatant, resuspend the cell pellet in 1 ml of pre-cooled PBS, wash once, and centrifuge again at 1000 rpm for 3-5 min. Discard the PBS completely, add 500 μl of RIPA lysis buffer to the centrifuge tube, resuspend the cell pellet and mix well, and lyse on ice for 30 min.

[0162] (4) Sonicate the lysate. To ensure uniform fragmentation after sonication, the same sample can be collected into one tube and sonicated simultaneously. Place the centrifuge tube in an ice bath, set the sonication power to below 50%, sonicate for 5 seconds, and then sonicate for 10 seconds to break the chromatin into DNA fragments of 200-500 bp. The specific sonication time and power can be determined by the user. After sonication, centrifuge at 13000 rpm for 10 minutes in a 4℃ centrifuge and remove the cell nuclear fragments and other insoluble substances from the sample.

[0163] (5) Take 5% or 10% of the lysate as the input control group and do not perform immunoprecipitation. Add specific antibody or IgG control to the lysate. The amount of antibody required for each precipitation reaction is 2-5 μg. Incubate at 4°C in a rotary vat for at least 3 hours or overnight to perform immunoprecipitation on the chromatin.

[0164] (6) Take an appropriate amount of protein A / G magnetic beads, wash them 3 times with PBS, discard the PBS, resuspend the magnetic beads with an appropriate amount of PBS and mix well, add the washed magnetic beads to the antibody-chromatin complex, and incubate at 4°C for at least 2 hours to capture the antibody-chromatin complex.

[0165] (7) Wash the magnetic beads 5 times with PBS to remove non-specifically bound substances, and then elute the chromatin.

[0166] (8) Perform reverse cross-linking treatment on the eluted chromatin to release DNA. Add 6 µL of 5M NaCl and 2 µL of LRNase A to all magnetic bead tubes and input tubes, respectively. Incubate at 37°C for 30 min. Then add 2 µL of proteinase K and heat in a 65°C metal bath with shaking at 300 rpm for at least 4 h. Purify the DNA in the supernatant using a universal DNA recovery kit.

[0167] (9) The purified DNA was repaired at the ends and ligated with adapters, and then PCR amplified to obtain a sufficient amount of DNA for sequencing.

[0168] (10) Perform high-throughput sequencing on the amplified DNA to determine transcription factor binding sites.

[0169] (11) Analyze the sequencing data to determine the DNA binding regions of transcription factors and compare them with known genomic information to reveal the binding map of transcription factors on the genome.

[0170] 2.18. RNA enzyme digestion (1) Select the cell line to be digested with enzymes. When the cells grow to a density of 85%-95%, extract RNA using the Trizol method. If enzyme digestion is required immediately, proceed directly to the next step. If subsequent experiments are not to be carried out immediately, the cells can be quick-frozen in liquid nitrogen and stored in a -80°C freezer.

[0171] (2) Select the corresponding RNA enzyme according to the experimental purpose, and determine the reaction system, temperature and time according to the instructions.

[0172] (3) If RNase A is used, prepare the reaction system in a 200 μl PCR tube according to Table 19, mix thoroughly, then transfer to the bottom of the tube and incubate in a 37℃ constant temperature incubator for 20-40 min to perform enzyme digestion.

[0173] Table 19 RNaseA digestion system (4) After the enzyme digestion is completed, add alcohol precipitation reagent to the tube at a ratio of 1:2.3, mix thoroughly and then place in a -80℃ refrigerator for alcohol precipitation for 2 hours.

[0174] (5) After alcohol precipitation, the RNA was recovered and reverse transcribed using an equal volume loading method. Then, the gene memory qPCR to be tested was selected.

[0175] 2.19. Site-directed mutation (1) Use PCR technology or homologous recombination to clone the target gene into a suitable expression vector to ensure that the target gene sequence is correct.

[0176] (2) Design a pair of complementary primers containing the mutation sequence to be introduced according to the required mutation site, perform PCR reaction using high-fidelity polymerase, and introduce the mutation using the cloned target gene as a template.

[0177] (3) The parent strand was digested with DpnI enzyme, and only the daughter strand DNA containing the mutation was retained. Then the DNA containing the mutation was transformed into E. coli for amplification.

[0178] (4) Transformed bacterial clones were obtained by antibiotic screening and plasmid DNA was extracted. Restriction enzyme digestion and / or DNA sequencing were used to verify whether the mutation was successfully introduced.

[0179] (5) The verified gene clone containing the mutation is returned to the expression vector to construct an expression vector containing site-directed mutation.

[0180] (6) Use liposome-mediated transfection or electroporation to transfect expression vectors containing mutant genes into target eukaryotic cells.

[0181] (7) Detect the expression level of mutant proteins and analyze their functional changes. Statistically analyze the experimental results to determine the effect of site-directed mutation on gene function.

[0182] 2.20 Statistical Analysis Each group of data in the above experiments was replicated three times independently. Data were presented as mean ± standard deviation (SD) or mean ± standard error (SEM). Two-tailed Mann-Whitney or Student's-test tests were used to compare differences between the control and experimental groups; the Spearman test was used to analyze the correlation between the expression levels of two molecules. Prism or FlowJo software was used for experimental data analysis. When the difference between groups was statistically significant, This indicates that p < 0.05. p<0.01, p < 0.001. When the difference between groups is not statistically significant, ns (nosignificant) is used.

[0183] 3. Results Analysis 3.1 ICAM1 / ICAM1-AS binds to ILF3 protein In previous studies, we found that ICAM1 and its reverse complementary strand ICAM1-AS can bind to and protect each other, and have the opposite effect on cell proliferation phenotype to that of the ICAM1-encoded protein. After knocking out the protein using CRISPR / Cas9, cell proliferation was significantly reduced, while after knocking down the RNA and protein levels of ICAM1 using small interfering RNA, cell proliferation was significantly increased.

[0184] To investigate the specific molecular mechanism by which ICAM1 / ICAM1-AS double-stranded RNA inhibits cell proliferation, we performed an RNA pulldown assay in lung adenocarcinoma cell lines. Using LacZ as a negative control and ICAM-AS as the experimental group, we observed three distinct specific bands in the ICAM1-AS pulldown lane. Label-free comparative LC / MS-MS analysis of these bands identified two candidate splice variants (NF90 / NF110) of ILF2 and ILF3 as related proteins. Figure 1 A).

[0185] To verify the interaction between ILF3 and ICAM1 / ICAM1-AS, we combined publicly available ILF3eCLIP data with genomic cis-antisense transcripts. This analysis revealed 242 cis-antisense transcripts that may bind to ILF3. We individually labeled potential ILF3 binding sites on chromosome 19 and found that the ICAM1 / ICAM1-AS site, which we are currently investigating, was also included. Figure 1 (B, C). The binding site is dsRBD2. After confirming the binding site, a binding domain can be constructed based on the characteristics of the binding site to predict binding ability or detect the binding efficiency of dsRNA. 3.2 ICAM1 / ICAM1-AS dsRNA binds to ILF3 and regulates cell proliferation Since ILF3 protein is known to possess a double-stranded RNA-binding domain (dsRBD), to verify whether there are differences in the binding between ICAM1 / ICAM1-AS double-stranded RNA and single-stranded RNA and ILF3, we performed RNA immunoprecipitation using ICAM1, ICAM1-AS single-stranded RNA, and ICAM1 / ICAM1-AS double-stranded RNA in A549 cells with relatively low ILF3 expression and Calu-1 cells with relatively high ILF3 expression, respectively. Western blot electrophoresis analysis showed that dsRNA pulled down significantly more ILF2 / ILF3 complexes than single-stranded RNA. Figure 2 A). To verify whether there is a direct binding between NF90 protein and ICAM1 / ICAM1-AS double-stranded RNA, we performed an electrophoretic migration assay (EMSA) and observed a clear binding band ( Figure 2 B). Next, we performed RIP experiments using antibodies against ILF2 and ILF3. The results showed that ILF2 and ILF3 could specifically enrich ICAM1 and ICAM1-AS, further confirming the interaction between ILF2 / ILF3 and ICAM1 mRNA and ICAM1-AS. Figure 2 C).

[0186] Based on protein structure analysis, ILF3 possesses two dsRBDs. To verify which dsRBD plays a primary role in dsRNA binding, we constructed ILF3 mutants with selective RBD deletion and performed RIP experiments. The results showed that the enrichment of dsRNA in NF90 and NF110 cells lacking dsRBD2 was significantly reduced. This experiment elucidates region-specific interactions and reveals the importance of the RBD2 domain for ICAM1 / ICAM1-AS binding. Figure 3A, B). Next, we wanted to verify whether ILF3 and dsRNA were consistent in their localization. Through immunofluorescence, we observed that ILF3 and total dsRNA in the cell nucleus were significantly co-localized ( Figure 3 C).

[0187] Next, we wanted to verify whether ICAM1KD had any effect on this colocalization, so we performed immunofluorescence experiments using cell lines containing ICAM1KD. We found that the colocalization remained essentially unchanged, and ICAM1KD did not alter the mRNA or protein levels of ILF3. Figure 4 A, B). Furthermore, ILF3KD did not affect ICAM1 mRNA or ICAM1-AS levels, but significantly reduced the binding of ILF2 and ILF3 to ICAM1 / ICAM1-AS (A,B). Figure 4 CD).

[0188] Knockdown of ILF3 in the HCC827 cell line and detection of cell proliferation using the CTG assay revealed that KDILF3 significantly inhibited cell proliferation. Figure 5 A). Next, we further KD-treated ILF3 in the ICAM1-treated cell line and performed CTG assays to detect cell proliferation. The results showed that cell proliferation increased by KD-treated ICAM1 was inhibited by KD-treated ILF3. Figure 5 B).

[0189] Correspondingly, we further KD-treated ICAM1 or ICAM1-AS in the ILF3KO cell line and found that KO of ILF3 completely inhibited the cell proliferation-promoting effect of KD-treated ICAM1 or ICAM1-AS. Figure 5 C). In summary, these results indicate that ICAM1 / ICAM1-ASdsRNA regulates cell proliferation through ILF3.

[0190] 3.3 ICAM1 Regulation of the Genome-Wide Combination of the ILF2 / ILF3 Complex Since ILF2 / ILF3 are known DNA-binding proteins, we further investigated whether the binding of ICAM1 to ILF2 / ILF3 affects their binding to the genome. We performed cut & tag experiments on KD-treated and wild-type cells. The results showed that after ICAM1 KD, ILF2 / ILF3 were widely localized around the whole-genome transcription start site (TSS), indicating that ICAM1 inhibits the genome-binding ability of ILF2 / ILF3. Figure 6 A, B).

[0191] Genomic distribution analysis of ILF2 / ILF3 binding sites showed that the altered binding pattern after ICAM1KD is mainly located in the promoter regions of protein-coding genes. Figure 7 A). We identified several highly enriched DNA-binding sequences for ILF3 and ILF2 through motif analysis ( Figure 7 B). The predicted most affinity motif for ILF3 is "ATTGG", while ILF2 also shows a strong preference for the "ATTGG" sequence.

[0192] 3.4 ICAM1 Regulation of the Genome-Wide Combination of the ILF2 / ILF3 Complex To verify whether this sequence can directly bind to the ILF3 protein, we designed a probe using this motif and performed an EMSA experiment with the NF90 protein. The results showed that NF90 binds to the double-stranded probe of this motif. Figure 8 A). To verify the importance of this predicted motif for NF90 binding, we performed dual-luciferase reporter gene analysis using the motif and its mutant version. The results showed that NF90 specifically binds to the predicted motif sequence, but binding to the mutant sequence is significantly weakened (A). Figure 8 B).

[0193] Next, we used a DNA probe containing the ATTGG motif and an RNA probe containing the AUGG sequence from ICAM1 to detect the binding efficiency of NF90 with DNA and RNA using EMSA, verifying whether there was a difference in the binding ability of NF90 with DNA and RNA. The experimental results showed that compared with DNA, RNA required a smaller amount to achieve a clear binding band with NF90, and the binding efficiency of RNA with NF90 was higher. Figure 9 A). Next, we wanted to verify the effect of this core motif on binding. Therefore, we performed EMSA experiments using RNA and DNA probes with the core motif, as well as mutated RNA and DNA probes. The results showed that there was no significant difference in the binding of the RNA probes before and after the mutation to NF90. However, the binding affinity of the DNA probe with the mutated core motif to NF90 was significantly weaker than that of the unmutated DNA probe. The mutation of the core ATTGG sequence significantly impaired the DNA binding affinity of NF90. However, the mutation of the AUGG sequence did not reduce the RNA binding affinity of NF90, which is consistent with the non-sequence-specific dsRBP. Figure 9 B).

[0194] 3.5 Genome-wide combination of ICAM1 regulation of the ILF2 / ILF3 complex Next, we wanted to investigate whether the binding of NF90 to RNA would affect its binding to DNA. By adding ICAM1 / ICAM1-AS dsRNA of different lengths for interference, we performed a DNA pull-down assay using a DNA motif probe to explore whether the binding of RNA to ILF3 would interfere with its ability to bind to DNA. The results showed that both the addition of dsRNA probes and full-length dsRNA could interfere with the binding of DNA to NF90. Full-length ICAM1 / ICAM1AS significantly inhibited the binding of ILF3 to the DNA probe, while short dsRNA probes had only limited inhibitory effects. Figure 10 A). Next, we wanted to investigate whether the interference of dsRNA on DNA binding to NF90 was related to its length. Therefore, in a DNA pull-down experiment using DNAmotif on NF90, we added equal amounts of dsRNA of different lengths. The results showed that the longer the added dsRNA, the weaker the DNA-NF90 binding band. Therefore, we concluded that the inhibitory effect of ICAM1 dsRNA on ILF3 binding to DNA depends on the length of the dsRNA. Figure 10 (B, C). In summary, these findings highlight that ICAM1 and its antisense RNA regulate the binding dynamics of ILF2 / ILF3 to genomic DNA.

[0195] 3.6 ICAM1 affects the binding of ILF2 / ILF3 to the EIF4E promoter To further investigate the potential mechanisms by which the ICAM1 / ICAM1-AS / ILF2 / ILF3 complex influences cell fate, we integrated transcriptomics and CUT&Tag data analysis, identifying 728 genes that may be regulated by the ICAM1 / ICAM1-AS and ILF2 / ILF3 complexes. Figure 11 A, B). The main pathways of enrichment include RNA localization and transport (…). Figure 11 C).

[0196] Notably, ICAM1KD significantly altered the binding pattern of ILF2 / ILF3 to EIF4E, a key gene for RNA transport and translation. Figure 12 A). To further verify the above results, we performed ChIP experiments using antibodies against ILF2 and ILF3 in wild-type and ICAM1KD cells. qPCR results showed that after ICAM1 deletion, the binding of ILF2 / ILF3 to the EIF4E promoter region was significantly enhanced (A). Figure 12 B).

[0197] Next, we performed dual-luciferase reporter gene assays, and the results showed that NF90 binds to the EIF4E promoter region containing the ATTGG motif ( Figure 13A). Next, we used qPCR to detect changes in EIF4E mRNA expression levels in ILF3KO and ICAM1 / ICAM1-ASKD cells compared to the NC group. As expected, ILF3KO downregulated EIF4E expression, while ICAM1 and ICAM1-ASKD upregulated EIF4E expression. Figure 13 B).

[0198] 3.7 ICAM1 controls translation via the ILF2 / ILF3-EIF4E axis Since EIF4E is a known eukaryotic translation initiation factor, we wanted to investigate whether ICAM1 had any effect on cellular translation. Therefore, we performed ribosome density gradient centrifugation. The results further supported our hypothesis: compared to NC cells, ICAM1 and ICAM1ASKD increased the many-to-monomer ratio of ribosomes. Figure 14 A). Next, we performed a puromycin-labeled neonatal protein assay, and Western blotting results showed increased total protein synthesis in cells with ICAM1 and ICAM1-ASKD (A). Figure 14 B). It is known that downstream translational targets of EIF4E include CDK2 and c-MYC. Western blotting analysis showed that EIF4E protein levels were downregulated in ILF3KO cells, while CDK2 and c-MYC protein levels were also downregulated. Figure 14 C).

[0199] Similarly, the expression patterns of CDK2 and c-MYC are consistent with those of EIF4E, which are upregulated in ICAM1KD and ICAM1-ASKD. Figure 15 A). However, further research revealed that ICAM1KD failed to upregulate EIF4E and its downstream targets in ILF3KO cells (A). Figure 15 (B) indicates that the effect of ICAM1 on EIF4E is dependent on ILF3. Consistent with this, ILF3KD eliminated the upregulation of EIF4E, CDK2, and c-MYC induced by ICAM1 or ICAM1-ASKD. Figure 15 C).

[0200] Furthermore, qPCR detection of different ribosome components after ribosome isolation revealed that ICAM1 or ICAM1-ASKD also enhanced multisome associations between CDK2 and c-MYC, indicating an overall increase in translational activity. Figure 16 In summary, these results indicate that ICAM1 / ICAM1-AS mediates cell fate regulation of EIF4E and its subsequent translation via ILF2 / ILF3.

[0201] 3.8 Clinical significance of ICAM1 protein, ICAM1 mRNA, and ICAM1-AS in tumors To investigate the clinical relevance of ICAM1 and ICAM1-AS to tumors, we first analyzed Cancer Genome Atlas (TCGA) data for different cancer types. The results showed that, compared to adjacent normal tissues, lung cancer tissues exhibited significantly reduced levels of either ICAM1 or ICAM1-AS. Figure 17 A, B). In lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC), we observed the distribution of co-expressed cis-antisense transcripts, as well as a small subset of long co-expressed cis-antisense transcripts (A, B). Figure 17 C).

[0202] Notably, in the differential expression co-expression cis-antisense transcript analysis of LUSC and LUAD, we found that ICAM1 / ICAM1-AS was among the top 10 co-downregulated long cis-antisense transcripts, and almost all of the top transcripts were identified as dsRNAs. Figure 18 A). This finding highlights the potential co-regulatory relationship between ICAM1 and ICAM1-AS in lung cancer. Furthermore, among the top 5 gene pairs that are co-regulated or downregulated in both types of lung cancer, most of the coding genes showed low translation efficiency in publicly available data (A). Figure 18 B).

[0203] 3.9 Clinical significance of ICAM1 protein, ICAM1 mRNA and ICAM1-AS expression in lung cancer tissues Next, to verify the expression of ICAM1 and ICAM1-AS, we performed qPCR analysis on the collected clinical samples. The results showed that the expression levels of ICAM1 and ICAM1-AS in tumor tissues were low. Figure 19 A). ICAM1 expression was significantly positively correlated with ICAM1-AS (A). Figure 19 B). In TCGA data, there was also a significant positive correlation between the expression levels of ICAM1 and ICAM1-AS (B). Figure 19 C).

[0204] Next, we performed tissue microarray analysis, immunohistochemistry (IHC) of ICAM1 protein, and fluorescence in situ hybridization (FISH) of ICAM1 and ICAM1-AS on 90 paired tumor samples. Figure 20 A). ICAM1 protein is highly expressed in tumor tissues but almost undetectable in adjacent tissues, suggesting a crucial role for ICAM1 protein in tumor progression. Figure 20 B). We found a persistent correlation between ICAM1 and ICAM1-AS in both normal and tumor tissues. Figure 20 C).

[0205] Immunohistochemical staining of ICAM1 protein in cancer and adjacent normal tissues showed no significant correlation with ICAM1-AS expression. Furthermore, FISH analysis of ICAM1 and ICAM1-AS showed comparable staining ratios between cancerous and adjacent tissues. Figure 21 A). However, the relationship between ICAM1 mRNA and protein levels differed between normal and tumor tissues. In adjacent normal tissues, ICAM1 mRNA was present, but mostly untranslated, while in tumor tissues, a subset of samples showed that ICAM1 mRNA was translated into protein. However, statistical analysis did not show a significant correlation between ICAM1 mRNA and protein levels in either tissue type. Figure 21 B). In summary, these results indicate that ICAM1 / ICAM1-AS is synergistically downregulated in lung cancer, independent of the high expression of ICAM1 protein.

[0206] In lung cancer cell lines with low ICAM1-AS expression (such as Calu-1, A549, and NCI-H226), ICAM1 protein levels were positively correlated with mRNA levels, while they were negatively correlated with sensitivity to ICAM1 antibody-drug conjugate (ADC) therapy. Figure 23 A, Figure 23 B). Furthermore, ICAM1 gene knockout (KO) confers resistance to ICAM1 ADCs, and long-term use of this ADC reduces ICAM1 protein expression. Figure 23 C Figure 23 (D) These findings suggest that ICAM1-AS may influence cellular intrinsic drug responses and the development of treatment resistance by regulating ICAM1 protein expression. In summary, these results confirm that ICAM1 / ICAM1-AS are synergistically downregulated in lung cancer, independent of ICAM1 protein overexpression.

[0207] 3.10 Other dsRNAs that may function in lung cancer To investigate whether the ICAM1 / ICAM1-AS dsRNA pattern is a common phenomenon in the genome, we found that cissense and antisense transcripts are widely expressed in lung cancer, with ICAM1 / ICAM1AS significantly downregulating long cissense and antisense gene pairs (overlapping regions >800 bp). To verify the expression of dsRNAs in lung cancer cells identified in previous data analysis, we treated RNA with RNAseA to digest the single-stranded RNA, followed by qPCR detection. The results showed that almost all 10 differentially expressed long cissense and antisense transcript pairs in lung cancer existed in the form of dsRNAs, with their corresponding protein-coding genes showing low or no protein expression. Figure 22 A, B, C).

[0208] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0209] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

Claims

1. The application of a reagent for detecting the expression of biomarker mRNA in the preparation of products for diagnosing or predicting early-stage cancer, characterized in that, The biomarker is ICAM1 and its reverse complementary chain ICAM1-AS.

2. The application according to claim 1, characterized in that, The cancers mentioned include lung cancer.

3. A product for predicting the efficacy of cancer immunotherapy, characterized in that, The product contains an antibody that specifically binds to immunoglobulin ICAM1 and its inverse complementary chain ICAM1-AS.

4. The product for predicting the efficacy of cancer immunotherapy according to claim 3, characterized in that, The product is a reagent kit or a chip.

5. A product for predicting the efficacy of cancer immunotherapy according to claim 3, characterized in that, The antibody is either ILF2 or ILF3.

6. A product for predicting the efficacy of cancer immunotherapy according to claim 5, characterized in that, The upstream primer sequence used for detecting ILF2 is SEQ ID NO.1, and the downstream primer sequence is SEQ ID NO.

2.

7. A product for predicting the efficacy of cancer immunotherapy according to claim 5, characterized in that, The upstream primer sequence used for detecting ILF3 is SEQ ID NO.3, and the downstream primer sequence is SEQ ID NO.4.