Biomarker for evaluating litchi quality and detection method
By developing SNP molecular markers and detection methods related to fructose content in litchi, the problems of long breeding cycles and low efficiency in litchi have been solved. This has enabled accurate prediction and targeted breeding of fructose content in seedlings, thereby improving the efficiency of litchi breeding and the ability to assess quality.
Patent Information
- Application Number
- CN202610171781.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-06
- Publication Date
- 2026-03-13
- Estimated Expiration
- 2046-02-06
AI Technical Summary
Current technologies rely on post-fruit ripening testing to assess the fructose content of litchi, resulting in long breeding cycles, low efficiency, and a lack of precise biomarkers and testing methods, making it difficult to meet the breeding needs of varieties with high fructose content.
We developed SNP molecular markers related to fructose content in litchi, constructed an efficient and stable detection method, applied it to marker-assisted selection and genome selection, and provided specific primer sets and kits to achieve accurate prediction and targeted breeding of fructose content in seedlings.
It enables accurate prediction of fructose content during the seedling stage, improves breeding efficiency, reduces costs, and provides full-chain quality assessment technical support for the litchi industry.
Smart Images

Figure CN121653286A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a biomarker and detection method for evaluating the quality of litchi. Background Technology
[0002] litchi( Litchi chinensisAs a distinctive and advantageous fruit of tropical and subtropical regions, lychee is favored by consumers worldwide for its tender taste and rich nutritional content. Its quality directly determines its commercial value and market competitiveness, making it a core requirement for the high-quality development of the industry. Among the many quality traits of lychee, fructose content is one of the key indicators, directly affecting the fruit's sweetness, flavor, and palatability. Lychee varieties with different fructose contents exhibit significant differences in market positioning, consumer groups, and prices. Varieties with high fructose content are more sought after in the market due to their sweet and mellow taste, and thus possess higher economic value. However, there are many technical bottlenecks in the current field of litchi quality assessment and targeted breeding that urgently need to be addressed. On the one hand, traditional litchi fructose content assessment relies on physicochemical testing after fruit maturity, which can only be carried out after the plant has completed its full growth cycle to the fruiting stage. Fructose content-related genotypes cannot be determined through phenotypic characteristics during the seedling stage, leading to the need to simultaneously cultivate a large number of plants during the breeding process, only selecting target individuals after fruiting, resulting in a serious waste of land, manpower, and material resources. On the other hand, traditional physicochemical testing methods are cumbersome, time-consuming, and costly, and are easily affected by environmental factors such as sample collection location, maturity, and storage conditions, resulting in poor stability and repeatability of test results. At the breeding level, traditional litchi breeding relies on phenotypic selection models. Breeding for quality traits such as fructose content requires multiple generations of screening and verification, with a breeding cycle of 3-5 years or even longer, resulting in low breeding efficiency and failing to meet the industry's urgent demand for high-quality litchi varieties with high fructose content. Modern breeding technologies such as marker-assisted breeding (MAS) and genome selection (GS) have become important means of crop genetic improvement due to their advantages of early detection and precise screening. Among them, SNP molecular markers have shown significant advantages in targeted selection of crop traits due to their wide distribution, high polymorphism, and accurate detection. Existing technologies have reported molecular markers for total reducing sugar and sucrose content in litchi (CN116694663A). However, research on specific SNP molecular markers for the key quality trait of fructose content in litchi is currently lacking. There is a lack of precise biomarkers that can be directly applied to breeding practices, and a corresponding efficient detection system has not been established. Existing molecular markers mostly focus on a few traits such as litchi color and fruit shape, which cannot meet the needs of targeted breeding for fructose content. At the same time, the lack of dedicated detection tools suitable for breeding scenarios limits the application of MAS breeding technology in litchi fructose content selection. Furthermore, the lack of precise markers supporting core quality traits in GS models results in insufficient predictive accuracy in multi-trait aggregation breeding, thus hindering the progress of genetic improvement of litchi quality. Furthermore, in the current litchi industry chain, there is a lack of rapid, accurate, and stable fructose content assessment technology in various scenarios, such as early seed selection by breeding units, quality identification by seedling enterprises, and resource evaluation by research institutions. This results in low efficiency in selecting high-quality seedlings and inconsistent quality of commercial fruits, affecting the overall development quality of the industry.
[0003] Therefore, developing SNP molecular marker biomarkers closely related to the fructose content of litchi, constructing efficient and stable detection methods, forming matching primer sets and reagent kits, and applying them to MAS breeding and GS model construction will enable accurate prediction and targeted breeding of fructose content in seedlings. At the same time, it will provide quality assessment technical support for the entire industry chain, which is of great significance for reducing breeding costs, accelerating the process of cultivating high-quality varieties, and promoting the high-quality development of the litchi industry. Summary of the Invention
[0004] To address the problems of existing technologies, such as the need for post-fruit assessment of litchi quality, long breeding cycles, and low efficiency, this invention develops a set of biomarkers for evaluating litchi quality. Specifically, it develops SNP molecular markers for assessing litchi quality using high-throughput sequencing technology and validates them in genetic and natural populations. These markers can be used for commercial identification of litchi (seedlings) sold in the market. Furthermore, applying them to marker-assisted selection (MAS) and genomic selection (GS) can accelerate the genetic improvement of litchi varieties.
[0005] The primary objective of this invention is to identify biomarkers associated with quality traits. These biomarkers are SNP molecular markers located on the litchi genome (NCBI: GCA_019925255.1). Specific SNP information is as follows:
[0006] Table 1 SNP locus information
[0007]
[0008] The molecular marker SNP1 is located at position 201 of the sequence in SEQ ID NO.1, with a mutation type of A>G, where AA represents the genotype with high fructose content; the molecular marker SNP2 is located at position 201 of SEQ ID NO.2, with a mutation type of T>C, where TT represents the genotype with high fructose content; the molecular marker SNP3 is located at position 201 of the sequence in SEQ ID NO.3, with a mutation type of T>C, where CC represents the genotype with high fructose content.
[0009] SEQ ID NO.1
[0010] GGACTAAAATGGTAACATCCCCCACAAACTCAAAATGATGAGATGGATATAAACTTGAGTTTGGAGACTAATTTATGAAAACATCTAGGATGATGAGCTTGAAACTATTCATGCACTTTTAATATTTGTCTCTTGTTACCATATCAGTCCTCACCATTATTGTTCATTATTGTGACATATTTGGTTTCTATATGTAGATT[A / G]TATGATTCCAATTGACTTATATAGATTATTCATTTACTTATTTACTTCTTTTGTTTTTCTCTTTGGCTTATAAATAGGTCCTATAATATACATTGCAATTCACAGTTAAATATATATCATTCTTCTACTTTTATCACTTGTATTCCTTTGTTTTCTGGTTGAGTTGTTCTTTTTGTTGTTTTCTTTAAAATAAAATTGAA;
[0011] SEQ ID NO.2
[0012] CCTTTATCATTTGTCACAGGACTGAAGGAGAGAGCTTTTGTCTTATAATCATTACCATATTCTTCAACTGCTTCACATGTAATCCTTGCCACAGCTCCTGTATGTACACTAAAAAACAATTAAAAGTAGTACTTCCATGAAAAAGTCATTATATATACTAACTGTACATTTTCGACAGACTAAAAATAATTTTATGAGCA[T / C]AAACTAGTTGGTAATTACACCTCTTAGCAAAATTGAGTTTTCACGTTAAATCTCCATTCTTAAGTAATTTATATAATAAAAATAAAAAATAATAAAATAATAAAAACACTGAAGGGTGGAAGGGGTCAAGTTTGGGGAGGTGGTGGAGATAGTCAACTGGCTCCGGCTTTTTAATGTTTGGCTTGGCAACATAATCAGAA;
[0013] SEQ ID NO.3
[0014] ATTGCTAAAAAAAATAAAAATTTTATAAATACATTTAGATATTATTATTAAAATATTATGTCCTTCATAAAACTTTTTTTACTTTCTTCGATCCTAATTTTTTTTTTAAATGCTAATCTTAAAGCGTCAAATTCTTTTCAAAAAATACCCATAGATTATGGAGTATTGAGAATGAAACAAAATTATTTAAATTAATCTAG[T / C]TATGAAAGGGTAGTTTTTAATTAACTTTTGTTGTTTTTATGGTCTATAGTTGAAAGAATCCGAGTTGAAAAGTGGAAAAAGCATCGAGGATCATTAGGGTTTCAATAAGAGAAAGATGATAGGAGGAAGACTAAAGGTGATGGGGGAGGATAAAACTTGGGATCGATGAGTGGGAGGGAGGCGAAGGAGGAGCCTAGCGA.
[0015] To achieve efficient and accurate detection of the aforementioned molecular markers, this invention provides a set of adaptive specific primers, comprising three primer pairs: primer pair 1 for detecting SNP1, with nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO.5, primer pair 2 for detecting SNP2, with nucleotide sequences shown in SEQ ID NO.6 and SEQ ID NO.7, and primer pair 3 for detecting SNP3, with nucleotide sequences shown in SEQ ID NO.8 and SEQ ID NO.9.
[0016] SEQ ID NO.4
[0017] TGTTACCATATCAGTCCTCACCA
[0018] SEQ ID NO.5
[0019] ACAACTCAACCAGAAAACAAAGGA
[0020] SEQ ID NO.6
[0021] TTGCCACAGCTCCTGTATGT
[0022] SEQ ID NO.7
[0023] CTTGACCCCTTCCACCCTTC
[0024] SEQ ID NO.8
[0025] TGCTAATCTTAAAGCGTCAAATTCTTT
[0026] SEQ ID NO.9
[0027] CCCACTCATCGATCCCAAGT
[0028] The present invention also provides a kit for detecting the above-mentioned molecular markers, the core component of which is the above-mentioned specific primer set, and also includes a special mix (containing Taq enzyme, dNTPs, and reaction buffer), sterile water, and standard controls (one tube each of GG, CG, and CC standard genotype templates, each with a concentration of 50 ng / μL).
[0029] This invention also provides a method for evaluating litchi quality traits using molecular markers. This method can quickly predict quality and is especially suitable for commercial identification of seedlings in the market. The method includes the following steps: detecting the genotype of the aforementioned SNP molecular markers using any method, and evaluating litchi quality based on the detected genotype results.
[0030] Specifically, a method for assessing the quality of lychees includes the following steps:
[0031] 1) Determine the genotype of the molecular marker loci associated with the fructose content trait in litchi resource populations, wherein the molecular marker is any one of the aforementioned SNP1, SNP2 and SNP3 loci.
[0032] 2) Determine the quality of litchi samples based on the genotype of the molecular markers.
[0033] Step 1) includes the following steps:
[0034] 1.1) Extract genomic DNA from the litchi to be tested;
[0035] 1.2) Detect the genotype of the litchi to be tested;
[0036] 1.3) Based on the detection results, determine the genotypes of the litchi to be tested at SNP1, SNP2 and SNP3 loci on chromosome 3 of the reference genome;
[0037] Step 2) determining the quality of litchi samples based on the genotype of the molecular markers includes at least one of the following steps:
[0038] 2.1) In the litchi population, if the genotype of the litchi sample at the SNP1 locus is AA, then the sample is determined to be a sample with high fructose content.
[0039] 2.2) In the litchi population, if the genotype of the litchi sample at the SNP2 locus is TT, then the sample is determined to be a sample with high fructose content.
[0040] 2.3) In the litchi population, if the genotype of the litchi sample at the SNP3 locus is CC or TC, then the sample is determined to be a sample with high fructose content.
[0041] Preferably, in step 2.3), individuals with the SNP3 locus being of the CC type are samples with high fructose content.
[0042] Preferably, in order to perform quality assessment more accurately, step 2) includes at least one of the following steps:
[0043] 2.1) In the litchi population, if the combined genotype of the litchi sample at SNP1 and SNP2 loci is AA_TT, then the sample is determined to be a high-fructose sample.
[0044] 2.2) In the litchi population, if the combined genotype of the litchi sample at SNP3 and SNP1 sites is CC_AA, then the sample is determined to be a sample with high fructose content.
[0045] 2.3) In the litchi population, if the combined genotype of the litchi sample at SNP3 and SNP2 sites is CC_TT, then the sample is determined to be a sample with high fructose content.
[0046] Preferably, in order to conduct a more accurate quality assessment, step 2) is as follows:
[0047] Taking into account both genotype ratio and fructose content, if the combined genotype of the litchi sample at SNP3, SNP1, and SNP2 loci is C / C_A / A_T / T, then the sample is determined to be a high-fructose sample.
[0048] The accuracy of the prediction results has been verified to be high through population testing, and can provide a reliable basis for seedling transactions.
[0049] This invention further provides a genetic breeding method for screening litchi quality traits. This method can accurately achieve quality-oriented selection and significantly improve breeding efficiency. The method includes the following core steps: using any method to detect the genotype of the aforementioned SNP molecular markers, and selecting individuals with different genotypes as parents according to the breeding objectives.
[0050] Specifically, a method for genetic improvement of litchi quality includes the following steps:
[0051] 1) Determine the genotype of the molecular marker loci associated with the fructose content trait in litchi resource populations, wherein the molecular marker is any one of the aforementioned SNP1, SNP2 and SNP3 loci.
[0052] 2) Make appropriate selections based on the genotype of the molecular marker and the breeding objectives.
[0053] Step 1) includes the following steps:
[0054] 1.1) Extract genomic DNA from the litchi to be tested;
[0055] 1.2) Detect the genotype of the litchi to be tested;
[0056] 1.3) Based on the detection results, determine the genotypes of the litchi to be tested at SNP1, SNP2 and SNP3 loci on chromosome 3 of the reference genome;
[0057] Step 2) includes at least one of the following steps:
[0058] 2.1) Individuals with the GG and AG genotypes at the litchi SNP1 locus in the litchi resource population were eliminated to increase the frequency of the AA genotype at this locus generation by generation, thereby increasing the fructose content of the offspring litchi.
[0059] 2.2) Individuals with the CC and TC genotypes at the litchi SNP2 locus in the litchi resource population were eliminated to increase the frequency of the TT genotype at this locus generation by generation, thereby increasing the fructose content of the offspring litchi.
[0060] 2.3) Eliminate individuals with the TT genotype at the litchi SNP3 locus in the litchi resource population to increase the frequency of the CC and / or TC genotypes at this locus generation by generation, thereby increasing the fructose content of the offspring litchi.
[0061] Preferably, in step 2.3), individuals with the TT and TC genotypes at the SNP3 locus of litchi are eliminated to increase the frequency of the CC genotype at this locus generation by generation, thereby increasing the fructose content of the offspring litchi.
[0062] Preferably, in order to perform genetic probability breeding more accurately, step 2) includes at least one of the following steps:
[0063] 2.1) In the litchi resource population, individuals with the genotype AA_TT for the combination of SNP1 and SNP2 were retained, thereby increasing the fructose content of the offspring litchi.
[0064] 2.2) Individuals with the SNP3 and SNP1 combination genotype CC_AA were retained in the litchi resource population to increase the fructose content of the offspring litchi.
[0065] 2.3) In the litchi resource population, individuals with the SNP3 and SNP2 combination genotype CC_TT were retained to increase the fructose content of the offspring litchi.
[0066] Preferably, in order to perform genetic probability breeding more accurately, step 2) is as follows:
[0067] Taking into account both genotype ratio and fructose content, individuals with the genotype C / C_A / A_T / T combination of SNP3, SNP1, and SNP2 on chromosome 3 of litchi were retained in the litchi resource population to increase the fructose content of offspring litchi.
[0068] The beneficial effects of this invention are as follows: The aforementioned biomarkers have significant application value in litchi quality trait-related breeding or litchi quality prediction. Applying them to MAS breeding enables precise seed selection at the seedling stage, eliminating individuals with non-target genotypes and reducing breeding costs. Integrating them into the GS model can improve the predictive accuracy of multi-trait aggregation breeding and accelerate the process of variety genetic improvement. Simultaneously, the aforementioned primer sets or kits also possess significant application advantages in litchi quality trait-related breeding or litchi quality prediction. They exhibit high specificity and stable detection results, making them widely applicable to early screening in breeding units, quality identification by seedling enterprises, and resource evaluation by research institutions, providing the litchi industry with full-chain technical support from variety cultivation to commercial circulation. Attached Figure Description
[0069] The method of the present invention and its beneficial effects will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0070] Figure 1 This is a Manhattan plot of GWAS analysis. The horizontal axis represents the chromosome number, and the vertical axis represents the logarithmized P-value of the significant association. The red dashed line is the threshold line, and the blue line is the corrected threshold line.
[0071] Figure 2 These are the statistical results of fructose content in different genotypes at the SNP1 locus, with different lowercase letters indicating significant differences.
[0072] Figure 3 These are the statistical results of fructose content in different genotypes at the SNP2 locus, with different lowercase letters indicating significant differences.
[0073] Figure 4 These are the statistical results of fructose content in different genotypes at the SNP3 locus. Different lowercase letters indicate significant differences, and different uppercase letters indicate extremely significant differences. Detailed Implementation
[0074] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0075] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0076] Example
[0077] Example 1: Development of SNPs and QTL Localization
[0078] 1. Experimental materials
[0079] In the same year, 186 litchi germplasm resource samples were collected.
[0080] 2. Sample DNA extraction, library construction, and sequencing
[0081] 1) Use a kit to extract genomic DNA.
[0082] 2) Perform whole-genome resequencing on the samples.
[0083] 3. Data quality control
[0084] Use the software fastp (version: 0.20.0) with default parameters to filter low-quality sequences in the original data and obtain CleanData data.
[0085] 4. Population variation detection
[0086] In this invention, we used the litchi genome as the reference genome (NCBI: GCA_019925255.1). The obtained sequencing reads needed to be remapped to the reference genome before subsequent variant analysis could be performed. The reference genome was aligned using BWA (Burrows-Wheeler Aligner, 0.7.19-r1273) with parameters set to -M and -R. The generated SAM file was converted to BAM format using samtools (version 1.9). Then, PCR duplications were marked using picardMarkDuplicates (version 2.21.2). Only high-quality reads were then retained for subsequent analysis.
[0087] 5. SNP Filtering
[0088] (1) Sequencing depth and quality value filtering: average sequencing depth greater than or equal to 10X, minimum quality value greater than or equal to 30, site detection rate ≥90%, only biallelic SNP sites are retained, and minimum allele frequency (maf) ≥0.05. (2) Target region filtering: based on the target region to be amplified, SNPs located within the target region are screened.
[0089] 6. Genome-wide association analysis
[0090] The SNPs obtained in step 5 above were used to perform GWAS correlation analysis with the fructose content in fresh pulp of each sample at the ripening stage (detected by high performance liquid chromatography HPLC). The GWAS analysis model used in this invention is a general linear model and additive effects correlation analysis.
[0091] Ultimately, three loci on chromosome 3 were found to have a significant impact on fructose content, such as... Figure 1 As shown in Table 2:
[0092] Table 2. Associated SNP sites
[0093]
[0094] Note: P-value indicates the degree of association between each SNP locus and the fructose content trait.
[0095] The molecular marker SNP1 A>G is located at position 201 of the sequence in SEQ ID NO.1 below, the molecular marker SNP2 T>C is located at position 201 of SEQ ID NO.2, and the molecular marker SNP3 T>C is located at position 201 of the sequence in SEQ ID NO.3 below.
[0096] SEQ ID NO.1
[0097] GGACTAAAATGGTAACATCCCCCACAAACTCAAAATGATGAGATGGATATAAACTTGAGTTTGGAGACTAATTTATGAAAACATCTAGGATGATGAGCTTGAAACTATTCATGCACTTTTAATATTTGTCTCTTGTTACCATATCAGTCCTCACCATTATTGTTCATTATTGTGACATATTTGGTTTCTATATGTAGATT[A / G]TATGATTCCAATTGACTTATATAGATTATTCATTTACTTATTTACTTCTTTTGTTTTTCTCTTTGGCTTATAAATAGGTCCTATAATATACATTGCAATTCACAGTTAAATATATATCATTCTTCTACTTTTATCACTTGTATTCCTTTGTTTTCTGGTTGAGTTGTTCTTTTTGTTGTTTTCTTTAAAATAAAATTGAA
[0098] SEQ ID NO.2
[0099] CCTTTATCATTTGTCACAGGACTGAAGGAGAGAGCTTTTGTCTTATAATCATTACCATATTCTTCAACTGCTTCACATGTAATCCTTGCCACAGCTCCTGTATGTACACTAAAAAACAATTAAAAGTAGTACTTCCATGAAAAAGTCATTATATATACTAACTGTACATTTTCGACAGACTAAAAATAATTTTATGAGCA[T / C]AAACTAGTTGGTAATTACACCTCTTAGCAAAATTGAGTTTTCACGTTAAATCTCCATTCTTAAGTAATTTATATAATAAAAATAAAAAATAATAAAATAATAAAAACACTGAAGGGTGGAAGGGGTCAAGTTTGGGGAGGTGGTGGAGATAGTCAACTGGCTCCGGCTTTTTAATGTTTGGCTTGGCAACATAATCAGAA
[0100] SEQ ID NO.3
[0101] ATTGCTAAAAAAAATAAAAATTTTATAAATACATTTAGATATTATTATTAAAATATTATGTCCTTCATAAAACTTTTTTTACTTTCTTCGATCCTAATTTTTTTTTTAAATGCTAATCTTAAAGCGTCAAATTCTTTTCAAAAAATACCCATAGATTATGGAGTATTGAGAATGAAACAAAATTATTTAAATTAATCTAG[T / C]TATGAAAGGGTAGTTTTTAATTAACTTTTGTTGTTTTTATGGTCTATAGTTGAAAGAATCCGAGTTGAAAAGTGGAAAAAGCATCGAGGATCATTAGGGTTTCAATAAGAGAAAGATGATAGGAGGAAGACTAAAGGTGATGGGGGAGGATAAAACTTGGGATCGATGAGTGGGAGGGAGGCGAAGGAGGAGCCTAGCGA
[0102] Example 2: Correlation analysis between phenotype and genotype in a genetic population
[0103] Three primer pairs (as shown in SEQ ID NO.4~SEQ ID NO.9) were designed to detect the above three loci in 179 litchi samples. Statistical analysis and t-tests were performed on the fructose content of individuals with different genotypes. The results are shown in Table 3 and... Figures 2-4 As shown:
[0104] Table 3. Genotypes of Mutation Sites and Fructose Content Traits
[0105]
[0106] Note: Different lowercase letters indicate significant differences between groups (P≤0.05), different uppercase letters indicate extremely significant differences between groups (P≤0.01), and the same uppercase or lowercase letters indicate no significant differences; the statistical results exclude individuals whose genotypes were not detected, and the fructose content is the average value.
[0107] Table 3 shows that there are significant differences among the three genotypes at SNP1, with fructose content from highest to lowest being AA, AG, and GG genotypes. There are also significant differences among the three genotypes at SNP2, with fructose content from highest to lowest being TT, TC, and CC genotypes. Finally, there are significant differences among the three genotypes at SNP3, with the CC genotype showing a significantly higher fructose content than the TT genotype, and fructose content from highest to lowest being CC, TC, and TT genotypes.
[0108] Further statistical analysis and t-tests were performed on the fructose content of different genotype combinations at the three loci. The results are shown in Table 4.
[0109] Table 4. Fructose content of different genotype combinations
[0110]
[0111] Note: Different lowercase letters indicate significant differences between groups (p<=0.05), different uppercase letters indicate extremely significant differences between groups (p<=0.01), and the same letter indicates no significant difference. The statistical results exclude samples where no genotype was detected at any locus. The fructose content is the average value.
[0112] Example 3: Method for evaluating litchi quality
[0113] A method for evaluating the quality of lychees, wherein the quality is defined as the fructose content of the lychee pulp, the method comprising the following steps:
[0114] 1) Determine the genotypes of molecular marker sites related to the fructose content trait in litchi resource populations, wherein the molecular marker sites are the sites in the aforementioned embodiments.
[0115] 2) Determine the quality of litchi samples based on the genotype of the molecular markers.
[0116] Step 1) includes the following steps:
[0117] 1.1) Extract genomic DNA from the litchi to be tested;
[0118] 1.2) Detect the genotype of the litchi to be tested;
[0119] 1.3) Based on the detection results, determine the genotypes of the litchi to be tested at SNP1, SNP2 and SNP3 loci on chromosome 3 of the reference genome;
[0120] Step 2) determining the quality of the litchi sample based on the genotype of the molecular marker includes at least one of the following steps:
[0121] 2.1) In the litchi population, if the genotype of the litchi sample at the SNP1 locus is AA, then the sample is determined to be a sample with high fructose content.
[0122] 2.2) In the litchi population, if the genotype of the litchi sample at the SNP2 locus is TT, then the sample is determined to be a sample with high fructose content.
[0123] 2.3) In the litchi population, if the genotype of the litchi sample at the SNP3 locus is CC or TC, then the sample is determined to be a sample with high fructose content.
[0124] Preferably, in step 2.3), if the genotype of the litchi sample at the SNP3 locus is CC, then the sample is determined to be a sample with high fructose content.
[0125] Preferably, in order to perform quality assessment more accurately, step 2) includes at least one of the following steps:
[0126] 2.1) In the litchi population, if the combined genotype of the litchi sample at SNP1 and SNP2 sites is AA_TT, then the sample is determined to be a sample with high fructose content.
[0127] 2.2) In the litchi population, if the combined genotype of the litchi sample at SNP3 and SNP1 sites is CC_AA, then the sample is determined to be a sample with high fructose content.
[0128] 2.3) In the litchi population, if the combined genotype of the litchi sample at SNP3 and SNP2 sites is CC_TT, then the sample is determined to be a sample with high fructose content.
[0129] Preferably, in order to conduct a more accurate quality assessment, step 2) is as follows:
[0130] Taking into account both genotype ratio and fructose content, if the combined genotype of the litchi sample at SNP3, SNP1, and SNP2 loci is C / C_A / A_T / T, then the sample is determined to be a high-fructose sample.
[0131] Example 4: Method for genetic improvement of litchi quality
[0132] A method for genetic improvement of litchi quality, the method comprising the following steps:
[0133] 1) Determine the genotypes of molecular marker sites related to the fructose content trait in litchi resource populations, wherein the molecular marker sites are the sites in the aforementioned embodiments.
[0134] 2) Make appropriate selections based on the genotype of the molecular marker and the breeding objectives.
[0135] Step 1) includes the following steps:
[0136] 1.1) Extract genomic DNA from the litchi to be tested;
[0137] 1.2) Detect the genotype of the litchi to be tested;
[0138] 1.3) Based on the detection results, determine the genotypes of the litchi to be tested at SNP1, SNP2 and SNP3 loci on chromosome 3 of the reference genome;
[0139] Step 2) includes at least one of the following steps:
[0140] 2.1) Individuals with the GG and AG genotypes at the litchi SNP1 locus in the litchi resource population were eliminated to increase the frequency of the AA genotype at this locus generation by generation, thereby increasing the fructose content of the offspring litchi.
[0141] 2.2) Individuals with the CC and TC genotypes at the litchi SNP2 locus in the litchi resource population were eliminated to increase the frequency of the TT genotype at this locus generation by generation, thereby increasing the fructose content of the offspring litchi.
[0142] 2.3) Eliminate individuals with the TT genotype at the litchi SNP3 locus in the litchi resource population to increase the frequency of the CC and / or TC genotypes at this locus generation by generation, thereby increasing the fructose content of the offspring litchi.
[0143] Preferably, in step 2.3), individuals with the TT and TC genotypes at the SNP3 locus of litchi are eliminated to increase the frequency of the CC genotype at this locus generation by generation, thereby increasing the fructose content of the offspring litchi.
[0144] Preferably, in order to perform genetic probability breeding more accurately, step 2) includes at least one of the following steps:
[0145] 2.1) In the litchi resource population, individuals with the genotype AA_TT for the combination of SNP1 and SNP2 were retained, thereby increasing the fructose content of the offspring litchi.
[0146] 2.2) Individuals with the SNP3 and SNP1 combination genotype CC_AA were retained in the litchi resource population to increase the fructose content of the offspring litchi.
[0147] 2.3) In the litchi resource population, individuals with the SNP3 and SNP2 combination genotype CC_TT were retained to increase the fructose content of the offspring litchi.
[0148] Preferably, in order to perform genetic probability breeding more accurately, step 2) is as follows:
[0149] Taking into account both genotype ratio and fructose content, individuals with the genotype C / C_A / A_T / T combination of SNP3, SNP1, and SNP2 on chromosome 3 of litchi were retained in the litchi resource population to increase the fructose content of offspring litchi.
[0150] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to the above embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A marker related to the quality of lychee, characterized in that, The quality refers to the fructose content of the pulp, and the marker is a SNP molecular marker, which includes at least one of SNP1, SNP2 or SNP3. SNP1 corresponds to the A>G mutation at position 10145002 on chromosome 3 of the litchi genome, and its nucleotide sequence is shown in SEQ ID NO.1, where AA is the genotype with high fructose content. The SNP2 corresponds to the T>C mutation at position 10194102 on chromosome 3 of the litchi genome, and its nucleotide sequence is shown in SEQ ID NO.2, where TT is the genotype with high fructose content; The SNP3 corresponds to the T>C mutation at position 10243904 on chromosome 3 of the litchi genome, and its nucleotide sequence is shown in SEQ ID NO.3, where CC is the genotype with high fructose content.
2. A primer set for detecting the marker of claim 1, characterized in that, The nucleotide sequences of the primer set are shown in SEQ ID NO.4 ~ SEQ ID NO.9, wherein SEQ ID NO.4 ~ SEQ ID NO.5 are used to detect SNP1, SEQ ID NO.6 ~ SEQ ID NO.7 are used to detect SNP2, and SEQ ID NO.8 ~ SEQ ID NO.9 are used to detect SNP3.
3. A reagent kit for detecting the marker of claim 1, characterized in that, The kit comprises the primer set as described in claim 2.
4. A method for evaluating the quality traits of litchi, characterized in that, The quality refers to the fructose content of the fruit pulp, and the method includes the following steps: (1) Extract genomic DNA from the litchi samples to be tested; (2) The genotype of the litchi to be tested is detected using the primer set described in claim 2 or the kit described in claim 3; (3) Based on the test results, determine the genotype of the litchi to be tested; (4) Based on the genotype results obtained from the detection, the quality of litchi is predicted. The judgment criteria are that the fructose content of individuals with any of the following genotypes at any of the following loci is higher than that of individuals with other genotypes at the same locus: individuals with AA type at SNP1 locus, individuals with TT type at SNP2 locus, and individuals with CC type at SNP3 locus. SNP1 corresponds to the A>G mutation at position 10145002 on chromosome 3 of the litchi genome, and its nucleotide sequence is shown in SEQ ID NO.
1. SNP2 corresponds to the T>C mutation at position 10194102 on chromosome 3 of the litchi genome, and its nucleotide sequence is shown in SEQ ID NO.
2. SNP3 corresponds to the T>C mutation at position 10243904 on chromosome 3 of the litchi genome, and its nucleotide sequence is shown in SEQ ID NO.
3.
5. A genetic breeding method for improving the quality traits of litchi, characterized in that, The quality refers to the fructose content of the fruit pulp, and the method includes the following steps: (1) Extract genomic DNA from the litchi resource population to be tested; (2) The genotype of the litchi to be tested is detected using the primer set described in claim 2 or the kit described in claim 3; (3) Based on the test results, determine the genotype of the litchi to be tested; (4) Select individuals with different genotypes as parents according to the breeding goal. When the breeding goal is to breed varieties with high fructose content, select individuals with the following genotypes as parents: Individuals with SNP1 of type AA, and / or SNP2 of type TT, and / or SNP3 of type CC, wherein SNP1 corresponds to the A>G mutation at position 10145002 on chromosome 3 of the litchi genome, and its nucleotide sequence is shown in SEQ ID NO.1; SNP2 corresponds to the T>C mutation at position 10194102 on chromosome 3 of the litchi genome, and its nucleotide sequence is shown in SEQ ID NO.2; and SNP3 corresponds to the T>C mutation at position 10243904 on chromosome 3 of the litchi genome, and its nucleotide sequence is shown in SEQ ID NO.
3.
6. The application of the marker as described in claim 1 in litchi quality trait-related breeding or litchi quality prediction, characterized in that, The quality refers to the fructose content of the fruit pulp.
7. The application of the primer set according to claim 2 or the kit according to claim 3 in litchi quality trait-related breeding or litchi quality prediction, characterized in that, The quality refers to the fructose content of the fruit pulp.
Citation Information
Patent Citations
Gene related to accumulation type of litchi pulp sugar as well as molecular marker, primer pair and application thereof
CN116694663A
Litchi kernel size character identification method and detection primer group
CN120591462A
InDel molecular marker related to size of lychee kernel and application of InDel molecular marker
CN120648850A
Cited By
Molecular markers associated with pecan nut weight and their application
CN122189240A
Molecular markers associated with the weight of unripe pecans and their applications
CN122189240B