Artemisia argyi endophytic diplohyta mediterranean strain AY7B and application thereof in weed control

Abstract

The invention discloses a folium artemisiae argyi endophytic diplodia mediterranean strain AY7B and application thereof in weed control, and belongs to the field of microorganisms. The strain is separated from healthy and disease-free folium artemisiae argyi, is preserved in the China General Microbiological Culture Collection Center (CGMCC) on November 11, 2024, has the preservation number of CGMCC NO.41594, and is classified and named as bicognia mediterranean. The strain is named as bicognia mediterranean, and the strain is named as bicognia mediterranean. Two herbicidal active substances, namely fermentation liquor and solid fermentation extract, prepared by taking the strain as a core have inhibition effects on seed germination and seedling growth of common weeds such as digitaria sanguinalis and amaranthus viridis, and the inhibition rates on roots and buds of amaranthus viridis respectively reach 91.0% and 94.6%. The application provides a landing scheme for the development of a novel microbial herbicide, and has both environmental safety and industrialization potential.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microorganisms, and particularly relates to a strain of Endophragma mediterraneum AY7B and application thereof in weed control. BACKGROUND

[0002] As a large agricultural country, China has a large number of weeds in farmland, which are harmful. More than 1400 weed species have been found, of which more than 130 species can pose a significant threat to agricultural production (including 37 species of malignant weeds and 96 species of regional malignant weeds). These weeds compete with crops for light, nutrients and water, becoming one of the key bottlenecks restricting high yield and high quality of agriculture.

[0003] For a long time, chemical herbicides have become the mainstream means of weed control due to their high efficiency and convenience, significantly reducing the labor intensity of manual weeding. However, long-term and widespread use of chemical herbicides has led to multiple serious problems: first, it causes soil and water pollution; second, it induces poisoning incidents in humans and animals; and third, it leads to rapid evolution of weed resistance. Currently, many weeds have developed resistance to commonly used herbicides, forcing farmers to continuously increase the amount and frequency of pesticide use, forming a vicious cycle of "increasing pesticide use - increasing resistance - decreasing pesticide efficacy". Under this background, the development of new herbicides that are safe, efficient and environmentally friendly has become an urgent need for sustainable agricultural development.

[0004] Microbial herbicides, as a core component of biological pesticides, use microorganisms or their metabolites as active ingredients, and have become a key development direction for global green weed control due to their unique advantages. The core characteristics of microbial herbicides are as follows: first, they have abundant resources and multiple action mechanisms, and can inhibit weed growth through multiple ways such as infection and production of active metabolites, effectively delaying the development of weed resistance; second, they have strong specificity and are safe to non-target organisms such as crops, which can avoid disrupting the ecological balance of farmland; third, they are environmentally friendly, have no chemical residues and degrade quickly, which is in line with the policy direction of pesticide reduction and efficiency increase. Currently, international research has successfully developed fungal herbicide preparations such as Devine, Collego, and Lubao No. 1, as well as herbicide products based on microbial metabolites such as Harpin protein and Herbicidin derivatives, which have verified the application potential of microorganisms in weed control.

[0005] In the development of microbial herbicides, fungi have attracted much attention due to their rich metabolites and easy scale-up cultivation. Fungi of multiple genera have been confirmed to have herbicidal activity. However, current research on fungi of the genus Endophragma (E. sp.) mainly focuses on their anti-pathogenic fungal activity and production of pharmaceutically active metabolites. For example, some strains of this genus can produce secondary metabolites with antibacterial activity, but there are few public documents or patents reporting their application in weed control. Biscogniauxia ​

[0006] Therefore, exploring the herbicidal function of fungi in the genus *Carex* has significant theoretical and practical implications: on the one hand, it can expand the strain resource library of microbial herbicides, providing new ideas for solving problems such as the excessive specificity of existing fungal herbicides and their poor control effect on some weeds; on the other hand, the development and application of their metabolites can provide high-quality precursors for the research and development of new microbial herbicides, which plays an important supporting role in promoting the development of green weed control technology and alleviating the ecological crisis caused by chemical herbicides. Summary of the Invention

[0007] The main objective of this invention is to discover and provide a strain AY7B of the endophytic Mediterranean diatomaceous fungus *Artemisia argyi* and its application in weed control. The herbicidal active substances derived from this strain are suitable for various applications such as field spraying and seed treatment, facilitating industrialization and promotion. This technical solution forms a complete technology chain of "strain-active substance-formulation" by clarifying the characteristics of the strain, standardizing the preparation process, and refining the application methods, providing a feasible solution for the development of novel microbial herbicides.

[0008] The technical solution of this invention is as follows: This invention discloses an endophytic fungal strain of Artemisia argyi with excellent herbicidal activity and its related applications; the core strain is a strain of Artemisia argyi endophytic Mediterranean diatomaceous fungus strain AY7B, which was isolated from healthy, disease-free Artemisia argyi leaves harvested from the farm of Nanyang Normal University. This strain was deposited on November 11, 2024, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC NO.41594, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; and classified as *Diatomaceous Mediterranean diatomaceous fungus* (AY7B). Biscogniauxia mediterranea AY7B, belongs to the genus *Carya*. Biscogniauxia sp.) fungi.

[0009] Furthermore, the ITS sequence of strain AY7B is shown in SEQ ID NO.5, and the β-tubulin gene sequence is shown in SEQ ID NO.6.

[0010] This application claims protection for a herbicidal active substance derived from strain AY7B, which has the strain's metabolites as its core active ingredients and specifically includes two forms: one is the liquid fermentation broth of strain AY7B, and the other is an extract of the solid fermentation product of strain AY7B. Both forms have significant weed-suppressing activity.

[0011] Based on the above two forms of active substances, this invention provides a corresponding standardized preparation process, wherein the preparation process of the fermentation broth of the strain is as follows: The activated strain AY7B was inoculated into PDB liquid medium and cultured with shaking at 25℃ and 150 r / min for 12-15 days. The fermentation broth was obtained by filtration. The preparation process of the solid-state fermentation extract of the strain is as follows: S1. The activated strain AY7B was inoculated into PDB liquid medium for fermentation culture; S2. Inoculate the seed liquid into rice solid culture medium at the preset inoculation amount and perform static fermentation in a constant temperature incubator; S3. After air-drying and pulverizing the fermentation product, extract it and concentrate the extract to obtain the solid fermentation product extract.

[0012] Further, in step S1, the fermentation culture conditions are: shaking culture at 25℃ and 150 r / min for 4-6 days to obtain seed liquid; in step S2, the rice solid culture medium is prepared by: taking 80 g of rice, adding 120 mL of water to soak overnight, then sterilizing by high-pressure steam at 121℃ for 20 min, and cooling to room temperature; the inoculation amount of seed liquid is 4-7 mL / bottle, and the static fermentation temperature in the rice solid culture medium is 25-28℃ for 35-45 days; in step S3, the extract is a 1:1 volume ratio of dichloromethane / methanol mixed solvent, and is extracted 3-5 times.

[0013] The above-mentioned herbicidal active substances can effectively inhibit the growth of many common farmland weeds. Specific application schemes are as follows: The active substance has an inhibitory effect on both grassy and broadleaf weeds, with the core applicable weed including crabgrass (Digitaria sanguinalis). Digitaria sanguinalis (L.) Scop.), wild amaranth ( Amaranthus viridis L.), barnyard grass ( Echinochloa crusgalli (L.) Beauv.), purslane ( Portulaca oleracea At least one of L.).

[0014] Furthermore, the active substances can target two key stages of weed growth: 1) Inhibition of weed seed germination: The fermentation broth is applied directly to weed seeds, and the solid fermentation extract is diluted to a concentration of 1500~2000 μg / mL before being applied to weed seeds; 2) Inhibition of weed seedling growth: The fermentation liquid or the solid fermentation extract with a concentration of 4000~6000 μg / mL after dilution is directly sprayed onto the leaves of weed seedlings that have grown two true leaves.

[0015] To enable large-scale application, this application also claims protection for a weed control agent, wherein the control agent uses strain AY7B itself or the aforementioned herbicidal active substances (fermentation broth / solid extract) as the core active ingredient.

[0016] Furthermore, the control agent also includes agriculturally acceptable excipients, which are at least one of solvents, stabilizers, and dispersants, which can improve the stability and efficacy of the formulation. The control agent can be formulated into liquid (such as soluble concentrate or suspension concentrate) or solid powder according to the application scenario, and is suitable for various application methods such as field spraying and seed treatment, which facilitates industrialization and promotion.

[0017] The beneficial effects of this invention are: 1. The Mediterranean double-seat discocrinophyte provided in this application ( Biscogniauxia mediterranea The strain AY7B was discovered and confirmed to have excellent herbicidal activity. In the existing technology, the research on fungi of the genus Anthracnose has focused on antibacterial and medicinal metabolite production, and its herbicidal potential has not been well explored. The development and application of this strain fills the application gap of Anthracnose in the field of weed control, provides a new high-quality resource for the screening of strains of microbial herbicides, and enriches the microbial resource reserve for green control of weeds. 2. The metabolites (fermentation broth and solid fermentation extract) of strain AY7B exhibit inhibitory effects on various common weeds, especially against weeds such as crabgrass and wild amaranth, which are prominent pests in agricultural production. During seed germination, the fermentation broth showed inhibition rates of 91.0% and 94.6% on the roots and shoots of wild amaranth, respectively, and 90.8% on the roots of crabgrass. During seedling growth, 5000 μg / mL of the solid fermentation extract reduced the fresh weight of wild amaranth and crabgrass by 36.0% and 19.0%, respectively, as determined by IC50. 50 Value verification confirmed that the solid fermentation extract has stable activity and a clear dose-effect relationship, providing data support for precise prevention and control. 3. Unlike single-target chemical herbicides and some highly specific microbial herbicides, strain AY7B achieves weed control through a dual mechanism: on the one hand, its metabolites can induce physiological damage in weed leaves, such as dry spots and scorched leaf margins, disrupting the normal physiological functions of the plant; on the other hand, it can significantly inhibit the growth of weed seeds, roots, and shoots, as well as the accumulation of seedling biomass, providing full-process control from germination to seedling stage. This multi-mechanism of action can effectively prevent weeds from developing resistance due to mutations at a single target, breaking the vicious cycle of "application-resistance-increased application" and extending the lifespan of the herbicide. 4. As an endophytic fungus of Artemisia argyi, strain AY7B's metabolites are derived from natural microbial synthesis and have the characteristics of no chemical residues and rapid degradation. Compared with chemical herbicides, it can significantly reduce the risk of soil pollution, water pollution and pesticide residues in agricultural products. In addition, it shows excellent safety to common crops such as corn and wheat, which lays a solid safety foundation for the large-scale field application of the strain's metabolites. 5. Strain AY7B can be efficiently cultured in conventional media such as PDB liquid medium and rice solid medium. The culture conditions are 25℃, 150 r / min shaking culture or isothermal static culture. It does not require complicated equipment or harsh culture parameters, resulting in low production costs and easy large-scale production. The preparation process of its fermentation products and extracts is mature (extraction, rotary evaporation concentration, etc.), and it can be easily developed into various formulations such as liquid inoculants and solid powders to suit different agricultural production scenarios. The industrialization transformation is easy and has broad prospects. 6. The herbicidal active substances of strain AY7B can be applied directly through fermentation broth or by preparing extracts through solid-state fermentation. Both methods can achieve good herbicidal effects, and the appropriate method can be chosen flexibly according to actual production needs (such as control scale, transportation conditions, and usage habits). Attached Figure Description

[0018] Figure 1 The images show the colony morphology of the endophytic fungus AY7B on agar plates. The left image shows the colony morphology on the front of the plate, and the right image shows the colony morphology on the back of the plate. Figure 2 This is a diagram showing the homology sequence alignment analysis of the endophytic fungus AY7B based on the ITS sequence. Figure 3 This is a diagram showing the homology sequence alignment analysis of the endophytic fungus AY7B based on the β-tubulin gene sequence. Figure 4 Comparative graph showing the inhibitory effect of endophytic fungus AY7B fermentation broth on the germination of four weed seeds; Figure 5 Comparison of concentration-dependent inhibitory effects of different concentrations of endophytic fungal AY7B solid fermentation extract on the germination of four weed seeds; Figure 6 Comparative graph showing the herbicidal efficacy of fermentation broth of endophytic fungus AY7B and 5000 μg / mL solid fermentation extract against potted seedlings of crabgrass and wild amaranth; Figure 7 This is a comparative graph showing the safety test results of solid fermentation extracts of endophytic fungus AY7B at different concentrations (1000 μg / mL, 2000 μg / mL and 5000 μg / mL) on potted wheat and maize seedlings. Detailed Implementation

[0019] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Any modifications and substitutions made to the methods, steps, or conditions of the present invention without departing from the essence of the invention are within the scope of the present invention.

[0020] Test samples and culture media

[0021] The endophytic fungus AY7B provided in this application was isolated from healthy, disease-free Artemisia argyi leaves collected in May 2024 at the farm of Nanyang Normal University in Nanyang City, Henan Province. It was obtained through rigorous disinfection and purification. This fungus belongs to the Mediterranean genus *Dicotyle* and is named as follows: Biscogniauxia mediterranea AY7B.

[0022] PDB liquid culture medium: Peel potatoes, cut 200 g into small pieces, add water and boil for 30 min, filter with 4 layers of gauze, add 20 g glucose, distilled water to a final volume of 1000 mL, boil and mix well, dispense, and sterilize at 121℃ for 20 min to obtain PDB liquid culture medium.

[0023] PDA solid medium: Peel potatoes, cut 200 g into small pieces, add water and boil for 30 min, filter with 4 layers of gauze, add 20 g glucose and 18 g agar, distilled water to a final volume of 1000 mL, boil and mix well, dispense, and sterilize at 121℃ for 20 min to obtain PDA solid medium.

[0024] 1. Strains screened and their physiological and biochemical characteristics studied

[0025] 1.1 Isolation and Screening of Strain AY7B

[0026] Select healthy, disease-free mugwort leaves and thoroughly rinse off any surface dirt and sand with running water. Then, transfer them to a clean bench and sterilize the samples under aseptic conditions using the following steps: First, soak the mugwort leaves in a 75% alcohol solution for 30-60 minutes. Immediately rinse once with sterile water; then immerse in 5% sodium hypochlorite solution for 3-5 minutes, and rinse three times with sterile water. To verify the disinfection effect, spread the last sterile rinse solution evenly on PDA solid culture medium as a blank control. If no bacteria grow on the control culture medium, the disinfection is confirmed to be thorough. If bacteria grow, it indicates that the surface disinfection is incomplete and residual bacteria remain in the rinse solution. In this case, the batch of Artemisia argyi samples should be discarded, and healthy Artemisia argyi of the same standard should be selected again. The entire disinfection process should be repeated starting from the rinsing step with running water, and the disinfection parameters can be optimized appropriately, such as extending the soaking time of 75% alcohol, extending the soaking time of 5% sodium hypochlorite, or increasing the number of sterile water rinses. After disinfection, the last rinse solution should still be used as a blank control until no bacteria grow on the culture medium. Ensure that the disinfection is qualified before proceeding with subsequent tissue cutting and inoculation operations to avoid surface bacteria interfering with the isolation purity of endophytic fungi.

[0027] After disinfection, use sterile scissors to cut the mugwort leaves into pieces approximately 0.5 cm in size. 2Small pieces of plant tissue were inoculated onto PDA solid medium plates supplemented with streptomycin sulfate (to inhibit bacterial contamination), with three pieces of plant tissue evenly inoculated onto each plate. The inoculated plates were then placed under suitable conditions for incubation, and the colony growth was observed periodically. Once clearly morphologically distinct fungal colonies appeared at the cut surfaces of the plant tissue, single colonies of different morphologies were immediately picked and transferred to new PDA solid medium plates for purification. This purification process was repeated until a homogeneous, contaminated pure strain was obtained. The purified strain was then stored on PDA solid medium for later use. After preliminary screening tests, strain AY7B was selected for further identification.

[0028] 1.2 Morphological and physiological-biochemical characteristics analysis of strain AY7B

[0029] Strain strain AY7B was inoculated onto PDA solid medium and incubated at 28°C for colony morphology observation. The results showed that strain AY7B grew well on PDA solid medium; initially, the colonies were white, but after 7 days of growth, brown patches appeared on the hyphae (see [link to PDA solid medium]). Figure 1 ).

[0030] 1.3 Molecular biological identification

[0031] Genomic DNA was extracted from strain AY7B using the CTAB method; the target gene fragments were amplified by PCR using the following primers: ITS region: primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO.1) and ITS4 (5'-TCCTCCGCTTATTGATATGC-3', SEQ ID NO.2); Microtubule gene (β-tubulin): primers Bt2a (5'-GGTAACCAAATCGGTGCTGCTTTC-3', SEQ ID NO.3) and Bt2b (5'-ACCCTCAGTGTAGTGACCCTTGGC-3', SEQ ID NO.4).

[0032] The PCR amplification products were sequenced by Sangon Biotech (Shanghai) Co., Ltd. The final ITS sequence and β-tubulin gene sequence are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0033] The sequence of SEQ ID No. 5 is as follows:

[0034] GGGCTGCGGGTATACAACTCCAAACCCCTGTGACTTACCTATGTTGCCTCGGCAGGTCGTGGCGTGTAGCGTGGTCCCTCGCGGGATCGCTGCCTCGCGCCACGCCAAAAGGCCTGTCAAAGGACCCCTAAAATCTGTTTTATTACTGCATCTCTGAGTTTATTATACAAACGAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTGATAGTATTCTGTCAGGCATGCCTGTTCGAGCGTCATTTCAACCCCCAAGCCCTATTTGCTTGACGTTGGGAGTTTACGGAGACGTAATTCCTCAAATATAGTGGCGGAGCTAGGTCGTGCTCTAAGCGTAGTAACCACACTCTCGCTTCTGCAGCCGGCCTAGGTCTTGCCGTAAAACCCCCAATATTTTTTTTTTACTGGTGACCTCGATCAGTAGATGCCAA

[0035] The sequence of SEQ ID No.6 is as follows:

[0036] TTTGCCTTCTAGGGGGGGGAAGACTCGGCGGTAACCAGCTACTAGATGGTTCGATAAGTCTTTCGCCCCCATGCGCAGATTTGACGATCGATTTGCACGTCAGAACCGCTGCGAGCCTCCACCAGAGTTTCCTCTGGCTTCACCCTATCCACGCATAGTTCACCATCTTTCGGGTCCGAACAGTTATGCTCTTACTCAAATCCATCCGAAGACATCAGGATCGGTCGATGATGCACCCCCGAAGGGGCTCTCACCTCCGTTCACTTTCATTACGCGTGAGGGTTTGACACCCAAACACTCGCACAAATGTTCGACTCCTTGGTCCGTGTTTCAAGACGGGTCGTTGACGACCATTACGCCAGCATCCTTGCAAAAAGCGCGGTCCTCGGCCCCTGTAAGGGTATTATGCAGAGGGCTATAACACTCCCGAAGGAGCTACTTTCCCACTGCTTTTATCCCCCTACGGGGGCCGATGCTGGCCTAAACCTGGCGGAGTGCACTGGTGAGAACACCAGATGATCCGCCAGGAAAAGGTCTGGCCGTAAACGCTTCCCTTTCAACAATTTCACGTGCTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGAAATTTACCTCCCATTTAGAGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGCTTTACAGAGGCTTGGTGTCCAACCGTACGGGGCTCTCACCCTCTAAGGCGTCCCGTTCCAGGGAACTCGGAAGGCACCGCGCCAAAAGCATCCTCTGCAAATTACAACTCGGACCCGAAGGCCAGATTTCAAATTTGAGCTGTTGCCGCTTCACTCGCCGTTACTAGGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGTATTTCCGCCGGGGGGAAAAAAAA

[0037] Sequenced sequences SEQ ID NO.5 (ITS sequence) and SEQ ID NO.6 (β-tubulin gene sequence) were submitted to the NCBI database and homology sequence alignment was performed using the BLAST tool. The results showed that the ITS sequence is related to the genus *Carabacterium* (…). Biscogniauxia The highest homology was found in strains of sp. Figure 2 ), β-tubulin gene sequence and Mediterranean two-spotted cladoceran species ( Biscogniauxia mediterranea The homology of the strains reached 99.01%. Figure 3 Based on a comprehensive assessment of the colony morphology characteristics of this strain on PDA medium (such as colony color, texture, and growth rate), strain AY7B was ultimately identified as *Discocephalus mesenteroides*. Biscogniauxia mediterranea ).

[0038] 1.4 Preservation information of strain AY7B

[0039] Strain AY7B was deposited on November 11, 2024, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC NO.41594. The strain is classified as *Discocephalus thaliana*. Biscogniauxia mediterranea AY7B.

[0040] 2. Verification of the weed-control effect of Mediterranean double-seat platycodon AY7B

[0041] 2.1. Mediterranean Gloydiomycium ( Biscogniauxia mediterranea Determination of the inhibitory activity of AY7B fermentation broth on weed seed germination

[0042] The strain AY7B was inoculated into PDB liquid medium and cultured with shaking at 25℃ and 150 r / min for 14 days. The fermentation broth was then filtered through a 0.22 μm sterile filter membrane for sterilization before use.

[0043] Two layers of circular filter paper were placed in a petri dish and sterilized by autoclaving at 121℃ for 20 min. Plump and uniform target weed seeds (Digitaria sanguinalis) were selected. Digitaria sanguinalis (L.) Scop., barnyard grass Echinochloa crusgalli (L.) Beauv., wild amaranth Amaranthus viridis L., Purslane Portulaca oleraceaL.), disinfected by soaking in 5% sodium hypochlorite solution for 10 min, followed by rinsing with sterile water 3-5 times until no residue remains; add 2.5 mL of AY7B fermentation broth to each petri dish, and use sterile tweezers to pick up weed seeds and evenly place them on filter paper, 30 seeds per dish; each treatment group was set up with 3 biological replicates, with the group with an equal volume of sterile water added as a blank control (also set up with 3 replicates). The petri dishes were placed in a light incubator, and the culture conditions were set as 25℃, 12 h light (6000 lx) / 12 h dark photocycle. After 7 days of culture, the root length and shoot length of the seeds in each treatment group and the control group were measured. The root length inhibition rate and shoot length inhibition rate were calculated according to the following formula: Inhibition rate (%) = [root (bud) length of control group − root (bud) length of treatment group] / root (bud) length of control group × 100%.

[0044] The fermentation broth of strain AY7B showed good inhibitory activity against the seed germination of the four tested weeds (barnyard grass, wild amaranth, and purslane) (see [link to original text]). Figure 4 Among them, it showed the best inhibitory effect on broadleaf weed Amaranth, with root length inhibition rate and shoot length inhibition rate of 91.0% and 94.6%, respectively; at the same time, it showed a strong inhibitory effect on root growth of grass weed Crataegus pinnatifida, with an inhibition rate of 90.8%. For specific inhibition data, please refer to Table 1.

[0045] Table 1. Inhibitory effects of fermentation broth from strain AY7B on root and shoot length of different weed seeds.

[0046]

[0047] 2.2, Mediterranean two-seat placoid ( Biscogniauxia mediterranea Preparation and herbicidal activity determination of AY7B solid fermentation extract

[0048] Strain strain AY7B was inoculated into PDB liquid medium and cultured with shaking at 25℃ and 150 r / min for 5 days to prepare seed culture.

[0049] Take 80 g of rice and place it in a fermentation container. Add 120 mL of deionized water and soak overnight. Then, autoclave at 121℃ for 20 min and cool to room temperature to obtain the rice solid fermentation medium. Inoculate the sterilized medium with seed liquid at a rate of 5 mL / bottle, mix well, and place in a 25℃ constant temperature incubator for static fermentation for 40 days.

[0050] After fermentation, the fermentation product was removed and air-dried in a cool, ventilated place until constant weight. Then, it was pulverized and passed through a 40-mesh sieve. The pulverized fermentation product powder was extracted three times at room temperature using a dichloromethane / methanol (volume ratio 1:1) mixture as the extraction solvent, each time for 24 hours. The three extracts were combined and concentrated to dryness using a rotary evaporator (45℃, reduced pressure) to obtain AY7B solid fermentation extract. The extract was sealed and stored at 4℃ for later use.

[0051] The above extract was dissolved in 0.5% dimethyl sulfoxide (DMSO) and then diluted with sterile water to prepare a series of sample solutions with final extract concentrations of 125 μg / mL, 250 μg / mL, 500 μg / mL, 1000 μg / mL, and 2000 μg / mL. Following the seed germination inhibition test method in step 2.1, barnyard grass, wild amaranth, millet, and purslane were used as test weeds to determine the herbicidal activity of the extract. After 7 days of cultivation, seed root length and shoot length were measured, the inhibition rate was calculated, and the concentration-inhibition rate curve was fitted using SPSS software to calculate the half-maximal inhibitory concentration (IC50). 50 value).

[0052] AY7B solid fermentation extract showed significant concentration-dependent inhibitory activity against seed germination of both Digitaria sanguinalis and Amaranthus fragrans. Figure 5 (See Table 2). The inhibitory effect increased with increasing extract concentration, reaching its peak at 2000 μg / mL. Among the extracts, the inhibitory activity against the root growth of *Digitaria sanguinalis* was the most prominent, with an IC50 value of [missing value]. 50 The value was 508.14 μg / mL, and the IC50 value for its bud growth was... 50 The value was 736.67 μg / mL; the IC50 value for the growth of roots and shoots of Amaranthus chinensis was... 50 The values ​​were 663.86 μg / mL and 718.81 μg / mL, respectively.

[0053] Table 2. Inhibitory effects of solid-state fermentation extract of strain AY7B on root and shoot length of different weed seeds.

[0054]

[0055] The above results indicate that the AY7B solid fermentation extract has efficient and stable herbicidal activity against both tested weeds, and has good application prospects as a novel microbial herbicide.

[0056] 2.3, Mediterranean double-seat placoid ( Biscogniauxia mediterranea Assay of the inhibitory activity of AY7B metabolites on weed seedling growth

[0057] Sow 30 seeds of crabgrass and wild amaranth evenly on the surface of the prepared substrate (sterilized nutrient soil and perlite in a 3:1 volume ratio) in flowerpots, cover with a thin layer of soil, and place in a greenhouse for cultivation. The greenhouse conditions are set at 25±2℃, 12h light (6000 lx) / 12h darkness, and relative humidity of 60%-70%. Once the seedlings have two true leaves, treat them with appropriate pesticides. Treatment group 1: Spray the fermentation broth of strain AY7B (preparation method as described in 2.1); Treatment group 2: Spray an equal volume of AY7B solid fermentation extract solution with a concentration of 5000 μg / mL (preparation method as described in 2.2); Control group: Sprayed with an equal volume of sterile water.

[0058] Each treatment group had 6 biological replicates. Each replicate was sprayed with 10 mL of the corresponding solution, ensuring the leaves were moist but not dripping. After 7 days of treatment, morphological changes in the weed seedlings were observed and recorded. Subsequently, whole seedlings were harvested, the root substrate was washed away, and the fresh weight (weighed immediately after washing) and dry weight (weighed after drying in an 80℃ oven to constant weight) were measured. The fresh weight inhibition rate and dry weight inhibition rate were calculated using the following formulas: Inhibition rate (%) = [Fresh (dry) weight of control group - Fresh (dry) weight of treatment group] / Fresh (dry) weight of control group × 100%.

[0059] Morphological observations showed that after treatment with fermentation broth and 5000 μg / mL extract solution for 7 days, the damage symptoms of different weeds differed significantly: Amaranth seedlings showed typical and obvious damage, with obvious yellowing and drying spots on their leaves, and some leaf edges curling and wilting; Digitaria seedlings showed no obvious damage; while the control group treated with water grew vigorously, with bright green leaves and no abnormal symptoms such as scorching or spots (see...). Figure 6 ).

[0060] Biomass determination results (Table 3) showed that after treatment with 5000 μg / mL extract solution, the fresh weight inhibition rates of wild amaranth and crabgrass seedlings reached 36.0% and 19.0%, respectively, and the dry weight inhibition rates were 29.2% and 22.2%, respectively; the fresh weight inhibition rates of wild amaranth and crabgrass seedlings in the fermentation broth treatment group were 27.9% and 7.9%, respectively, and the dry weight inhibition rates were 24.8% and 14%, respectively.

[0061] Based on the morphological damage symptoms (leaf wilting, leaf margin scorching, etc.) and biomass inhibition data of the tested weed seedlings, it can be seen that *Discocephalus medarius* (Mediterranean dispersible fungus) is a significant contributor to the disease. Biscogniauxia mediterraneaAY7B metabolites (including fermentation broth and solid-state fermentation extracts) significantly inhibited the growth of Amaranth seedlings through a dual mechanism of action: inducing physiological damage to weed leaves and blocking biomass accumulation. This result further demonstrates that AY7B is a superior endophytic fungus with the potential to develop novel microbial herbicides, providing a high-quality microbial resource and innovative research direction for screening microbial herbicidal active substances. The development and application of its related metabolites, due to the natural advantages of microbial herbicides—both environmental compatibility and target specificity—have significant practical importance and application value in alleviating problems such as weed resistance, pesticide residues, and environmental pollution caused by the long-term use of chemical herbicides.

[0062] 2.4, Mediterranean two-seat placoid ( Biscogniauxia mediterranea Safety evaluation of AY7B metabolites for crop growth

[0063] Select plump and uniform wheat ( Triticum aestivum L.) and corn ( Zea mays L.) Seeds are disinfected by soaking in a 5% sodium hypochlorite solution for 10 minutes and rinsing 3-5 times with sterile water. Then, 10 seeds are evenly sown in flowerpots containing sterilized substrate (nutrient soil: perlite = 3:1), and covered with a 0.5 cm layer of soil. The flowerpots are placed in a greenhouse for cultivation (conditions: 25±2℃, 12 h light / 12 h darkness, relative humidity 60%~70%). When the seedlings reach the two true leaf stage, they are treated with a fungicide. Treatment groups 1-3: Sprayed with AY7B solid fermentation extract solutions at concentrations of 1000 μg / mL, 2000 μg / mL, and 5000 μg / mL respectively (preparation method as described in 2.2); Control group: Sprayed with an equal volume of sterile water.

[0064] Each treatment group had 6 biological replicates. Each replicate was sprayed with 10 mL of the corresponding solution, ensuring that both sides of the leaves were moist but not dripping. After 7 days of treatment, the morphological growth of the crop seedlings was observed and recorded. Subsequently, the whole seedlings were harvested, the root substrate was washed off, and the fresh weight (weighed immediately after washing) and dry weight (weighed after drying in an 80℃ oven to constant weight) were measured to analyze the effects of metabolites on crop growth.

[0065] Safety evaluation results showed that the solid-state fermentation extract of strain AY7B exhibited good crop safety in both wheat and corn seedlings (Table 3). Figure 7Specifically, as the extract concentration increased from 1000 μg / mL to 5000 μg / mL, the fresh and dry weights of both crop seedlings showed only slight decreases, without significant inhibitory effects. The extract had a relatively significant impact on maize seedling growth, but the fresh and dry weights of all treatment groups remained close to the control group, without a significant decline, and the seedlings showed no obvious yellowing, wilting, or other abnormal damage symptoms. The effect on wheat seedlings was even milder; only the 5000 μg / mL high-concentration treatment group showed a slight decrease in fresh weight, while the dry weight was not significantly different from the control group. The growth status of wheat seedlings in the low-concentration (1000 μg / mL, 2000 μg / mL) treatment groups was basically the same as the control group. In summary, wheat and maize seedlings treated with different concentrations of extract showed good growth without significant adverse physiological damage, indicating that the AY7B metabolite has excellent safety for both crops within the experimental concentration range, providing important safety assurance for their field application.

[0066] Table 3. Effects of solid-state fermentation extracts from strain AY7B on fresh and dry weights of wheat and corn.

[0067]

[0068] The same experimental method was subsequently used to further verify the safety effect of the fermentation broth of strain AY7B on crop growth. The results showed that the fermentation broth also exhibited excellent crop safety for wheat and corn seedlings, consistent with the safety characteristics of solid fermentation extracts.

[0069] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. However, the above description is merely a specific embodiment of the present invention, and the technical features of the present invention are not limited thereto. Any other embodiments derived by those skilled in the art without departing from the technical solution of the present invention should be covered within the scope of the present invention.

Claims

1. A strain of endophytic Mycosphaerella mediterranea AY7B, characterized in that, The strain is isolated from healthy and disease-free artemisia leaves picked up in a farm of Nanyang Normal University, and the strain is preserved in China General Microbiological Culture Collection Center on November 11, 2024, with a preservation number of CGMCC NO.41594; and is classified and named as Dissopteris mediterranea (AY7B) belonging to the fungus of Dissopteris. Biscogniauxia mediterranea )AY7B, belongs to the fungus of Dissopteris.

2. The strain of Phaeosphaeria sp. AY7B of Elaeagnus umbellata of claim 1, characterized by, The ITS sequence of the strain AY7B is shown as SEQ ID NO. 5, and the β-tubulin gene sequence is shown as SEQ ID NO.

6.

3. A herbicidally active substance, characterized in that, The active substance is derived from the Biscogniauxia mediterranea strain AY7B according to any one of claims 1-2, and the active substance is a fermentation broth of the strain, or an extract of solid fermentation product of the strain.

4. The method of preparing a herbicidally active substance according to claim 3, wherein the herbicidally active substance is prepared by the method according to claim 1 or 2. The preparation process of the fermentation broth of the strain is as follows: The activated strain AY7B is inoculated into PDB liquid medium, and cultured at 25℃ with 150 r / min for 12-15 days, and then filtered to obtain the fermentation broth; The preparation process of the extract of solid fermentation product of the strain is as follows: S1. The activated strain AY7B is inoculated into PDB liquid medium for fermentation culture; S2. The seed liquid is inoculated into rice solid medium according to the preset inoculation amount, and statically fermented in a constant temperature incubator; S3. The fermentation product is dried, crushed, extracted, and the extract is concentrated to obtain the extract of solid fermentation product.

5. The preparation method of the herbicidal active substance according to claim 4, wherein, In step S1, the fermentation culture conditions are as follows: 25℃, 150 r / min, and oscillation culture for 4-6 days to obtain the seed liquid; In step S2, the preparation method of the rice solid medium is as follows: 80 g of rice is soaked overnight after adding 120 mL of water, then sterilized at 121℃ for 20 min by high-pressure steam, and cooled to room temperature to obtain the rice solid medium; the inoculation amount of the seed liquid is 4-7 mL / bottle, and the static fermentation temperature in the rice solid medium is 25-28℃, and the time is 35-45 days; In step S3, the extraction solvent is a mixed solvent of dichloromethane / methanol with a volume ratio of 1:1, and the extraction is performed for 3-5 times.

6. Use of a herbicidally active substance according to claim 3 for controlling weeds, characterized in that The weeds are selected from at least one of Digitaria sanguinalis, Amaranthus retroflexus, Echinochloa crus-galli, and Portulaca oleracea.

7. Use according to claim 6, wherein The application includes inhibition of the seed germination stage of weeds and inhibition of the seedling growth stage of weeds.

8. Use according to claim 7, wherein the compound is ###0002### When used for inhibiting the seed germination of weeds, the fermentation broth is directly applied to the seeds of weeds, and the extract of solid fermentation product is diluted to a concentration of 1500-2000 μg / mL and then applied to the seeds of weeds; when used for inhibiting the seedling growth of weeds, the fermentation broth or the extract of solid fermentation product diluted to a concentration of 4000-6000 μg / mL is directly sprayed on the leaves of the weed seedlings with 2 true leaves.

9. A weed control agent, characterized by, The active ingredient of the control agent comprises the Biscogniauxia mediterranea strain AY7B according to claim 1, or the herbicidal active substance according to claim 3.

10. The weed control agent according to claim 9, wherein The control agent further comprises an agriculturally acceptable adjuvant, which is at least one of a solvent, a stabilizer, and a dispersant, and the dosage form of the control agent is a liquid agent or a solid powder. The active ingredient of the control agent comprises the Biscogniauxia mediterranea strain AY7B according to claim 1, or the herbicidal active substance according to claim 3. The control agent further comprises an agriculturally acceptable adjuvant, which is at least one of a solvent, a stabilizer, and a dispersant, and the dosage form of the control agent is a liquid agent or a solid powder.

Images