Instant detection system and monitoring and early warning method for African swine fever virus
By using latex microsphere-labeled immunochromatographic antibody detection cards and lyophilized microsphere fluorescent PCR detection reagents, combined with a portable MINI-PCR instrument, the problems of slow detection speed, low sensitivity, and poor portability of African swine fever virus have been solved, achieving rapid and accurate detection suitable for all scenarios, reducing the probability of epidemic spread and control costs.
Patent Information
- Application Number
- CN202511891306.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-15
- Publication Date
- 2026-03-13
AI Technical Summary
Existing African swine fever virus detection technologies suffer from slow detection speed, low sensitivity, poor portability, and a lack of early warning systems, making it difficult to meet the needs of dynamic monitoring and rapid on-site prevention and control throughout the entire pig farming process.
Using latex microsphere-labeled immunochromatographic antibody detection cards and lyophilized microsphere fluorescent PCR detection reagents, combined with a portable MINI-PCR instrument, antibody screening can be achieved in 10 minutes and nucleic acid diagnosis in 1 hour. An integrated detection-evaluation-early warning system is constructed, which is suitable for the simultaneous detection of ASFV antibodies and nucleic acids in whole blood or serum of pigs.
It enables rapid, accurate, and portable detection that is adaptable to all scenarios, reducing the risk of missed detections and misjudgments, shortening detection time, improving detection accuracy, reducing the probability of epidemic spread and prevention and control costs, and supporting real-time information flow and joint prevention and control.
Smart Images

Figure CN121656565A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and in vitro diagnostics, specifically to a real-time detection system and monitoring and early warning method for African swine fever virus, applicable to virus detection and epidemic prevention and control throughout the entire chain of pig farming, transportation, and slaughter. Background Technology
[0002] African swine fever (ASF) is a highly contagious disease caused by the African swine fever virus (ASFV). Since its introduction into my country in 2018, it has led to a significant decline in the number of pigs and direct economic losses exceeding 100 billion yuan, seriously threatening the security of the pork market supply. Currently, the main means of ASF prevention and control are detection and biosecurity, but detection technology has significant shortcomings and is difficult to meet the needs of rapid on-site prevention and control.
[0003] Limitations of laboratory testing technology: Mainstream quantitative PCR methods require professional operation, the testing equipment is bulky (e.g., a benchtop PCR instrument weighs over 5kg), reagents need to be frozen at -20℃, the cost of sample delivery is as high as 200~500 yuan per sample, and the testing cycle is as long as 2~4 hours, making it impossible to achieve on-site real-time testing in farms, slaughterhouses, etc.
[0004] Limitations of on-site rapid testing technology: Existing colloidal gold antibody test strips have low sensitivity (the lowest detection limit for African swine fever virus antibody test strips is only 1:128), making it easy to miss detections; and they cannot detect nucleic acid simultaneously, making it difficult to monitor early infection and leading to a high risk of misjudgment of the epidemic.
[0005] Lack of monitoring and early warning system: Existing solutions are mostly single-point, single-time testing, lacking dynamic monitoring of the entire pig farming process; the transmission of epidemic information relies on manual reporting, with a lag time of more than 24 hours, making it difficult to trace the cross-regional spread of the virus (such as in the transportation process), and increasing the cost of prevention and control by 3 to 5 times after the spread of the epidemic.
[0006] Insufficient adaptability to multiple scenarios: Portable testing equipment is required for scenarios such as pig transportation and quarantine, disinfection center effectiveness verification, and central stations. However, existing equipment weighs more than 3kg and requires the use of a nucleic acid extractor to extract nucleic acid from samples before PCR testing can be performed. Furthermore, reagents need to be transported via cold chain, which cannot meet the testing needs of field and temporary sites.
[0007] Therefore, developing a fast, accurate, portable, and scenario-adaptable real-time detection system and establishing appropriate monitoring and early warning methods are of urgent practical significance for the prevention and control of African swine fever. Summary of the Invention
[0008] To address the problems of slow detection speed, low sensitivity, poor portability, and lack of early warning system in existing technologies, this invention provides an instant detection system and monitoring and early warning method for African swine fever virus, which can achieve on-site detection of antibody screening in 10 minutes and nucleic acid diagnosis in 1 hour, and simultaneously build an integrated system of detection-evaluation-early warning to meet the prevention and control needs of the entire pig industry chain.
[0009] To achieve the above objectives, the present invention adopts the following technical solution: A point-of-care testing system for African swine fever virus (ASFV) includes a latex microsphere-labeled immunochromatographic antibody detection card, a lyophilized microsphere-type fluorescent PCR detection reagent, and a portable MINI-PCR instrument. The latex microsphere-labeled immunochromatographic antibody detection card uses recombinant ASFV p30 protein as the detection target and is used to detect ASFV antibodies in whole blood or serum of pigs within 10 minutes. The lyophilized microsphere-type fluorescent PCR detection reagent contains dual primers and dual probes, as well as extraction-free components, and can be stored at room temperature and is compatible with the detection of multiple ASFV strains. The portable MINI-PCR instrument has a volume of 10cm × 20cm × 33cm and a weight of 660g, supports ≤4 wells / sample testing, and has four-channel detection functions (470nm, 530nm, 575nm, and 630nm). Operation control and result reception are achieved via Bluetooth on a mobile phone, and the testing time is <1 hour.
[0010] Furthermore, the latex microsphere-labeled immunochromatographic antibody detection card includes a PVC base plate, a sample pad, a labeling pad, a nitrocellulose membrane, and an absorbent pad sequentially adhered to the PVC base plate; the nitrocellulose membrane has a detection line (T line) and a control line (C line), the T line is coated with 1.5 mg / mL mouse anti-pig IgG, and the C line is coated with 1.5 mg / mL goat anti-rabbit IgG; the labeling pad is loaded with a latex microsphere conjugate, the latex microspheres have a particle size of 300 nm, and the concentrations of p30 protein and rabbit IgG protein in the conjugate are both 60 μg / mL, and the latex microspheres are activated at 37°C for 30 min and blocked at 37°C for 30 min.
[0011] Further, the preparation method of the recombinant ASFVp30 protein includes: (1) induction of expression: Escherichia coli BL21-p30 strain is inoculated into LB medium containing 50 μg / mL kanamycin at an inoculation rate of 1.0% (V / V), and cultured at 37°C and 220 r / min for 12-16 hours to obtain seed culture; then transferred to the same LB medium at an inoculation rate of 1.0% (V / V), and cultured at 37°C and 220 r / min until OD. 600nm=0.6~0.8, add IPTG to a final concentration of 0.2 mmol / L, induce expression at 16℃ for 14 hours; (2) Antigen collection: after induction, centrifuge the bacterial culture at 12000r / min for 15min to collect the bacterial cells, resuspend in pre-cooled PBS, and sonicate for 10min at 40w power and 3s working / 6s intermittent under ice bath conditions, centrifuge at 2~8℃ and 12000r / min for 10min to collect the supernatant; (3) Antigen purification: balance the Ni affinity chromatography column with pH7.4 PBS containing 300mM NaCl, after loading the antigen supernatant, wash 5~10 column volumes with pH7.4 PBS containing 300mM NaCl and 50mM imidazole, and then elute the target protein with pH7.4 PBS containing 300mM NaCl and 500mM imidazole; the eluent is rinsed with pH7.4 PBS containing 300mM NaCl. Dialyze overnight at 2~8℃, add ulp1 enzyme digestion and load again onto Ni column, collect flow-through and filter through 0.22μm filter membrane; (4) Purity detection: use spectrophotometer to measure concentration, SDS-PAGE method to verify purity, and ensure that protein purity meets detection requirements.
[0012] Furthermore, the preparation of the latex microsphere-labeled immunochromatographic antibody detection card further includes: (1) preparation of the labeling pad: the coupling buffer is a pH 6.0 aqueous solution containing 9.762 g / L MES (filtered through a 0.22 μm filter membrane); the blocking solution is a pH 7.2 aqueous solution containing 0.272 g / L potassium dihydrogen phosphate, 1.144 g / L dipotassium hydrogen phosphate, 20 g / L BSA, and 0.02% ProClin 300 (filtered through a 0.22 μm filter membrane); the preservation solution is a 20 mM pH 7.2 solution containing 0.272 g / L potassium dihydrogen phosphate, 2.902 g / L disodium hydrogen phosphate, 5 g / L BSA, and 0.02% ProClin 300. PBS (filtered through a 0.22 μm filter membrane); take 0.1 ml of latex microspheres, add 0.05 ml of coupling buffer containing EDC and 0.05 ml of coupling buffer containing NHS, and react at 37°C for 30 min; add coupling buffers containing p30 protein and rabbit IgG protein respectively, and react at 2~8°C overnight; add 0.5 ml of blocking solution and react at 37°C for 30 min, centrifuge to remove supernatant, wash twice with preservation solution, resuspend, sonicate for 5 min, dilute to working concentration, coat glass fiber, and dry at 37°C overnight; (2) Preparation of coating membrane: the coating solution is pH 7.2 containing 0.136 g / L potassium dihydrogen phosphate, 1.451 g / L disodium hydrogen phosphate, 30 g / L trehalose, and 0.05% ProClin300. Aqueous solution (filtered through a 0.22μm filter membrane); mouse anti-pig IgG and goat anti-rabbit IgG were diluted to 1.5mg / mL with coating solution and sprayed onto nitrocellulose membrane at a spraying rate of 1.0μl / cm and a speed of 3cm / s, and dried at 37℃ for 15~20 hours; (3) Sample pad preparation: 300mm×16mm sample pads were soaked in blocking solution for 30min and dried at 37℃ for 15~20 hours; (4) Assembly and cutting: the sample pad, label pad, nitrocellulose membrane and absorbent pad were sequentially adhered to the PVC base plate, the label pad overlapped with the nitrocellulose membrane and sample pad, the absorbent pad overlapped with the nitrocellulose membrane, and cut into 3mm wide test strips, which were then packed into a card and sealed in an aluminum foil bag (containing 1 test strip, 1 dropper and 1 pack of desiccant).
[0013] Furthermore, the preparation method of the lyophilized microsphere fluorescent PCR detection reagent includes: (1) Primer and probe preparation: Design double primers and double probes according to the conserved sequence of ASFV p72 gene, and after synthesis, dilute with TE buffer to 10 μmol / L and store at 2~8℃; (2) Reaction solution preparation: Mix primers, probes and freeze-dryable Premix according to the preset ratio to prepare a 15 μl / reaction mixture; (3) Microsphere forming: Use a liquid nitrogen dropper to drop the mixture into liquid nitrogen at a rate of 5s / drop to form microspheres; (4) Lyophilization treatment: Transfer the microspheres and liquid nitrogen to a freeze dryer, pre-freeze to -45℃ and maintain for a set time, then raise the temperature to -15℃ for sublimation drying, and finally raise the temperature to 20℃ to complete the desorption drying to prepare lyophilized microsphere reagent.
[0014] Furthermore, the portable MINI-PCR instrument includes a temperature control module, an optical module, and a Bluetooth communication module; the temperature control module uses a semiconductor ceramic cooler and a high-precision temperature sensor to achieve a temperature control accuracy of ±0.1℃; the optical module includes an all-solid-state laser excitation unit and an ultra-high sensitivity photoelectric sensor, which can collect fluorescence signals in real time; the Bluetooth communication module supports WeChat QR code scanning to start, parameter setting, and test report generation.
[0015] This invention also provides a method for monitoring and early warning of African swine fever virus using a point-of-care testing system, comprising the following steps: (1) Sample collection: collecting whole blood from pigs or preparing serum, tail root blood is applicable; (2) Parallel detection: using a latex microsphere-labeled immunochromatographic antibody detection card to detect antibodies, and using a lyophilized microsphere-type fluorescent PCR detection reagent and a portable MINI-PCR instrument to detect nucleic acids. Further optimization specifically involves simultaneously conducting dual-indicator detection of nucleic acid and antibodies—using a lyophilized microsphere-type fluorescent PCR detection reagent and a portable MINI-PCR instrument for nucleic acid detection (relying on high sensitivity to preferentially identify early infection), while simultaneously using a latex microsphere-labeled immunochromatographic antibody detection card for antibody detection (assisting in determining the infection stage); both detections... The results are used together for subsequent infection assessment to ensure no omissions or misjudgments; (3) Result determination: In antibody testing, both C line and T line are colored, indicating antibody positivity; only C line is colored, indicating antibody positivity; no C line is colored, indicating invalid results; In nucleic acid testing, Ct value ≤ 40 and a typical amplification curve indicates nucleic acid positivity; Ct value > 40 or no typical amplification curve indicates nucleic acid positivity; (4) Infection assessment: Based on the combination of nucleic acid and antibody test results, the infection stage is determined: nucleic acid positivity + antibody positivity indicates early infection; nucleic acid positivity + antibody positivity indicates mid-term infection; nucleic acid positivity + antibody positivity indicates recovery period infection; (5) Early warning response: For different infection stages, corresponding prevention and control recommendations are pushed, including isolating sick pigs, environmental disinfection, tracing the transmission chain, etc.
[0016] Furthermore, the detection steps of the latex microsphere-labeled immunochromatographic antibody detection card also include: diluting the sample with sample diluent (containing 8 g / L NaCl, 5 g / L Na2HPO4・12H2O, 1 g / L Na2H2PO4・2H2O, 0.1 ml / L Tween-20, 10 g / L BSA, and 0.1 ml / L ProClin-300) at a ratio of 1:10; further, taking 2 drops (approximately 50 μL) of sample and adding it to 500 μL of sample diluent at a ratio of approximately 1:10; taking 4 drops (approximately 100 μL) and adding them to the sample well; and interpreting the results within 10 minutes at room temperature.
[0017] Furthermore, the application of real-time detection systems in the prevention and control of African swine fever virus includes daily monitoring of pig farms, quarantine of live pig transportation, entry inspection of slaughterhouses, verification of the effectiveness of disinfection centers, and epidemiological investigations.
[0018] Furthermore, the latex microsphere conjugate of the labeled pad is diluted with a latex microsphere protein diluent (containing 1.36 g / L potassium dihydrogen phosphate, 14.51 g / L disodium hydrogen phosphate, 0.2 ml / L Tween-20, 5 g / L PVP, 20 g / L protein protectant, and 0.02% ProClin300 in a pH 7.2 aqueous solution) to ensure uniform dispersion and stable activity of the conjugate.
[0019] The present invention has the following beneficial effects: This invention employs a parallel detection mode combining nucleic acid and antibody indicators: a latex microsphere-labeled immunochromatographic antibody detection card completes antibody screening in 10 minutes, while lyophilized microsphere reagents and a MINI-PCR instrument complete nucleic acid detection in 1 hour. Both processes are performed simultaneously and their results are complementary. Leveraging the high sensitivity of nucleic acid detection, abnormal pigs with early infection (antibody negative + nucleic acid positive) can be prioritized, and the infection stage can be further determined using antibody detection results. This avoids missed detections and misjudgments associated with single-indicator detection, forming a complete detection system of rapid screening, accurate typing, and stage assessment. The total detection time is shortened by 3-4 hours compared to existing technologies (colloidal gold initial screening + laboratory PCR confirmation). The high sensitivity (1:1024) of the antibody detection card and the high specificity (dual primers, dual probes) of the nucleic acid detection reagent complement each other, avoiding missed detections of antibody-negative but nucleic acid-positive (early infection) and antibody-positive but nucleic acid-negative (previous infection). The overall accuracy rate reaches 99.2% in reducing misdiagnosis of infection; the test card requires no instruments and is suitable for rapid screening in the field and at temporary sites; the MINI-PCR instrument is portable and supports power bank power supply, making it suitable for on-site diagnosis in farms and slaughterhouses; freeze-dried reagents can be stored at room temperature, solving the problem of cold chain transportation. The combination of these three features achieves full-scenario coverage, increasing the number of applicable scenarios by 4-6 compared to existing technologies; the integration of testing data, infection assessment, and early warning push through WeChat mini-programs enables real-time information flow; after synchronization with regional platforms, cross-site and cross-regional joint prevention and control can be formed, avoiding the limitations of single-point prevention and control, and reducing the regional epidemic incidence rate by 40-50%. This invention improves antibody detection sensitivity by 8 times and shortens nucleic acid detection time by 33%; it establishes a nucleic acid-antibody dual-index evaluation system, achieving for the first time accurate classification of African swine fever infection stages, providing a scientific basis for the formulation of prevention and control measures; the cost of single-sample testing has been reduced from 200-500 yuan (sample delivery cost and laboratory PCR cost) to 50-80 yuan, reducing the annual testing cost for farms by 60-70%; the time for epidemic identification has been shortened by 22 hours, the spread range has been reduced by 60%, and the cost of epidemic prevention and control per farm has been reduced from 500,000-1,000,000 yuan to 100,000-200,000 yuan; through full-process monitoring, it reduces the loss of pig inventory, stabilizes pork market prices, and reduces supply shortages caused by the epidemic; it enables real-time reporting of epidemic information and joint prevention and control, avoiding cross-regional spread of the virus, and helping to detect, treat, and eradicate African swine fever early.
[0020] To more clearly illustrate the structural features and effects of the present invention, the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. Attached Figure Description
[0021] Figure 1 This is a schematic diagram of the SDS-PAGE identification results of the three batches of p30 antigen proteins mentioned in this invention; Figure 2 This is a schematic diagram of the assembly of the latex microsphere-labeled immunochromatographic antibody detection card mentioned in this invention.
[0022] Figure 3 This is a schematic diagram illustrating the result determination of the latex microsphere-labeled immunochromatographic antibody detection card mentioned in this invention.
[0023] Figure 4 This is a schematic diagram of the color chart for optimizing the interpretation of latex microsphere coupling concentration mentioned in this invention.
[0024] Figure 5 This is a schematic diagram of the structure of the MINI-PCR mentioned in this invention.
[0025] Figure 6 This is a schematic diagram of the lyophilized microsphere PCR reagent mentioned in this invention.
[0026] Figure 7 The results are the sensitivity test results of the latex microsphere-labeled immunochromatographic antibody detection card mentioned in this invention.
[0027] Figure 8 This refers to the specificity test results of the latex microsphere-labeled immunochromatographic antibody detection card mentioned in this invention. Detailed Implementation
[0028] The present invention will now be further described in conjunction with the accompanying drawings and relevant knowledge, and will be described clearly and completely. Obviously, the described applications are only some embodiments of the present invention, and not all embodiments.
[0029] This invention discloses a point-of-care detection system for African swine fever virus (ASFV), comprising a latex microsphere-labeled immunochromatographic antibody detection card, a lyophilized microsphere-type fluorescent PCR detection reagent, and a portable MINI-PCR instrument. The latex microsphere-labeled immunochromatographic antibody detection card uses recombinant ASFV p30 protein as the detection target and is used for detecting ASFV antibodies in porcine whole blood or serum. The lyophilized microsphere-type fluorescent PCR detection reagent contains dual primers and dual probes, as well as extraction-free components, and is compatible with the detection of multiple ASFV strains. The portable MINI-PCR instrument has a four-channel detection function. The latex microsphere-labeled immunochromatographic antibody detection card, MINI-PCR instrument, fluorescent PCR detection reagent, and their application in the combined clinical point-of-care quantitative detection of ASFV provided by this invention enable ASFV monitoring and early warning.
[0030] In this invention, the latex microsphere-labeled immunochromatographic antibody detection card is suitable for detecting ASFV antibodies in porcine whole blood or serum, and can diagnose ASFV infection within 10 minutes. It is particularly suitable for on-site ASFV infection diagnosis, epidemiological investigation, and quarantine inspection for international trade in live pigs. It is simple and convenient to operate, highly accurate, and practical, suitable for grassroots operational scenarios and personnel. The fluorescent PCR detection reagent of this invention uses dual primers and dual probes, compatible with the detection of multiple ASFV strains. This reagent is a lyophilized microsphere formulation containing extraction-free reagents, can be stored at room temperature, and is suitable for detection in pig farm environments, on pigs, in slaughterhouses, disinfection centers, and during the transportation of live pigs. It is simple and convenient to operate, highly accurate, and practical.
[0031] In a preferred embodiment of the present invention, the MINI-PCR instrument is small in size, preferably 10cm×20cm×33cm, and lightweight, weighing 660g; the number of samples tested is ≤4 wells / test; the light source channels are ≤4 channels: channel 1: 470nm; channel 2: 530nm; channel 3: 575nm; channel 4: 630nm; the instrument is connected to a mobile phone via Bluetooth, allowing for full operation of the experiment and receipt of results via mobile phone, with a testing time of less than 1 hour. The testing performance is not significantly different from large benchtop laboratory instruments, and the results are accurate.
[0032] In a preferred embodiment of the present invention, the method for preparing recombinant ASFV p30 protein includes the following steps: To induce expression, *Escherichia coli* BL21-p30 for production was inoculated at a rate of 1.0% (V / V) into LB liquid medium containing 50 µg / mL kanamycin and cultured at 37°C with shaking at 220 rpm for 12–16 hours as the seed culture. The seed culture was then inoculated at a rate of 1.0% (V / V) into LB liquid medium containing 50 µg / mL kanamycin and cultured at 37°C with shaking at 220 rpm. When the OD of the culture medium... 600nmWhen the value reaches 0.6–0.8, add IPTG to a final concentration of 0.2 mmol / L and incubate at 16°C for 14 hours to induce expression.
[0033] Antigen collection: After induction, the bacterial culture was centrifuged at 12000 rpm for 15 minutes to collect the bacterial pellet. The pellet was resuspended in pre-cooled PBS buffer and then sonicated. The bacterial cells were disrupted using an ultrasonic homogenizer with the following parameters: 3 seconds on, 6 seconds off, 10 minutes on, and 40W power, all performed in an ice bath. After the bacterial culture clarified, it was centrifuged at 12000 rpm for 10 minutes at 2–8°C, and the supernatant was collected.
[0034] Antigen purification was performed by equilibrating the Ni affinity chromatography column with equilibration buffer (1×PBS buffer; 300mM NaCl; pH=7.4). The treated antigen supernatant was loaded onto the column, and the column was washed with 5-10 column volumes of washing buffer (1×PBS buffer; 300mM NaCl; 50mM imidazole; pH=7.4). The target protein was eluted with elution buffer (1×PBS buffer, 300mM NaCl; 500mM imidazole; pH=7.4). The eluted target protein was dialyzed overnight at 2-8°C with dialysis buffer (1×PBS buffer, 300mM NaCl, pH 7.4), and the buffer was replaced. ULP1 enzyme was added for enzymatic digestion. The digested sample was loaded back onto the Ni affinity chromatography column, and the target protein in the flow-through was collected and filtered through a 0.22µm filter membrane.
[0035] The concentration and purity of the prepared p30 protein were determined using a spectrophotometer and SDS-PAGE method, referring to... Figure 1 As shown, this invention uses the African swine fever virus (ASFV) structural protein p30 expressed in Escherichia coli as a detection target and is developed based on latex microsphere immunochromatography. The detection line (T line) uses mouse anti-pig IgG, the control line (C line) uses goat anti-rabbit IgG, and latex microspheres conjugated with p30 protein and rabbit IgG protein are used as immunoprobes. The device is assembled with a matching sample dilution solution and is suitable for the rapid detection of ASFV antibodies in porcine whole blood or serum.
[0036] The latex microspheres had a particle size of 300 nm, and the p30 protein and rabbit IgG protein conjugation concentration was 60 µg / mL. The activation conditions were 37 °C for 30 min, and the blocking conditions were 37 °C for 30 min. The working concentration of goat anti-rabbit IgG in control line C is 1.5 mg / mL; The working concentration of mouse anti-pig IgG in the T-line detection line is 1.5 mg / mL; During membrane preparation, the antibody spraying amount was 1.0 μl / cm, the spraying speed was 3cm / s, and the distance between the detection line and the control line was 7mm.
[0037] In this invention, the preparation method of the African swine fever virus latex microsphere-labeled immunochromatographic antibody detection card includes the following steps: Preparation of the marking pad: Preparation of coupling buffer: Weigh 9.762g of MES powder and dissolve it in 800ml of ultrapure water. Stir until completely dissolved, adjust the pH to 6.0 with 1M NaOH solution, bring the volume to 1L, filter through a 0.22µm filter membrane, and store at 2~8℃.
[0038] To prepare the blocking solution, weigh 0.272 g of potassium dihydrogen phosphate and 1.144 g of dipotassium hydrogen phosphate, dissolve them in about 800 ml of ultrapure water, stir to dissolve, adjust the pH to 7.2, and bring the volume to 1 L. Then add 20 g of BSA and stir until completely dissolved. Add 0.2 ml of ProClin300 and mix well. Filter through a 0.22 µm filter membrane and store at 2-8 °C.
[0039] To prepare the preservation solution, weigh 0.272 g of potassium dihydrogen phosphate and 2.902 g of disodium hydrogen phosphate, add approximately 800 ml of ultrapure water, and stir until completely dissolved. Adjust the pH to 7.2 with 1 M HCl or NaOH, and bring the volume to 1 L. Mix well to obtain a 20 mM PBS buffer. Then add 5 g of BSA, stir until dissolved, add 0.2 ml of ProClin 300, mix well, filter through a 0.22 µm filter membrane, and store at 2–8 °C.
[0040] To prepare the latex microsphere diluent, weigh 1.36 g of potassium dihydrogen phosphate and 14.51 g of disodium hydrogen phosphate, dissolve them in approximately 800 ml of ultrapure water, stir to dissolve, adjust the pH to 7.2, and bring the volume to 1 L. Add 2 ml of Tween-20, 5 g of PVP, and 20 g of protein protectant in sequence, stir until completely dissolved, and finally add 0.2 ml of ProClin300 and mix well. Filter through a 0.22 µm filter membrane and store at 2–8 °C.
[0041] Preparation of latex microsphere-conjugated proteins: Activation: 0.1 ml of latex microspheres were added to 0.05 ml each of EDC and NHS dissolved in the conjugation solution, and the mixture was incubated at 37°C for 30 min. Conjugation of p30 protein: Activated latex microspheres were added to p30 protein dissolved in the conjugation solution, and the mixture was incubated overnight at 2-8°C. Blocking: 0.5 ml of blocking solution was added, and the mixture was incubated at 37°C for 30 min. Storage: Centrifugation was performed to remove the supernatant, and the mixture was washed twice with storage solution and then stored. Conjugation of rabbit IgG protein: Activated latex microspheres were added to rabbit IgG protein dissolved in the conjugation solution, and the mixture was incubated overnight at 2-8°C. Blocking: 0.5 ml of blocking solution was added, and the mixture was incubated at 37°C for 30 min. Storage: Centrifugation was performed to remove the supernatant, and the mixture was washed twice with storage solution and then stored.
[0042] Immobilization of latex microsphere-coupled proteins: High-concentration latex microsphere conjugates were ultrasonically diluted for 5 minutes to monodisperse the microspheres. The mixture was then diluted to the working concentration, thoroughly mixed, and uniformly coated onto the glass fibers to ensure even water absorption. Drying: The glass fibers were placed in a 37°C drying oven overnight. After drying, they were stored at room temperature in a moisture-proof environment.
[0043] The preparation of the coating membrane of the present invention includes: Preparation of coating solution: Weigh 0.136 g of potassium dihydrogen phosphate and 1.451 g of disodium hydrogen phosphate, dissolve them in about 800 ml of ultrapure water, stir to dissolve, adjust the pH to 7.2, and make up to 1 L; add 30 g of trehalose and stir until completely dissolved, then add 0.5 ml of ProClin300 and mix well, filter through a 0.22 µm filter membrane, and store at 2~8℃.
[0044] For secondary antibody coating, mouse anti-pig IgG and goat anti-rabbit IgG were diluted to 1.50 mg / ml with coating solution, and sprayed onto the detection line and control line of nitrocellulose membrane (NC membrane) adhered to PVC substrate at a volume of 1.0 µl per centimeter using a membrane applicator. The membranes were dried in an oven at 37°C for 15–20 hours, sealed in aluminum foil bags, and stored at 2–30°C for later use.
[0045] Sample pad preparation: Immerse the sample pad (300mm×16mm) in the sealing solution for 30 minutes, then dry it in an oven at 37℃ for 15-20 hours, seal it in an aluminum foil bag, and store it at 2-30℃ for later use.
[0046] To prepare the absorbent pad, cut the absorbent paper to a size of 300mm × 16mm and set it aside.
[0047] The test strip assembly consists of a sample pad, a marking pad, a nitrocellulose membrane, and an absorbent pad, which are sequentially adhered to a PVC base plate. After being cut into 3mm wide strips, they are then placed in a cartridge. Figure 2 As shown, sample pad 1, marking pad 2, and absorbent pad 3 are sequentially attached to their respective positions on the PVC base plate 7 to which the nitrocellulose membrane is adhered, so that the marking pad and absorbent pad are in partial contact with the nitrocellulose membrane, and the sample pad is in partial contact with the marking pad. Figure 2 The names of the markings are as follows: Sample pad 1, Marking pad 2, Nitrocellulose membrane 3, Absorbent pad 4, Detection line 5, Quality control line 6, PVC base plate 7.
[0048] The test strips are cut into 3mm wide strips using a strip cutter, then placed in an outer shell and packaged in an aluminum foil bag. Each bag contains one test strip, one disposable dropper, and one packet of desiccant.
[0049] For example, to prepare a 10,000 ml sample diluent, add 80 g NaCl, 50 g Na₂HPO₄·12H₂O, 10 g Na₂H₂PO₄·2H₂O, 1 ml Tween-20, 100 g bovine serum albumin, and 1 ml ProClin-300 to 5,000 ml of purified water, and bring the volume to 10,000 ml. Filter the solution through a 0.22 μm membrane for sterilization, and then aseptically dispense it.
[0050] To determine the optimal serum dilution factor, African swine fever virus positive and negative sera were diluted with sample diluent at 1:5, 1:10, 1:20, 1:40, and 1:80, respectively, and tested. The optimal serum dilution factor was 1:10, which resulted in high sensitivity of positive serum (bright T line) and negative results for both negative serum.
[0051] To select the optimal reaction time for the test strip, African swine fever virus negative and positive sera were diluted 10 times and added to the sample wells. The samples were then incubated at room temperature for 5 minutes, 10 minutes, and 15 minutes, respectively. The optimal reaction time was 10 minutes, when the positive serum showed high sensitivity (bright T line) and the negative serum showed negative results.
[0052] To determine the optimal sample addition volume, African swine fever virus negative and positive sera were diluted 10 times and then added to the sample wells at concentrations of 1 drop, 2 drops, 3 drops, 4 drops, 5 drops, and 6 drops, respectively. The optimal sample addition volume was 4 drops, which was achieved when the flow rate was less than 1 minute, the positive serum had high sensitivity (bright T line color), and the negative serum was negative.
[0053] Method of using the African swine fever virus antibody detection card of this invention: Sample preparation: Collect whole blood from pigs. The blood can be used directly or serum can be prepared using conventional methods.
[0054] Preparation for the test: Before use, bring the test card, sample diluent and whole blood or serum to be tested to room temperature (15-25°C).
[0055] Test: Tear open the aluminum foil bag, place the test card flat on the table, use a disposable dropper to draw up the sample to be tested, slowly add 2 drops (about 50µl) to the sample diluent, mix thoroughly, then draw up the diluted sample and add 4 drops (about 100µl) drop by drop to the sample well. Observe the results within 5 to 10 minutes. Results are invalid after 10 minutes.
[0056] Reference Figure 3As shown, the results are as follows: Positive: A band appears at both the C and T lines, indicating the presence of African swine fever virus antibodies in the sample. Negative: A band appears at the C line but not at the T line, indicating the absence of African swine fever virus antibodies in the sample. Invalid: No band appears at the C line, regardless of whether a band appears at the T line, indicating incorrect operation or an expired test strip.
[0057] In this invention, the latex microspheres are selected with a particle size in the range of 200 to 300 nm.
[0058] In a specific embodiment of the present invention, p30 protein latex microspheres were diluted to different concentrations of 20 µg / mL, 40 µg / mL, 60 µg / mL, 80 µg / mL, and 100 µg / mL, respectively. Rabbit IgG latex microspheres were also diluted to different concentrations of 20 µg / mL, 40 µg / mL, 60 µg / mL, and 80 µg / mL. These were then uniformly coated onto glass fibers, which were dried overnight in an oven at 37°C. The fibers were then removed and stored at room temperature under humidity protection as the labeling pads for the test strips. The glass fibers immobilized with the latex microsphere conjugates were assembled into a card strip. After the test strips were assembled, ASFV positive and negative sera were tested, and the optimal concentration was determined based on the test results. Rabbit IgG protein latex markers did not affect T-line interpretation but did affect C-line color; the optimal concentration for both was 60 µg / mL. The optimal concentration for p30 protein latex markers was also 60 µg / mL. The results are shown in Tables 1 and 2. Figure 4 .
[0059] Table 1. Detection results of ASFV positive serum at different p30 protein spray concentrations (µg / mL)
[0060] Judgment criteria: T-line chromaticity > G2 is considered positive; T-line chromaticity < G2 is considered negative.
[0061] Table 2. Detection results of ASFV negative serum at different p30 protein spray concentrations (µg / mL)
[0062] Judgment criteria: T-line chromaticity > G2 is considered positive; T-line chromaticity < G2 is considered negative.
[0063] In a specific embodiment of the present invention, the optimal concentrations of the T and C lines of the immunochromatographic test strip were optimized using a checkerboard titration method. Mouse anti-pig IgG protein and goat anti-rabbit IgG were diluted to different concentrations of 0.50 mg / mL, 1.00 mg / mL, 1.50 mg / mL, and 2.00 mg / mL, respectively. The optimal secondary antibody coating concentration was screened using a checkerboard method. The results are shown in Table 3. The optimal coating concentrations for both mouse anti-pig IgG protein and goat anti-rabbit IgG were 1.50 mg / mL.
[0064] Table 3. Determination of secondary antibody coating concentration (mg / mL)
[0065] Judgment criteria: T-line chromaticity > G2 is considered positive; T-line chromaticity < G2 is considered negative.
[0066] In a specific embodiment of the present invention, the preparation method of the ASFV fluorescent PCR reagent includes the following steps: preparation of primers and probes; the primers and probes are designed based on the conserved sequence of the ASFV p72 gene. The primers and probes are dissolved and diluted to 10 μmol / L with TE buffer and stored at 2–8°C for later use.
[0067] Primer-probe sequence 1: Upstream primer 1: ACCTGGAACATCTCCGATCAAA Downstream primer 1: GGGCTGCATAATGGCGTTAA Probe 1: FAM-TCCTCATCAACACCGAGATTGGCACA-BHQ1 Primer-probe sequence 2: Upstream primer 2: TACACGTTCGCTGCGTATCA Downstream primer 2: TATCGGTGGAGGGAACCAGT Probe 2: FAM-CATCGGTAAGAATAGGTTTGC-BHQ1 Preparation of lyophilized microspheres for fluorescent PCR: The fluorescent PCR reaction solution was prepared according to the grouping in Table 4, with each reaction system consisting of 15 μl. During preparation, the mixture was expanded proportionally according to the requirements and thoroughly mixed to form a mixed solution.
[0068] Table 4 Preparation of Fluorescent PCR Reaction Solution
[0069] The fluorescent PCR reaction solution was formed into microspheres using a liquid nitrogen dropper, which dropped the mixture into liquid nitrogen. The droplet volume was set to 15 µl, and the dropping rate was 5 s / drop, allowing the mixture to freeze rapidly in the liquid nitrogen to form microspheres.
[0070] The microsphere freeze-drying process involves transferring microspheres and liquid nitrogen into a freeze dryer. First, pre-freezing is performed to freeze the water in the microspheres into ice crystals. Then, sublimation drying is carried out under high vacuum to directly sublimate the frozen water into water vapor for removal. Finally, desorption drying is performed, with the temperature appropriately increased to further remove any remaining bound water from the microspheres.
[0071] In a specific embodiment of the present invention, the temperature control module of the MINI-PCR instrument uses a high-performance semiconductor ceramic cooler, combined with a high-precision temperature sensor system for temperature control; the optical module uses an all-solid-state laser module for excitation, and an ultra-high sensitivity photoelectric sensor for real-time detection. The MINI-PCR instrument is also equipped with a Bluetooth connectivity module, allowing for control via a WeChat mini-program, one-click operation via QR code scanning, and direct report generation of results.
[0072] In a specific embodiment of the present invention, the African swine fever virus early warning and monitoring scheme is to perform nucleic acid and antibody detection in parallel, and to assess the African swine fever infection time based on the detection results (Table 5).
[0073] Table 5 Evaluation Results
[0074] This invention combines molecular biology and immunological detection methods to successfully achieve real-time monitoring of African swine fever virus (ASFV). The detection results can be used to preliminarily determine the infection time and extent, accelerating on-site detection and clinical early warning. This invention eliminates the need for specialized facilities and is easy to operate, making it suitable for on-site clinical testing by grassroots staff. It improves testing efficiency and reduces the economic burden of laboratory construction and equipment acquisition. The ASFV antibody detection card of this invention has been modified for sensitivity and stability, enabling accurate identification of antigenic epitopes of multiple ASFV strains. The lyophilized microsphere qPCR uses dual primers and dual probes, making it compatible with multiple ASFV strains, and meeting both sensitivity and specificity requirements. The detection reagents of this invention have a wide temperature range for storage and operation, ranging from 2 to 30°C, facilitating transportation and storage.
[0075] Example 1, referring to Figure 7 As shown, the sensitivity test of the antibody test strip was performed using ASFV standard positive serum with dilution gradients. The results showed that the limit of detection reached 1:1024. The test strip exhibits good sensitivity.
[0076] Example 2, refer to Figure 8As shown, the specificity test of the antibody test strip was performed using inactivated porcine reproductive and respiratory syndrome virus (PRRSV), classical swine fever virus (CSFV), foot-and-mouth disease virus (FMDV), pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), porcine encephalitis virus (JEV), porcine parvovirus (PPV), porcine epidemic diarrhea virus (PEDV), and African swine fever virus (ASFV) negative serum to determine its specificity. The results showed that the test strip was negative for PRRSV, CSFV, FMDV, PRV, PCV2, JEV, PPV, PEDV, and African swine fever virus, indicating that the test strip has good specificity.
[0077] Example 3 shows that the antibody test card has a 100% concordance rate with the commercial ELISA antibody test kit. In African swine fever virus detection, under suitable application scenarios such as screening abnormal pigs, introducing new breeds, and double-negative evolution, the antibody test card can effectively replace the ELISA method. On-site operation offers advantages such as simplicity, speed, and low cost, improving the efficiency and flexibility of African swine fever detection in pig farms and reducing disease prevention risks.
[0078] Table 6. Detection results of antibody test cards and ELISA kits on clinical samples.
[0079] Note: The ELISA result interpretation standard is an OD value > 0.20 as positive.
[0080] Example 4: The protein prepared for the antibody detection card was compared with the protein coated by different brands using positive and negative samples. The results are shown in Table 7. The detection card made from the prepared protein had the best sensitivity, and the negative rate of the negative samples was 100%.
[0081] Table 7 Comparison results of different coating proteins
[0082] Example 5: African swine fever poses a huge threat to the pig farming industry. Accurate detection is the key to prevention and control. Due to the cost of sample delivery and personnel, there is an urgent need for portable clinical testing equipment in cases of abnormal pigs, multiple zones in a single plant, disinfection points, breeding service stations, slaughterhouses, and on-site services.
[0083] Freeze-dried microsphere reagents are superior to liquid reagents in terms of sensitivity, low copy nucleic acid detection rate, stability, and convenience. They are also easy to operate, can be used with MINI-PCR instruments, and are suitable for applications with low requirements for personnel, environment, and facilities, as well as portable and mobile applications. They can provide a reference for on-site detection of African swine fever virus nucleic acid.
[0084] The results of the comparative analysis of clinical samples were obtained by extracting nucleic acid using a nucleic acid extraction kit and amplifying the samples using both lyophilized microsphere PCR reagent and liquid reagent. The results are shown in Table 8. The results indicate that lyophilized microspheres are suitable for both blood and swab samples, and their amplification performance is superior to that of liquid reagent, with Ct values ranging from 1.44 to 5.77.
[0085] Table 8. Amplification results of clinical samples using lyophilized microspheres and liquid reagents.
[0086] The amplification performance of plasmid standards was compared using lyophilized microsphere PCR reagent and liquid reagent, respectively. The results are shown in Table 9. The results indicate that the detection rate of lyophilized microspheres for low-concentration plasmid standards was 100%, which is superior to that of liquid reagent.
[0087] Table 9. Amplification results of plasmid standards using lyophilized microspheres and liquid reagents.
[0088] The amplification performance of nucleic acid standards was compared using lyophilized microsphere PCR reagent and liquid reagent, respectively. The results are shown in Table 10. The results indicate that the detection rate of lyophilized microspheres for low-concentration nucleic acid standards was 100%, and the Ct values were lower than those of liquid reagents, demonstrating superior amplification performance.
[0089] Table 10 Amplification results of nucleic acid standards using lyophilized microspheres and liquid reagents.
[0090] The amplification performance of clinical samples with low viral load was compared. Lyophilized microsphere PCR reagents and liquid reagents were used to amplify clinical samples with low viral load, and the results are shown in Table 11. The results indicate that lyophilized microspheres, which could not be detected by liquid reagent in the retesting of clinical samples with low viral load, can be detected by retesting. This method is suitable for the detection, retesting, and confirmation of abnormal results in clinical samples with low viral load, and is applicable to human, environmental, and swine samples.
[0091] Table 11 Amplification results of lyophilized microspheres and liquid reagents on clinical samples with low viral load
[0092] The performance comparison of clinical sample amplification using the extraction-free reagent with lyophilized microspheres and the nucleic acid extraction reagent with liquid reagent was presented in Table 12. Clinical samples were amplified using both the extraction-free reagent with lyophilized microspheres and the nucleic acid extraction reagent with liquid reagent, and the results are shown in Table 12. The results indicate that the detection results of the extraction-free reagent with lyophilized microspheres and the nucleic acid extraction reagent with liquid reagent are basically consistent, with a Ct value difference within 1, making them suitable for blood and swab samples.
[0093] Table 12 Amplification results of clinical samples using hands-free reagents combined with lyophilized microspheres and nucleic acid extraction reagents combined with liquid reagents.
[0094] For specific assays, amplification was performed on clinical negative samples and specific quality controls using extraction-free reagents combined with lyophilized microspheres, nucleic acid extraction reagents combined with lyophilized microspheres, and nucleic acid extraction reagents combined with liquid reagents, respectively. The results are shown in Table 13. The results indicate that the negative rate for all negative samples and specific quality controls was 100%.
[0095] Table 13 Amplification results of clinical negative samples and specific quality control samples
[0096] In Example 6, samples were tested using both a MINI-PCR instrument and a laboratory benchtop PCR instrument. The results are shown in Tables 14-16. The results showed that the Ct values of positive samples detected by the MINI-PCR instrument were all lower than those detected by the laboratory benchtop PCR instrument, with the Ct value difference ranging from 1.84 to 5.27.
[0097] Table 14 Amplification results of different PCR instruments
[0098] Table 15 Amplification results from different PCR instruments
[0099] Table 16 Amplification results from different PCR instruments
[0100] This invention designs a latex microsphere-labeled immunochromatographic antibody detection card, a portable MINI-PCR instrument, and a lyophilized microsphere-type fluorescent PCR detection reagent. The detection card targets recombinant ASFV p30 protein, completing antibody detection within 10 minutes with a limit of detection of 1:1024 and specificity >99%. The lyophilized microsphere-type fluorescent PCR detection reagent employs a dual-primer, dual-probe design with a limit of detection of 1 copy / μl. This invention achieves full-cycle ASFV infection detection through a collaborative process of antibody screening, nucleic acid confirmation, and result evaluation, advancing the time to outbreak detection to 1-3 days after infection and shortening the early warning response time by more than 60%. Furthermore, the system is simple to operate, low-cost, requires no professional personnel or laboratory, and can be deployed in grassroots settings such as pig farms, slaughterhouses, and veterinary stations, effectively addressing the pain points of existing detection technologies and providing key technical support for African swine fever prevention and control.
[0101] Example 7: This example is based on a three-in-one real-time detection system using latex microsphere-labeled immunochromatographic antibody detection cards, lyophilized microsphere fluorescent PCR detection reagents, and a portable MINI-PCR instrument. Combined with a monitoring and early warning method of parallel detection of nucleic acid and antibody dual indicators, it realizes rapid and accurate detection and hierarchical prevention and control of African swine fever virus (ASFV) throughout the entire infection cycle.
[0102] Preparation of latex microsphere-labeled immunochromatographic antibody detection cards: Preparation of recombinant ASFV p30 protein: Induction of expression: Escherichia coli BL21-p30 strain was inoculated at a rate of 1.0% (V / V) into LB medium containing 50 μg / mL kanamycin and cultured at 37℃ and 220 rpm for 12–16 h to obtain seed culture; then, it was transferred to the same medium at a rate of 1.0% (V / V) and cultured until OD... 600nm When the concentration is 0.6~0.8, add IPTG to a final concentration of 0.2 mmol / L and induce expression at 16℃ for 14 h.
[0103] Antigen collection: After induction, the bacterial culture was centrifuged at 12000 r / min for 15 min to collect the bacterial cells. After resuspending in pre-cooled PBS, the cells were sonicated at 40 W power for 3 s on and 6 s on the ice bath for 10 min. The supernatant was then collected by centrifugation at 12000 r / min at 2~8℃ for 10 min.
[0104] Antigen purification: Equilibrate the Ni affinity chromatography column with pH 7.4 PBS containing 300 mM NaCl. After loading the sample, wash with 5-10 column volumes of pH 7.4 PBS containing 300 mM NaCl and 50 mM imidazole. Then elute the target protein with pH 7.4 PBS containing 300 mM NaCl and 500 mM imidazole. Dialyze the eluent overnight at 2-8°C using the same buffer. After digestion with ulp1 enzyme, load the sample onto the Ni column again. Collect the flow-through and filter through a 0.22 μm filter membrane.
[0105] Purity testing: Concentration is measured by spectrophotometer, and purity is verified by SDS-PAGE to ensure that the testing requirements are met.
[0106] Preparation of test card components: Label pad preparation: The coupling buffer was a pH 6.0 aqueous solution containing 9.762 g / L MES (filtered through a 0.22 μm filter membrane); 0.1 ml of latex microspheres (300 nm in diameter) was added to 0.05 ml of coupling buffer containing EDC and 0.05 ml of coupling buffer containing NHS, and reacted at 37 °C for 30 min; coupling buffers containing 60 μg / mL p30 protein and 60 μg / mL rabbit IgG protein were added separately, and reacted overnight at 2–8 °C; 0.5 ml of blocking buffer (pH 7.2 aqueous solution containing 0.272 g / L potassium dihydrogen phosphate, 1.144 g / L dipotassium hydrogen phosphate, 20 g / L BSA, and 0.02% ProClin 300) was added, and reacted at 37 °C for 30 min. After centrifugation and removal of supernatant, the mixture was placed in preservation buffer (containing 0.272 g / L potassium dihydrogen phosphate, 2.902 g / L disodium hydrogen phosphate, and 5 g / L... Wash twice with BSA and 0.02% ProClin300 in 20mM pH7.2 PBS, resuspend, and sonicate for 5 min. Dilute to working concentration with latex microglobulin diluent (containing 1.36 g / L potassium dihydrogen phosphate, 14.51 g / L disodium hydrogen phosphate, 0.2 ml / L Tween-20, 5 g / L PVP, 20 g / L protein protectant, and 0.02% ProClin300 in pH7.2 aqueous solution), coat with glass fiber, and dry overnight at 37°C.
[0107] Preparation of the coating membrane: The coating solution was an aqueous solution with pH 7.2 containing 0.136 g / L potassium dihydrogen phosphate, 1.451 g / L disodium hydrogen phosphate, 30 g / L trehalose, and 0.05% ProClin 300; mouse anti-pig IgG and goat anti-rabbit IgG were diluted to 1.5 mg / mL with the coating solution and sprayed onto the nitrocellulose membrane at a spraying rate of 1.0 μl / cm and a speed of 3 cm / s (the spacing between the detection line T line and the control line C line was 7 mm), and dried at 37℃ for 15~20 h.
[0108] Sample pad preparation: Immerse a 300mm×16mm sample pad in a blocking solution for 30min and dry at 37℃ for 15~20h.
[0109] Assembly and Cutting: Adhere the sample pad, marking pad, nitrocellulose membrane, and absorbent pad to the PVC base plate in sequence, with each component overlapping. Cut into 3mm wide test strips, pack into the cartridge, and seal in an aluminum foil bag (containing 1 test strip, 1 dropper, and 1 pack of desiccant).
[0110] Sample dilution preparation: Prepare an aqueous solution containing 8 g / L NaCl, 5 g / L Na2HPO4・12H2O, 1 g / L Na2H2PO4・2H2O, 0.1 ml / L Tween-20, 10 g / L BSA, and 0.1 ml / L ProClin-300. Sterilize by filtration through a 0.22 μm filter membrane and aseptically dispense.
[0111] Preparation of lyophilized microsphere fluorescent PCR detection reagent: Primer and probe design and synthesis: Double primers and double probes were designed based on the conserved sequence of the ASFV p72 gene. After synthesis, they were diluted with TE buffer to 10 μmol / L and stored at 2~8℃.
[0112] Upstream primer 1: ACCTGGAACATCTCCGATCAAA Downstream primer 1: GGGCTGCATAATGGCGTTAA Probe 1: FAM-TCCTCATCAACACCGAGATTGGCACA-BHQ1 Upstream primer 2: TACACGTTCGCTGCGTATCA Downstream primer 2: TATCGGTGGAGGGAACCAGT Probe 2: FAM-CATCGGTAAGAATAGGTTTGC-BHQ1 Preparation of reaction solution: Mix primers (1-0.6 μl upstream primer, 1-0.6 μl downstream primer, 2-0.3 μl upstream primer, 2-0.3 μl downstream primer), probes (1-0.6 μl probes, 2-0.3 μl probes), and lyophilizable Premix-12.3 μl according to the preset ratio to prepare a 15 μl / reaction mixture.
[0113] Microsphere formation: The mixture is dropped into liquid nitrogen at a rate of 5 seconds per drop using a liquid nitrogen dropper to form microspheres.
[0114] Freeze-drying process: The microspheres and liquid nitrogen are transferred to a freeze dryer, pre-frozen to -45°C and maintained for a set time, then heated to -15°C for sublimation drying, and finally heated to 20°C to complete the desorption drying, so as to prepare freeze-dried microsphere reagents. After being packaged in aluminum foil bags with the desiccant pack, they can be stored at room temperature.
[0115] Portable MINI-PCR instrument parameter configuration: Basic parameters: 10cm×20cm×33cm in size, 660g in weight, supports ≤4 wells / sample testing.
[0116] Temperature control module: It adopts a semiconductor ceramic cooling chip and a high-precision temperature sensor, with a temperature control accuracy of ±0.1℃.
[0117] Optical module: Includes an all-solid-state laser excitation unit (four channels: 470nm, 530nm, 575nm, and 630nm) and an ultra-high sensitivity photoelectric sensor, which can acquire fluorescence signals in real time.
[0118] Communication module: Supports Bluetooth connection to mobile phones, WeChat QR code scanning for startup, parameter setting, test report generation and result push.
[0119] Monitoring and early warning methods and procedures: Sample collection: Collect whole blood from pigs or prepare serum; tail root blood is also applicable.
[0120] Parallel detection, antibody detection: Dilute 2 drops of sample with sample diluent, add 4 drops to the sample well of the test card, and interpret the results within 10 minutes at room temperature. Nucleic acid detection: Take 1 drop of the sample treated with the extraction-free reagent, reconstitute it with lyophilized microsphere reagent, place it in the MINI-PCR instrument, and start the detection program by scanning the QR code via WeChat. The detection time is <1 hour.
[0121] Results Interpretation: Antibody Detection: Both C and T lines show color, indicating a positive antibody result; only the C line shows color, indicating a negative antibody result; no color on the C line indicates an invalid result. Nucleic Acid Detection: View test results on your mobile phone. A Ct value ≤ 40 with a typical amplification curve indicates a positive nucleic acid result; a Ct value > 40 or no amplification curve indicates a negative nucleic acid result. Infection Assessment: Infection stage is determined based on a combination of dual indicators—positive nucleic acid and negative antibodies indicate early infection; positive nucleic acid and positive antibodies indicate mid-stage infection; negative nucleic acid and positive antibodies indicate recovery stage infection. Early Warning Response: For early infection, recommendations are sent to isolate infected pigs, conduct comprehensive disinfection, and trace the transmission chain; for mid-stage infection, recommendations are sent to expand the isolation area, increase disinfection frequency, and conduct sample screening; for recovery stage infection, recommendations are sent to continuously monitor, gradually lift isolation, and conduct immunization assessment.
[0122] Technical effectiveness verification: Detection performance verification: Sensitivity: The limit of detection for ASFV standard positive serum using the latex microsphere-labeled immunochromatographic antibody test card is 1:1024, which is 8 times higher than the existing colloidal gold test strip (1:128); the limit of detection for plasmid standards using the lyophilized microsphere PCR reagent is 0.58 copies / μL, and the limit of detection for nucleic acid standards is 1 copy / μL. The detection rate of low viral load samples is 100%, which is superior to liquid reagents.
[0123] Specificity: The antibody test card showed negative results for both PRRSV, CSFV, FMDV, PRV, PPV, PCV2, JEV, and PEDV antibody-positive sera and ASFV negative sera, with a specificity >99%. The PCR lyophilized reagent achieved a 100% negative rate for both PRRSV, CSFV, PRV, PPV, PCV2, and PEDV antibody-positive samples and ASFV negative samples, with no cross-reactivity.
[0124] Accuracy: The antibody test card and ELISA kit showed 100% concordance rate; the Ct value difference between the MINI-PCR instrument and the laboratory benchtop PCR instrument for positive samples ranged from 1.84 to 5.27, with no significant difference in detection performance; the overall system accuracy reached 99.2%.
[0125] Efficiency and cost advantages: Detection speed: Antibody screening is completed in 10 minutes, nucleic acid diagnosis is completed in less than 1 hour, and the total testing time is shortened by 3 to 4 hours compared with the existing technology (colloidal gold initial screening + laboratory PCR diagnosis); the epidemic identification time is shortened from more than 24 hours with the existing technology to 1 to 3 days, and the early warning response time is shortened by more than 60%.
[0126] Cost control: The cost of single sample testing is reduced to 50-80 yuan, which is 60-70% lower than laboratory PCR (200-500 yuan / sample); the annual testing cost of farms is reduced by 60-70%, and the cost of single-farm epidemic prevention and control is reduced from 500,000-1,000,000 yuan to 100,000-200,000 yuan.
[0127] Scene adaptability verification: Full-scenario coverage: The system is compatible with multiple scenarios such as daily monitoring of pig farms, quarantine of live pig transportation, entry inspection of slaughterhouses, verification of disinfection center effectiveness, and epidemiological investigation, adding 4 to 6 more scenarios compared to existing technologies.
[0128] Convenience: The test card requires no instruments and is suitable for rapid screening in the field or at temporary sites; the MINI-PCR instrument is powered by a power bank and operated via WeChat mini-program, requiring no professional personnel; the lyophilized reagents can be stored at room temperature, solving the problem of cold chain transportation.
[0129] Verification of prevention and control effectiveness: In a pilot application at 10 large-scale pig farms (total stock of 50,000 pigs), the system enabled early detection and treatment of ASFV, reducing the regional epidemic incidence rate by 40-50% and the spread of the epidemic by 60%. The loss rate of pig stock was reduced by 35% compared with the control group that did not use the system, effectively stabilizing the pork market supply.
[0130] This embodiment fully verifies the high sensitivity, high specificity, portability, and all-scenario adaptability of the point-of-care testing system by completely integrating the testing card, PCR reagents, and MINI-PCR instrument into a monitoring and early warning process. The system not only solves the pain points of existing technologies, such as slow detection speed, low sensitivity, poor portability, and delayed early warning, but also achieves precise segmentation of the infection stage through nucleic acid-antibody dual-indicator evaluation. It provides a scientific, efficient, and low-cost technical solution for African swine fever prevention and control, and has broad application value.
[0131] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A point-of-care testing system for African swine fever virus, characterized in that, The invention includes a latex microsphere-labeled immunochromatographic antibody detection card, a lyophilized microsphere-type fluorescent PCR detection reagent, and a portable MINI-PCR instrument. The latex microsphere-labeled immunochromatographic antibody detection card uses recombinant ASFV p30 protein as the detection target and is used for the detection of ASFV antibodies in porcine whole blood or serum. The lyophilized microsphere-type fluorescent PCR detection reagent contains dual primers and dual probes, as well as extraction-free components, and is compatible with the detection of multiple ASFV strains. The portable MINI-PCR instrument has a four-channel detection function.
2. The real-time detection system according to claim 1, characterized in that, The latex microsphere-labeled immunochromatographic antibody detection card includes a PVC base plate, a sample pad, a labeling pad, a nitrocellulose membrane, and an absorbent pad sequentially adhered to the PVC base plate; the nitrocellulose membrane has a detection line and a control line, the detection line is coated with mouse anti-pig IgG, and the control line is coated with goat anti-rabbit IgG; the labeling pad is loaded with latex microsphere conjugates.
3. The real-time detection system according to claim 2, characterized in that, The preparation method of the recombinant ASFV p30 protein includes: (1) induction of expression: Escherichia coli BL21-p30 strain is inoculated into kanamycin LB medium to obtain seed culture; then transferred to the same LB medium, IPTG is added to a final concentration of 0.2 mmol / L, and expression is induced at 16℃ for 14 h; (2) antigen collection: after induction, the bacterial culture is centrifuged to collect the bacterial cells, resuspended in pre-cooled PBS, and the supernatant is collected by centrifugation; (3) antigen purification: the Ni affinity chromatography column is equilibrated with pH 7.4 PBS containing 300 mM NaCl, the antigen supernatant is loaded, and 5-10 column volumes are washed with pH 7.4 PBS containing 300 mM NaCl and 50 mM imidazole, and then the target protein is eluted with pH 7.4 PBS containing 300 mM NaCl and 500 mM imidazole; the eluent is purified by pH 7.4 PBS containing 300 mM NaCl. Dialyze overnight at 2~8℃, add ulp1 enzyme digestion and load again onto Ni column, collect flow-through and filter through 0.22μm filter membrane; (4) Purity detection: use spectrophotometer to measure concentration and SDS-PAGE method to verify purity.
4. The real-time detection system according to claim 2, characterized in that, The preparation of the latex microsphere-labeled immunochromatographic antibody detection card further includes: (1) preparation of the labeling pad: the coupling buffer is a pH 6.0 aqueous solution containing 9.762 g / L MES; the blocking solution is a pH 7.2 aqueous solution containing 0.272 g / L potassium dihydrogen phosphate, 1.144 g / L dipotassium hydrogen phosphate, 20 g / L LBSA, and 0.02% ProClin 300; the preservation solution is a 20 mM pH 7.2 solution containing 0.272 g / L potassium dihydrogen phosphate, 2.902 g / L disodium hydrogen phosphate, 5 g / L LBSA, and 0.02% ProClin 300. PBS; Take 0.1 ml latex microspheres, add 0.05 ml of EDC-containing coupling buffer and 0.05 ml of NHS-containing coupling buffer, react at 37℃ for 30 min; Add coupling buffers containing p30 protein and rabbit IgG protein respectively, react at 2~8℃ overnight; Add 0.5 ml blocking buffer, react at 37℃ for 30 min, centrifuge to remove supernatant, wash twice with preservation solution, resuspend, sonicate for 5 min, dilute to working concentration, coat glass fiber, dry at 37℃ overnight; (2) Preparation of coating membrane: The coating solution is containing 0.136 g / L potassium dihydrogen phosphate, 1.451 (2) pH 7.2 aqueous solution of disodium hydrogen phosphate (g / L), trehalose (30g / L), and ProClin 300 (0.05%); dilute mouse anti-pig IgG and goat anti-rabbit IgG to 1.5mg / mL with coating solution, spray onto nitrocellulose membrane at a spraying rate of 1.0μl / cm and a speed of 3cm / s, and dry at 37℃ for 15~20h; (3) Sample pad preparation: soak 300mm×16mm sample pad in blocking solution for 30min, and dry at 37℃ for 15~20h; (4) Assembly and cutting: attach the sample pad, label pad, nitrocellulose membrane, and absorbent pad to the PVC base plate in sequence, with the label pad overlapping the nitrocellulose membrane and sample pad, and the absorbent pad overlapping the nitrocellulose membrane. Cut into 3mm wide test strips, put into the card case and seal in an aluminum foil bag.
5. The real-time detection system according to claim 1, characterized in that, The preparation method of the lyophilized microsphere fluorescent PCR detection reagent includes: (1) Primer and probe preparation: Design double primers and double probes according to the conserved sequence of ASFV p72 gene, and after synthesis, dilute with TE buffer to 10 μmol / L and store at 2~8℃; (2) Reaction solution preparation: Mix primers, probes and freeze-dryable Premix according to the preset ratio to prepare a 15μl / reaction mixture; (3) Microsphere forming: Use a liquid nitrogen dropper to drop the mixture into liquid nitrogen at a rate of 5s / drop to form microspheres; (4) Lyophilization treatment: Transfer the microspheres and liquid nitrogen to a freeze dryer, pre-freeze to -45℃ and maintain for a set time, then raise the temperature to -15℃ for sublimation drying, and finally raise the temperature to 20℃ to complete the desorption drying to prepare lyophilized microsphere reagent.
6. The real-time detection system according to claim 1, characterized in that, The portable MINI-PCR instrument includes a temperature control module, an optical module, and a Bluetooth communication module. The temperature control module uses a semiconductor ceramic cooler and a high-precision temperature sensor to achieve a temperature control accuracy of ±0.1℃. The optical module contains an all-solid-state laser excitation unit and an ultra-high sensitivity photoelectric sensor, which can collect fluorescence signals in real time.
7. The real-time detection system according to claim 2, characterized in that, The latex microsphere conjugate of the labeling pad is diluted with latex microsphere protein diluent to ensure uniform dispersion and stable activity of the conjugate.
8. A method for monitoring and early warning of African swine fever virus based on the real-time detection system according to any one of claims 1 to 6, characterized in that, The steps include: (1) Sample collection: collect whole blood from pigs or prepare serum, tail root blood is applicable; (2) Parallel detection: use latex microsphere labeled immunochromatographic antibody detection card to detect antibodies, and use lyophilized microsphere fluorescent PCR detection reagent and portable MINI-PCR instrument to detect nucleic acid; (3) Result determination: in antibody detection, both C line and T line are colored, which means antibody is positive; only C line is colored, which means antibody is negative; and C line is not colored, which means the result is invalid; in nucleic acid detection, Ct value ≤ 40 and there is a typical amplification curve, which means nucleic acid is positive; Ct value > 40 or no amplification curve, which means nucleic acid is negative; (4) Infection assessment: determine the infection stage based on the combination of nucleic acid and antibody detection results: nucleic acid positive + antibody negative means early infection; nucleic acid positive + antibody positive means mid-term infection; and nucleic acid negative + antibody positive means recovery period infection; (5) Early warning response: push corresponding prevention and control suggestions for different infection stages, including isolating sick pigs, environmental disinfection, tracing the transmission chain, etc.
9. The monitoring and early warning method according to claim 8, characterized in that, The detection steps of the latex microsphere-labeled immunochromatographic antibody detection card also include: taking 2 drops of sample and adding them to the sample diluent to dilute approximately 1:10, taking 4 drops and adding them to the sample well, and interpreting the results within 10 minutes at room temperature.
10. The application of the real-time detection system according to any one of claims 1 to 6 in the prevention and control of African swine fever virus, characterized in that, Application scenarios include daily monitoring of pig farms, quarantine of live pig transportation, entry inspection of slaughterhouses, verification of the effectiveness of disinfection centers, and epidemiological investigations.
Citation Information
Patent Citations
Freeze-drying type African swine fever virus quick Q-PCR detection method and reagent kit
CN110468239A
Method for detecting African swine fever virus
CN111020058A
Extraction-free triple fluorescent quantitative PCR (Polymerase Chain Reaction) detection composition, method and kit for nucleic acid of African swine fever virus
CN113308570A
African swine fever virus antibody rapid detection test strip and preparation method and application thereof
CN113640513A
Triple fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit for African swine fever
CN118910332A