RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) and immunochromatography combined porcine epidemic diarrhea virus nucleic acid detection kit and application thereof

Abstract

The invention belongs to the technical field of molecular biological detection, and particularly relates to an RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) and immunochromatography combined PEDV (Porcine Epidemic Diarrhea Virus) nucleic acid detection kit and application thereof. According to the kit, the high sensitivity and high specificity of the loop-mediated isothermal amplification technology and the rapid and visual interpretation advantages of the immunochromatography test strip are combined, and on-site, rapid and accurate detection of the PEDV is achieved. The core of the invention comprises a set of specific primer group designed for a PEDV N gene conserved region, an optimized RT-LAMP reaction system and an immunochromatography test strip which is specially treated and is used for detecting an LAMP amplification product. The kit does not need an expensive thermal cycler, the whole detection process is completed within 40 min, the sensitivity can reach 100 copies / [mu] L, and the kit is particularly suitable for rapid diagnosis and epidemic prevention and control of sites such as pig farms and grassroots veterinary stations.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection technology, specifically relating to a nucleic acid detection kit for porcine epidemic diarrhea virus combined with RT-LAMP and immunochromatography and its application. Background Technology

[0002] Porcine epidemic diarrhea virus (PEDV) causes porcine epidemic diarrhea, characterized by diarrhea, vomiting, and dehydration. It is a major pathogen causing diarrhea and death in piglets. Pigs at other stages can remain carriers after infection, causing severe economic losses to the pig industry worldwide. Currently, the main control measures for PEDV are immunizing sows with inactivated and attenuated vaccines to induce maternal antibodies and protect piglets. Therefore, detecting anti-PEDV antibodies in sow milk, blood, and piglet blood is an effective means of diagnosing infection or evaluating vaccine immunogenicity. Current detection methods for PEDV mainly include: Virus isolation and identification: considered the "gold standard," but time-consuming (days to weeks), technically demanding, and unsuitable for rapid diagnosis; Enzyme-linked immunosorbent assay (ELISA): mainly used to detect antibodies, but prone to false negatives in the early window period of infection and unable to distinguish between vaccine and wild-type viruses. Reverse transcription-polymerase chain reaction (RT-PCR): While highly sensitive, it relies on sophisticated and expensive PCR instruments and gel electrophoresis equipment, is complex to operate, and carries the risk of aerosol contamination, making it difficult to promote at the grassroots level. Real-time quantitative PCR (qPCR) PCR: High sensitivity and quantification, but the equipment is expensive and requires highly skilled operators, making it unsuitable for rapid on-site testing.

[0003] LAMP (Loop-Mediated Isothermal Amplification) is a novel nucleic acid amplification technique that enables exponential amplification of target genes within a short time (15-60 minutes) using a DNA polymerase with strand displacement activity at a constant temperature (approximately 60-65°C). Furthermore, the BST enzyme used in LAMP has both amplification and reverse transcription activity, allowing for the simultaneous amplification of both RNA and DNA samples. LAMP offers advantages such as low equipment requirements (water bath or metal bath suffices), high sensitivity, and strong specificity. However, traditional LAMP result interpretation relies heavily on turbidity observation, fluorescent dyes, or gel electrophoresis, resulting in complex and cumbersome product analysis procedures.

[0004] Therefore, there is an urgent need in this field for a solution that combines the high efficiency of RT-LAMP technology with an intuitive, equipment-free detection method to achieve truly rapid and accurate on-site diagnosis of PEDV. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention aims to provide a PEDV detection kit that is simple to operate, rapid, sensitive, specific, suitable for field use, and features a simple preparation process and low manufacturing cost. This kit perfectly solves the problems of high equipment dependence, complex operation steps, and inconvenient interpretation associated with traditional methods by combining RT-LAMP amplification with colloidal gold test strip detection.

[0006] In this regard, the present invention includes, but is not limited to, the following technical solutions: In some embodiments, the present invention provides a primer set for RT-LAMP detection of PEDV, comprising an outer primer pair, an inner primer pair, and a loop primer pair, wherein the outer primer pair comprises an outer forward primer and an outer reverse primer, the inner primer pair comprises an inner forward primer and an inner reverse primer, and the loop primer pair comprises a loop forward primer and a loop reverse primer, characterized in that the sequences are as follows: External forward primer: ACAGCGGCAAAAATACACCT; External reverse primer: AACTGGCGATCTGAGCATAG; Internal forward primer: CGCCCTTGGGAATTCTCCTCCGGCCACTTCGAAGGAACG; Internal reverse primers: GCAGCTTGCTTCGGACCCAGCCTGACGCATCAACACCTT; Forward loop primer: ACTCTGGGATGTCTTTGAGGTCA; Reverse loop primer: AAACTTTGGAGATGCGGAATTTGTC.

[0007] In some embodiments, the primer set described in this invention is used to amplify the PEDV N gene.

[0008] In some embodiments, the primer set of the present invention is marked with markers in the following manner: the 5' end of the loop forward primer is marked with a first marker, and the 5' end of the inner forward primer is marked with a second marker; the first marker and the second marker are different.

[0009] In some embodiments, the markers described in this invention are selected from biotin and fluorescent groups.

[0010] In some embodiments, the fluorescent groups of the present invention include FITC, TAMRA, Cy3, and Cy5.

[0011] In some implementations, the first marker at the 5' end of the loop forward primer is TAMRA.

[0012] In some implementations, the second marker at the 5' end of the internal forward primer is biotin.

[0013] In some specific implementations, the first marker at the 5' end of the loop forward primer is TAMRA, and the second marker at the 5' end of the inner forward primer is biotin.

[0014] In some embodiments, the present invention provides an RT-LAMP reaction system for detecting PEDV, comprising the primer set described herein, preferably wherein the 5' end of the loop forward primer is labeled with a first marker, and the 5' end of the inner forward primer is labeled with a second marker; the first marker and the second marker are different.

[0015] In some embodiments, the reaction system of the present invention further comprises 10×LAMP Buffer, magnesium sulfate, dNTPs, DNA polymerase, and nucleic acid sample to be tested.

[0016] In some embodiments, the amount of 10×LAMP buffer in the RT-LAMP reaction system of the present invention is approximately 2.5 μL; And / or, the magnesium sulfate concentration is 10 mM-13 mM; And / or, the dNTP concentration is 1 mM-1.4 mM; And / or, the concentrations of the external forward primer and the external reverse primer are 0.2 mM-0.6 mM, respectively; And / or, the concentrations of the internal forward primer and the internal reverse primer are 2 mM-4 mM, respectively; And / or, the concentrations of the forward and reverse loop primers are 0.2 mM each. 0.6 mM; And / or, the amount of DNA polymerase added is 4 U. 16 U.

[0017] In some specific implementations, the magnesium sulfate concentration is approximately 13 mM.

[0018] In some specific implementations, the dNTP concentration is approximately 1.4 mM.

[0019] In some embodiments, the concentrations of the external forward primer and the external reverse primer are approximately 0.2, 0.3, 0.4, 0.5, or 0.6 mM, respectively. Preferably, the concentrations of the external forward primer and the external reverse primer are approximately 0.2 mM, respectively.

[0020] In some embodiments, the concentrations of the internal forward primer and the internal reverse primer are approximately 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, or 4 mM, respectively. Preferably, the concentrations of the internal forward primer and the internal reverse primer are approximately 2-2.4 mM, respectively. More preferably, the concentrations of the internal forward primer and the internal reverse primer are approximately 2 mM, respectively.

[0021] In some embodiments, the concentrations of the loop forward primer and the reverse primer are approximately 0.2, 0.3, 0.4, 0.5, or 0.6 mM, respectively. Preferably, the concentrations of the external forward primer and the external reverse primer are approximately 0.4 mM, respectively.

[0022] In some embodiments, the amount of DNA polymerase added is approximately 4, 5, 6, 7, 8, 9, 10, 11, or 12 U. Preferably, the amount of DNA polymerase added is approximately 8 U.

[0023] In some embodiments, the 10×LAMP Buffer of the present invention contains about 20 mM Tris-HCl, about 10 mM potassium chloride, and a surfactant volume percentage of about 0.1%-0.3%.

[0024] In some embodiments, the surfactant of the present invention includes at least one of Tween 20, Triton, and ethyl phenyl polyethylene glycol (NP-40).

[0025] In some specific embodiments, the DNA polymerase described in this invention is Bst DNA polymerase, which has both amplification and reverse transcription activities, for example, Bst 3.0. ® DNA polymerase.

[0026] In some embodiments, the present invention also provides an immunochromatographic test strip for detecting PEDV, the immunochromatographic test strip comprising a sample pad, a reading area, a conjugate pad, and an absorbent pad; wherein the sample pad, conjugate pad, reading area, and absorbent pad are sequentially overlapped; and a detection line and a control line are respectively provided on the reading area; The detection line is coated with binding molecule 1, which specifically binds to the first marker on the loop forward primer in the RT-LAMP reaction system; The control line is coated with a control antibody that specifically binds to binding molecule 2 in the binding pad; The conjugate pad is labeled with a colloidal gold-labeled binding molecule 2, which specifically binds to a second label on the internal forward primer of the RT-LAMP reaction; wherein the colloidal gold-labeled binding molecule 2 is dissolved in a treatment solution A and then labeled onto the conjugate pad, the treatment solution A containing a synthetic polymer 1, sugars, buffer solution, bovine serum albumin (BSA), and sodium dodecyl sulfate (SDS). The sample pad is obtained by immersing the sample pad base material in a treatment solution B and then drying it. The treatment solution B contains synthetic polymer 2, sugars, phosphate buffer (PB), BSA, preservatives, and surfactants; or the treatment solution B contains buffer, BSA, surfactants, preservatives, and NaCl.

[0027] In some preferred embodiments, the treatment solution B of the present invention comprises a buffer solution, BSA, a surfactant, a preservative, and NaCl.

[0028] In some embodiments, the binding molecule 1 described in this invention is an antibody.

[0029] In some specific embodiments, the first marker on the loop forward primer of the RT-LAMP reaction described in this invention is the TAMRA fluorescent group, and the binding molecule 1 is an anti-TAMRA antibody.

[0030] In some embodiments, the concentration of bound molecule 1 is approximately 1 mg / mL to 1.5 mg / mL. Preferably, the concentration of bound molecule 1 is approximately 1.2 mg / mL.

[0031] In some embodiments, the binding molecule 2 described in this invention is an antibody.

[0032] In some specific embodiments, the second marker on the internal forward primer of the RT-LAMP reaction of the present invention is biotin, and the binding molecule 2 is a mouse anti-biotin antibody.

[0033] In some embodiments, the concentration of bound molecule 2 is approximately 20-30 μg / mL. Preferably, the concentration of bound molecule 2 is approximately 25 μg / mL.

[0034] In some specific implementations, the quality control antibody described in this invention is a goat anti-mouse IgG antibody.

[0035] In some embodiments, the concentration of the quality control antibody is approximately 1 mg / mL to 1.5 mg / mL. Preferably, the concentration of the quality control antibody is approximately 1.2 mg / mL.

[0036] In some specific implementations, the amount of antibody coated on the detection line and the control line is approximately 1 μL / cm, and the antibody concentration is approximately 1.2 mg / ml.

[0037] In some embodiments, the synthetic polymer 1 of the present invention includes at least one of polyvinylpyrrolidone (PVP) and polyethylene glycol 8000 (PEG8000); And / or, the synthetic polymer 2 includes at least one of polyvinyl alcohol (PVA), polyvinylpyrrolidone (PVP), and polyethylene glycol 8000 (PEG8000); And / or, the sugars include at least one of sucrose and trehalose; And / or, the buffer solution includes at least one of Tris-HCl buffer, HEPE buffer, PB buffer, and phosphate buffer; And / or, the preservative includes at least one of NaN3 and Proclin 300; And / or, the surfactant includes at least one of Tween 20, Triton, and ethyl phenyl polyethylene glycol (NP-40).

[0038] In some embodiments, in processing solution A, the synthetic polymer 1 has a mass percentage of approximately 0.5%, the sugar has a mass percentage of approximately 2%, the buffer solution has a concentration of approximately 0.02 mM, the BSA has a volume percentage of approximately 0.2%, and the SDS has a mass percentage of approximately 0.04%. And / or, in treatment solution B, the synthetic polymer 2 has a mass percentage of approximately 2%, the sugar has a mass percentage of approximately 1%, the buffer solution has a concentration of approximately 0.1 M, the preservative has a volume percentage of approximately 0.03%, and the surfactant has a volume percentage of approximately 0.05%; or in treatment solution B, the buffer solution has a concentration of approximately 50 mM, the BSA has a volume percentage of approximately 2%, the surfactant has a volume percentage of approximately 0.5%, the preservative has a mass percentage of approximately 0.05%, and the NaCl has a mass percentage of approximately 1%.

[0039] In some specific embodiments, the treatment solution A of the present invention contains approximately 0.5% PVP by mass, approximately 2% sucrose by mass, approximately 0.02 mM Tris-HCl buffer, approximately 0.2% BSA by volume, and approximately 0.04% SDS by mass.

[0040] In some specific embodiments, the treatment solution B of the present invention contains approximately 50 mM phosphate buffer, approximately 2% BSA by volume, approximately 0.5% Tween 20 by volume, approximately 1% NaCl by mass, and approximately 0.05% NaN3 by mass.

[0041] In some specific embodiments, the treatment solution B of the present invention contains approximately 2% PVA by mass, approximately 1% trehalose by mass, approximately 0.1M phosphate buffer, approximately 0.03% Proclin 300 by volume, and approximately 0.05% Tween 20 by volume.

[0042] In some embodiments, the base material of the sample pad and conjugate pad of the immunochromatographic test strip of the present invention is glass fiber.

[0043] In some embodiments, the base material of the reading area of ​​the immunochromatographic test strip of the present invention is an NC membrane.

[0044] In some embodiments, the base material of the absorbent area of ​​the immunochromatographic test strip of the present invention is absorbent paper.

[0045] In some embodiments, the sample pad, conjugation pad, interpretation area, and absorbent pad of the immunochromatographic test strip of the present invention are sequentially overlapped on the surface of a PVC board.

[0046] In some embodiments, the present invention provides a kit for detecting PEDV, comprising the primer set described in the present invention, the RT-LAMP reaction system described in the present invention, and / or the immunochromatographic test strip described in the present invention; preferably, the kit further comprises a standard positive plasmid as a standard positive control, wherein the standard positive plasmid is a plasmid containing the PEDV N gene.

[0047] In some embodiments, the kit of the present invention further comprises an amplification product diluent, and optionally, a negative control, which is a nucleic acid extract from a negative sample.

[0048] In some embodiments, the amplification product diluent of the present invention comprises 10 mM-30 mM Tris-HCl at pH 7-9 and 0.01%-0.03% Proclin 300 by volume.

[0049] In some embodiments, the sequence of the PEDV N gene of the present invention is shown in SEQ ID NO: 1.

[0050] In some embodiments, the present invention provides the application of the primer set, the RT-LAMP reaction system, and / or the immunochromatographic test strip described herein in the preparation of a kit for detecting PEDV virus and / or porcine epidemic diarrhea.

[0051] In some implementations, the applications described in this invention include: S1. Using the nucleic acid of the sample to be tested as an amplification template, the product is obtained by amplification reaction using the primer set described in this invention or the RT-LAMP reaction system described in this invention. S2. Dilute the product from step S1 using a diluent; S3. Use the immunochromatographic test strip described in this invention to detect the diluted product obtained in step S2, and observe the results; The criteria for judging the result of step S3 are as follows: ① If two colored bands appear on the control line and the test line T, it indicates that the sample is PEDV positive; ② Negative: The presence of only one color band at the control line indicates that the sample is PEDV negative; ③ Invalid: If no colored band appears in the quality control area or the test line, or only a colored band appears in the test line, it indicates that the test strip is invalid.

[0052] In some embodiments, in step S2, the product from S1 is diluted using a diluent comprising: 10 mM-30 mM Tris-HCl at pH 7-9 and 0.01%-0.03% Proclin 300 by volume.

[0053] In some implementations, in step S2, the product is diluted by mixing it with the diluent at a ratio of 1:5.

[0054] In some implementations, the amplification conditions for step S1 are 60 ℃-65 ℃ for 20 min-30 min. Preferably, the amplification conditions are 62 ℃ for 30 min.

[0055] In some implementations, the detection time for step S3 is 5 min-10 min. Preferably, the detection time for step S3 is 8 min.

[0056] In this invention, those skilled in the art can understand that the numerical range referred to by "about" varies, and that the expected technical effect can be achieved within this range. The numerical range may be, for example, within the ranges of ±0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, etc.

[0057] The beneficial effects of the present invention include at least the following: The porcine epidemic diarrhea virus detection kit provided by this invention includes: RT-LAMP amplification reagent, immunochromatographic test strip, product diluent, positive control, and negative control. The test strip conjugation pad and sample pad have undergone special treatment to significantly improve specificity and sensitivity. This invention also provides a porcine epidemic diarrhea (PEDV) detection kit. This invention introduces labeling groups (e.g., Biotin and TAMRA fluorescent labels) in primer design and combines isothermal amplification technology and immunochromatography technology to achieve rapid detection of PEDV. It can achieve rapid one-step RNA amplification in just 20 min to 30 min.

[0058] This invention is simple to operate, requiring only three steps for detection: 1. RT-LAMP amplification of the sample; 2. Diluting the amplified product and placing it into a test strip for chromatography; 3. Visual interpretation of the results. These three steps are simple and quick, requiring only a constant temperature device and test strips for the entire detection process. It eliminates the need for expensive and complex instruments or demanding, time-consuming professional operations such as virus isolation and identification; making it ideal for resource-constrained pig farms, slaughterhouses, and grassroots laboratories. Attached Figure Description

[0059] Figure 1 The structure diagram of the pCE3-PEDV-N plasmid.

[0060] Figure 2 This is a diagram of the test strip assembly in Example 1.

[0061] Figure 3 The results are the primer screening results from Example 2.

[0062] Figure 4 The results of primer optimization in Example 3 are shown.

[0063] Figure 5 The results of enzyme optimization in Example 4 are shown.

[0064] Figure 6 The results (A) and (B) of the RT-LAMP-immunochromatographic test strip in Example 5 are shown.

[0065] Figure 7 The results of different treatments were obtained for the test strip binding pad in Example 6.

[0066] Figure 8 The results of different treatments were obtained for the sample pad of the test strip in Example 7.

[0067] Figure 9 The results are shown in Example 8: immunochromatography (A) and agarose gel electrophoresis (B).

[0068] Figure 10 This is the result of the sensitivity verification in Example 9.

[0069] Figure 11 Example 10 was used to specifically verify the detection results of different pathogens causing swine diarrhea. Detailed Implementation

[0070] To make the objectives, technical solutions, advantages, and effects of this invention clearer, the concept and technical effects of this invention will be clearly and completely described below in conjunction with embodiments. However, the described embodiments are only a part of the embodiments of this invention, and not all of them. Other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort, or those not specifically described, are all within the scope of protection of this invention.

[0071] Example 1: Preparation of Immunochromatographic Test Strips (1) Sample pad preparation Place the required sample pad base material (glass fiber) on the gold-laying tool. Apply the sample pad treatment solution at a rate of 45 mL per sheet of glass fiber, pouring the solution onto the glass fiber and spreading it evenly using the handle roller. Place the laid sample pad on a sieve and continue processing the next sample pad. Place the processed sample pads in an environment of 37℃ and relative humidity ≤30% to dry for 24 hours. After drying, collect the sample pads and store them in a dry environment (humidity ≤30%). (2) Preparation of the interpretation zone and the water absorption zone Peel off the paper covering the NC film on the base plate. Place the NC film face up flat on the PVC board; use a strip cutter to cut the absorbent paper into strips: 2.7 cm. 30cm; Tear off the oil paper at the adhesive end of the absorbent paper on the PVC board (be careful not to tear it incorrectly; the shorter end of the PVC board is the absorbent paper end: 2.55cm wide end), and peel off the yellow protective film of the NC membrane. Adhere the absorbent paper to the absorbent paper end, aligning the absorbent paper with the other edge of the PVC board, and press the edge of the NC membrane flat for about 1-2mm; Take a clean and suitable centrifuge tube, and use a pipette to draw the calculated volume of coating buffer (1% sucrose, 0.2M phosphate buffer (PB)) and the corresponding antibody volume (detection line T: 30ul = 10.6ul antibody + 19.4ul coating buffer, control line C: 30ul = 4.5ul antibody + 15.5ul coating buffer), add them to the same centrifuge tube, and gently mix by pipetting. Label them as detection line T (1.2mg / ml anti-TAMRA antibody) and control line C (1.2mg / ml goat anti-mouse IgG antibody) for identification. The prepared working solution should be a colorless and clear liquid upon self-test. Then, perform a membrane stretching operation at 1 μL / cm, and after stretching, place it in a dry environment at 37°C and relative humidity ≤30% for 24 hours; store it in a dry environment (humidity ≤30%). (3) Preparation of binding pad Take 2 mL of gold sol (purchased from Weidu Biotechnology) and add a certain amount of 0.2 M potassium carbonate solution. The volume (μL) of the 0.2 M potassium carbonate solution is 2. 12 mL, invert and mix thoroughly; calculate the volume of 50 μg of mouse anti-Biotin monoclonal antibody based on the concentration of mouse anti-Biotin monoclonal antibody (volume = mass / concentration), and add the calculated volume of mouse anti-Biotin monoclonal antibody to the above gold sol accordingly. Mix quickly and let stand on the table for 10 minutes, mixing every 5 minutes; after the reaction, add 3.6 mL of blocking buffer, mix quickly, and let stand on the table for 5 minutes; after the reaction, transfer the solution to a clean centrifuge tube and centrifuge at 10000 rpm / min for 10 minutes; after centrifugation, observe whether the supernatant is clean (clear or slightly reddish). If the supernatant is clean, aspirate the supernatant to collect the precipitate. If the supernatant is not clean, aspirate the supernatant to a clean centrifuge bottle and centrifuge again with the same parameters. Ensure that the gold sol is completely centrifuged (the supernatant is clear or slightly reddish); The precipitate was reconstituted with conjugation pad treatment solution, and the reconstituted volume was 1 mL. If large precipitates were formed during the reconstitution process, they could be dispersed by ultrasonic cleaning for 60 seconds. After reconstitution, the prepared solution should be a purplish-red colloid with no obvious large particle aggregation, and the concentration of the gold-labeled antibody should be 25 μg / mL.

[0072] According to 4 per sheet of glass fiber Gold plating is performed using a 5cm:1mL gold-labeled antibody solution. Place a sheet of glass fiber on the gold plating tool, shake the gold-labeled antibody solution well, pour it onto the glass fiber, and use the handle roller to spread the gold evenly. Carefully place the plating conjugate pad on a sieve. Conjugate pad drying: Place the sieve containing the conjugate pad in a drying room (temperature 37±3℃, relative humidity ≤30%) and dry for 24~48 hours.

[0073] (4) Assembly Use a strip cutter to cut the bonding pad to a width of 0.4 mm. 30cm; Remove the oil paper from the sample pad end of the base plate, attach the gold marking pad, parallel to the membrane edge and pressing it 1-2mm over the membrane edge; attach the sample pad to the sample pad end, aligning it with the edge of the PVC plate, parallel to the membrane edge and pressing the gold marking pad about 2-3mm over; after assembly, the chromatography strip is as follows Figure 2 .

[0074] Example 2 Primer screening for RT-LAMP system Sample preparation: Using the constructed pCE3-PEDV-N plasmid (construction map as shown in the image) Figure 1 As shown, RNase was used as a positive standard. Samples with a concentration (Log10(Copies / μL)) of 5 were prepared by gradient dilution with free water.

[0075] Each primer set was tested in triplicate to evaluate the optimal primer set for detection.

[0076] Reaction system 1 (total volume 25 μL): 10×LAMP Buffer: 2.5 μL; 250 mM magnesium sulfate: 1.3 μL; 10 mM dNTPs: 3.5 μL; 50 mM primer set 1 / 2 / 3 mixture (F3, B3, FIP, BIP, LF, LB): 0.1 μL, 0.1 μL, 1 μL, 1 μL, 0.2 μL, 0.2 μL respectively; 8 U / μL LBst DNA polymerase: 1 μL; template nucleic acid: 2 μL.

[0077]

[0078] Reaction conditions: 62 ℃, 30 min.

[0079] LAMP product processing: Dilute the product with diluent (0.02M Tris-HCl buffer and 0.3% Proclin 300) at a ratio of 1:5. Insert the sample pad end of the test strip into the diluted product for chromatography. Observe the detection results after 8 minutes of chromatography.

[0080] Test results: The results are as follows Figure 3 As shown, among all the validation and optimization experiments, primer set 1 had the best validation results, the best detection effect and was consistent with the kit effect; Example 3 Primer optimization for RT-LAMP system Sample preparation: Using the constructed pCE3-PEDV-N plasmid (construction map as shown in the image) Figure 1 As shown, RNase was used as a positive standard. Samples with a concentration (Log10(Copies / μL)) of 5 were prepared by gradient dilution with free water.

[0081] Perform the assay using the primer combinations described below to evaluate the optimal primer ratio for detection.

[0082] Reaction system (total volume 25 μL): 10×LAMP Buffer: 2.5 μL; 250 mM magnesium sulfate: 1.3 μL; dNTPs: 3.5 μL; 8 U / μL Bst DNA polymerase: 1 μL; template nucleic acid: 2 μL; 50 mM primers added in the following proportions. Optimized primer sets (F3, B3, FIP, BIP, LF, LB): 0.1 / 0.2 / 0.3 μL, 0.1 / 0.2 / 0.3 μL, 1 μL, 1 μL, 0.2 μL, 0.2 μL, respectively; The optimized inner primer sets (F3, B3, FIP, BIP, LF, LB) were 0.1 μL, 0.1 μL, 1 / 1.1 / 1.2 μL, 1 / 1.1 / 1.2 μL, 0.2 μL, and 0.2 μL, respectively. Optimized loop primer sets (F3, B3, FIP, BIP, LF, LB): 0.1 μL, 0.1 μL, 1 μL, 1 μL, 0.1 / 0.2 / 0.3 μL, and 0.1 / 0.2 / 0.3 μL, respectively; Reaction conditions: 62 ℃, 30 min.

[0083] LAMP product processing: Dilute the product with the diluent at a ratio of 1:5, insert the sample pad end of the test strip into the diluted product for chromatography, and observe the detection results after 8 minutes of chromatography.

[0084] Test results: The results are as follows Figure 4 As shown, among all validation and optimization experiments, primer set 1 had the best validation results. Primer mixtures (F3, B3, FIP, BIP, LF, LB): 0.1 μL, 0.1 μL, 1 μL, 1 μL, 0.2 μL, and 0.2 μL, respectively, had the best economic and detection effects and were consistent with the kit's performance.

[0085] Example 4: Optimization of Bst DNA Polymerase in RT-LAMP System Sample preparation: Using the constructed pCE3-PEDV-N gene plasmid (construction map as shown in the image) Figure 1 As shown, RNase was used as a positive standard. Samples with a concentration (Log10(Copies / μL)) of 5 were prepared by gradient dilution with free water.

[0086] Each primer set was tested in triplicate to evaluate the optimal primer set for detection.

[0087] Enzyme-optimized reaction system (total volume 25 μL): 10×LAMP Buffer: 2.5 μL; 250 mM magnesium sulfate: 1.3 μL; dNTPs: 3.5 μL; 50 mM primer set 1 (F3, B3, FIP, BIP, LF, LB): 0.1 μL, 0.1 μL, 1 μL, 1 μL, 0.2 μL, 0.2 μL respectively; template nucleic acid: 2 μL; 8 U / μL LBst DNA polymerase: 0.5 / 1 / 1.5 μL.

[0088] Reaction conditions: 62 ℃, 30 min.

[0089] LAMP product processing: Dilute the product with the diluent at a ratio of 1:5, insert the sample pad end of the test strip into the diluted product for chromatography, and observe the detection results after 8 minutes of chromatography.

[0090] Test results: The results are as follows Figure 5 As shown, in all validation and optimization experiments, the enzyme addition amount of 1 μL had the best economic effect and detection effect, and was consistent with the kit effect. Example 5: Comparison and Validation of RT-PCR and RT-LAMP Sample preparation: Clinically confirmed PEDV positive samples were used as test templates after nucleic acid extraction. The template concentration was 7.1 (Log10(Copies / μL)).

[0091] RT-PCR (total volume 25 μL, purchased from Novizan Biotechnology): 5×One Step U+Mix 4 μL, One Step U+Enzyme Mix 1 μL, Primer Forward 0.2 μL, Primer Reverse 0.2 μL, TaqMan Probe 0.2 μL, template RNA 2 μL.

[0092] RT-LAMP (total volume 25 μL): 10×LAMP Buffer: 2.5 μL; 250 mM magnesium sulfate: 1.3 μL; 10 mM dNTPs: 3.5 μL; 50 mM primers (F3, B3, FIP, BIP, LF, LB): 0.1 μL, 0.1 μL, 1 μL, 1 μL, 0.2 μL, 0.2 μL respectively; 8 U / μL LBst DNA polymerase: 1 μL; template nucleic acid: 2 μL.

[0093] Reaction conditions:

[0094] Primer set:

[0095] LAMP product processing: Dilute the product with the diluent at a ratio of 1:5, insert the sample pad end of the test strip into the diluted product for chromatography, and observe the detection results after 8 minutes of chromatography.

[0096] Test results: Comparison of test results ( Figure 6 The detection results of RT-LAMP and RT-PCR methods showed good consistency, verifying the reliability of the present invention.

[0097] Example 6: Optimization of the binding pad on the immunochromatographic test strip Sample preparation: Clinically confirmed PEDV positive samples were used as test templates after nucleic acid extraction. The template concentration was 7.1 (Log10(Copies / μL)).

[0098] Reaction system (total volume 25 μL): 10×LAMP Buffer: 2.5 μL; 250 mM magnesium sulfate: 1.3 μL; 10 mM dNTPs: 3.5 μL; 50 mM primer mixture (F3, B3, FIP, BIP, LF, LB): 0.1 μL, 0.1 μL, 1 μL, 1 μL, 0.2 μL, 0.2 μL respectively; 8 U / μL LBst DNA polymerase: 1 μL; template nucleic acid: 2 μL.

[0099] Test strip treatment: The conjugate pads should be treated using the following three methods and dried before use: Treatment group 1: 0.5% polyvinylpyrrolidone (PVP) (Merck KGaA), 2% sucrose, 0.02 mM Tris-HCl buffer, 0.2% BSA, and 0.04% sodium dodecyl sulfate (SDS) (Merck KGaA).

[0100] Treatment group 2: 0.02M phosphate buffer (PB), 2% sucrose (w / w), 1% BSA (v / v), 0.1% Tween 20 (v / v), and 0.5% NaCl (w / w).

[0101] Treatment group 3: Blank control (no treatment).

[0102] Reaction conditions: 62 ℃, 30 min.

[0103] LAMP product processing: Dilute the product with the diluent at a ratio of 1:5, insert the sample pad end of the test strip into the diluted product for chromatography, and observe the detection results after 8 minutes of chromatography.

[0104] Detection results: Immunochromatography: after 8 minutes; Chromatographic detection results ( Figure 7 The results showed that the sensitivity of treatment groups 1 and 2 was significantly improved compared to treatment group 3, manifested as stronger detection line signals or lower background. Among them, the test strip of treatment group 1 exhibited the best overall chromatographic performance.

[0105] Example 7: Optimization of Immunochromatographic Test Strip Sample Pad Sample preparation: Clinically confirmed PEDV positive samples were used as test templates after nucleic acid extraction. The template concentration was 7.1 (Log10(Copies / μL)).

[0106] Reaction system (total volume 25 μL): 10×LAMP Buffer: 2.5 μL; 250 mM magnesium sulfate: 1.3 μL; 10 mM dNTPs: 3.5 μL; 50 mM primer mixture (F3, B3, FIP, BIP, LF, LB): 0.1 μL, 0.1 μL, 1 μL, 1 μL, 0.2 μL, 0.2 μL respectively; 8 U / μL LBst DNA polymerase: 1 μL; template nucleic acid: 2 μL.

[0107] Test strips: The sample pads for the test strips are processed using three different methods and then dried before use.

[0108] Treatment group 1: 2% PVA (Merck KGaA), 1% trehalose, 0.1 MPB, 0.03% Proclin 300, and 0.05% Tween 20 by volume.

[0109] Treatment group 2: 50 mM PB, 2% BSA (volume percentage), 0.5% Tween 20 (volume percentage), 1% NaCl (mass percentage), and 0.05% NaN3 (Merck KGaA) (mass percentage).

[0110] Treatment group 3: Blank treatment sample pad; Reaction conditions: 62 ℃, 30 min.

[0111] LAMP product processing: Dilute the product with the diluent at a ratio of 1:5, insert the sample pad end of the test strip into the diluted product for chromatography, and observe the detection results after 8 minutes of chromatography.

[0112] Test results: Chromatographic performance analysis shows that ( Figure 8 Compared with the blank control group (treatment group 3), both treatment groups 1 and 2 effectively enhanced the detection signal and improved background clarity. Overall, the test strip in treatment group 2 exhibited the strongest detection signal and the best chromatographic effect.

[0113] Example 8: Comparison and verification between immunochromatography and agarose gel electrophoresis Sample preparation: Clinically confirmed PEDV positive samples were used as test templates after nucleic acid extraction. The template concentration was 7.1 (Log10(Copies / μL)).

[0114] Reaction system (total volume 25 μL): 10×LAMP Buffer: 2.5 μL; 250 mM magnesium sulfate: 1.3 μL; 10 mM dNTPs: 3.5 μL; 50 mM primer mixture (F3, B3, FIP, BIP, LF, LB): 0.1 μL, 0.1 μL, 1 μL, 1 μL, 0.2 μL, 0.2 μL respectively; 8 U / μL LBst DNA polymerase: 1 μL; template nucleic acid: 2 μL.

[0115] Reaction conditions: 62 ℃, 30 min.

[0116] LAMP product processing: Dilute the product with the diluent at a ratio of 1:5, insert the sample pad end of the test strip into the diluted product for chromatography, and observe the detection results after 8 minutes of chromatography.

[0117] Detection results: The amplification products were detected in parallel using immunochromatographic test strips and agarose gel electrophoresis, respectively. Results ( Figure 9 The results show that the detection results of the two methods are highly consistent, verifying the accuracy and effectiveness of the immunochromatographic detection method established in this invention.

[0118] Example 9: Reagent Kit Sensitivity Verification Sample preparation: Construct the pCE3-PEDV-N plasmid for the PEDV N gene (construction map as shown in the figure). Figure 1 As shown, RNase was used as a positive standard. Samples were prepared by gradient dilution with free water, with concentrations (Log10(Copies / μL)) of 2, 3, 4, 5 and 6, respectively.

[0119] Each concentration was measured in triplicate, and independent replicate tests were performed in three different batches to assess the repeatability and stability of the assay.

[0120] Reaction system (total volume 25 μL): 10×LAMP Buffer: 2.5 μL; 250 mM magnesium sulfate: 1.3 μL; 10 mM dNTPs: 3.5 μL; 50 mM primer mixture (F3, B3, FIP, BIP, LF, LB): 0.1 μL, 0.1 μL, 1 μL, 1 μL, 0.2 μL, 0.2 μL respectively; 8 U / μL LBst DNA polymerase: 1 μL; template nucleic acid: 2 μL.

[0121] Reaction conditions: 62 ℃, 30 min.

[0122] LAMP product processing: Dilute the product with the diluent at a ratio of 1:5, insert the sample pad end of the test strip into the diluted product for chromatography, and observe the detection results after 8 minutes of chromatography.

[0123] Test results: The results are as follows Figure 10 As shown, in all detection limit tests, the kit of the present invention can still stably detect target concentrations as low as 100 copies / μL (i.e., Log10(Copies / μL) = 2.00), with a detection rate of 100%. Based on this, the detection sensitivity of the test strip is determined to be 100 copies / μL.

[0124] Example 10 Reagent Specificity Validation Sample preparation: Nucleic acid extracted from clinical samples that are positive for PEDV, Lawsonia intracellularis, rotavirus, transmissible gastroenteritis virus (TGEV), Seneca virus, and porcine deltacoronavirus (PDCoV) is used as the sample. Reaction system (total volume 25 μL): 10×LAMP Buffer: 2.5 μL; 250 mM magnesium sulfate: 1.3 μL; 10 mM dNTPs: 3.5 μL; 50 mM primer mixture (F3, B3, FIP, BIP, LF, LB): 0.1 μL, 0.1 μL, 1 μL, 1 μL, 0.2 μL, 0.2 μL respectively; 8 U / μL LBst DNA polymerase: 1 μL; template nucleic acid: 2 μL.

[0125] Reaction conditions: 62 ℃, 30 min.

[0126] LAMP product processing: Dilute the product with the diluent at a ratio of 1:5, insert the sample pad end of the test strip into the diluted product for chromatography, and observe the detection results after 8 minutes of chromatography.

[0127] Test results: Cross-reactivity of this kit was evaluated. (For example...) Figure 11 As shown, the test results were negative in reactions with Lawsonia intracellularis, rotavirus, TGEV, Seneca virus, and PDCoV, indicating that the kit has high specificity and can effectively distinguish PEDV from other common pathogens.

[0128] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes and improvements can be made without departing from the spirit of the present invention. Furthermore, the embodiments and features thereof can be combined with each other unless otherwise specified. All of the above fall within the protection scope of the present invention.

[0129] sequence list

Claims

1. A primer set for RT-LAMP detection of PEDV, comprising an outer primer pair, an inner primer pair, and a loop primer pair, wherein the outer primer pair includes an outer forward primer and an outer reverse primer, the inner primer pair includes an inner forward primer and an inner reverse primer, and the loop primer pair includes a loop forward primer and a loop reverse primer, characterized in that, The sequence is as follows: External forward primer: ACAGCGGCAAAAATACACCT; External reverse primer: AACTGGCGATCTGAGCATAG; Internal forward primer: CGCCCTTGGGAATTCTCCTCCGGCCACTTCGAAGGAACG; Internal reverse primers: GCAGCTTGCTTCGGACCCAGCCTGACGCATCAACACCTT; Forward loop primer: ACTCTGGGATGTCTTTGAGGTCA; Reverse loop primer: AAACTTTGGAGATGCGGAATTTGTC.

2. An RT-LAMP reaction system for detecting PEDV, characterized in that, The primer set includes the primer set according to claim 1, preferably, the 5' end of the loop forward primer is marked with a first marker, and the 5' end of the inner forward primer is marked with a second marker; the first marker and the second marker are different.

3. The RT-LAMP reaction system according to claim 2, characterized in that, The reaction system also includes 10×LAMP Buffer, magnesium sulfate, dNTPs, DNA polymerase, and the nucleic acid sample to be tested.

4. The RT-LAMP reaction system according to claim 3, characterized in that, The volume of 10×LAMP Buffer is approximately 2.5 μL; And / or, the magnesium sulfate concentration is 10 mM-13 mM; And / or, the dNTP concentration is 1 mM-1.4 mM; And / or, the concentrations of the external forward primer and the external reverse primer are 0.2 mM-0.6 mM, respectively; And / or, the concentrations of the internal forward primer and the internal reverse primer are 2 mM-4 mM, respectively; And / or, the concentrations of the loop primers are 0.2 mM–0.6 mM; And / or, the amount of DNA polymerase added is 4 U. 16 U.

5. An immunochromatographic test strip for detecting PEDV, characterized in that, The immunochromatographic test strip comprises a sample pad, an interpretation area, a conjugate pad, and an absorbent pad; wherein the sample pad, conjugate pad, interpretation area, and absorbent pad are arranged in an overlapping manner; a test line and a control line are respectively provided on the interpretation area; The detection line is coated with binding molecule 1, which specifically binds to the first marker on the loop forward primer in the RT-LAMP reaction system; The control line is coated with a control antibody that specifically binds to binding molecule 2 in the binding pad; The conjugate pad is labeled with a colloidal gold-labeled binding molecule 2, which specifically binds to a second label on the internal forward primer of the RT-LAMP reaction; wherein the colloidal gold-labeled binding molecule 2 is dissolved in a treatment solution A and then labeled onto the conjugate pad, the treatment solution A containing a synthetic polymer 1, sugars, buffer solution, bovine serum albumin (BSA), and sodium dodecyl sulfate (SDS). The sample pad is obtained by immersing the sample pad base material in a treatment solution B and then drying it. The treatment solution B contains synthetic polymer 2, sugars, phosphate buffer (PB), BSA, preservatives, and surfactants; or the treatment solution B contains buffer, BSA, surfactants, preservatives, and NaCl.

6. The immunochromatographic test strip according to claim 5, characterized in that, The synthetic polymer 1 includes at least one of polyvinylpyrrolidone (PVP) and polyethylene glycol 8000 (PEG8000); And / or, the synthetic polymer 2 includes at least one of polyvinyl alcohol (PVA), PVP, and PEG8000; And / or, the sugars include at least one of sucrose and trehalose; And / or, the buffer solution includes at least one of Tris-HCl buffer, HEPE buffer, PB buffer, and phosphate buffer; And / or, the preservative includes at least one of NaN3 and Proclin 300; And / or, the surfactant includes at least one of Tween 20, Triton, and NP-40.

7. The immunochromatographic test strip according to claim 5 or 6, characterized in that, In processing solution A, the mass percentage of the synthetic polymer 1 is approximately 0.5%, the mass percentage of the sugar is approximately 2%, the concentration of the buffer solution is approximately 0.02 mM, the volume percentage of BSA is approximately 0.2%, and the mass percentage of SDS is approximately 0.04%. And / or, in treatment solution B, the synthetic polymer 2 has a mass percentage of approximately 2%, the sugar has a mass percentage of approximately 1%, the buffer solution has a concentration of approximately 0.1 M, the preservative has a volume percentage of approximately 0.03%, and the surfactant has a volume percentage of approximately 0.05%; or in treatment solution B, the buffer solution has a concentration of approximately 50 mM, the BSA has a volume percentage of approximately 2%, the surfactant has a volume percentage of approximately 0.5%, the preservative has a mass percentage of approximately 0.05%, and the NaCl has a mass percentage of approximately 1%.

8. A kit for detecting PEDV, characterized in that, The kit comprises the primer set according to claim 1, the RT-LAMP reaction system according to any one of claims 2-4, and / or the immunochromatographic test strip according to any one of claims 5-7; preferably, the kit further comprises a standard positive plasmid as a standard positive control, wherein the standard positive plasmid is a plasmid containing the porcine epidemic diarrhea virus (PEDV) N gene.

9. The use of the primer set according to claim 1, the RT-LAMP reaction system according to any one of claims 2-4, and / or the immunochromatographic test strip according to any one of claims 5-7 in the preparation of a kit for detecting PEDV virus and / or porcine epidemic diarrhea.

10. The application according to claim 9, characterized in that, include: S1. Using the nucleic acid of the sample to be tested as an amplification template, the product is obtained by amplification reaction using the primer set according to claim 1 or the RT-LAMP reaction system according to any one of claims 2-4. S2. Dilute the product from step S1 using a diluent; S3. Use the immunochromatographic test strip according to any one of claims 5-7 to detect the diluted product obtained in step S2, and observe the results; The criteria for judging the result of step S3 are as follows: ① Positive: The presence of two colored bands on the control line and the test line T indicates that the sample is PEDV positive; ② Negative: The presence of only one color band at the control line indicates that the sample is PEDV negative; ③ Invalid: If no colored band appears in the quality control area or the test line, or only a colored band appears in the test line, it indicates that the test strip is invalid.

Images