Saccharomyces cerevisiae, probiotic agent and application of saccharomyces cerevisiae and probiotic agent in improvement of animal growth performance

By screening and combining Saccharomyces cerevisiae YSJ-21 with Bacillus licheniformis B289 and Lactobacillus casei Ssd3, a probiotic composition was prepared. This solved the problems of low survival rate and limited function of probiotics in gastric acid, bile salts and intestinal environment, improved the growth performance and antioxidant performance of livestock and poultry, and achieved the improvement of meat quality.

CN121674243APending Publication Date: 2026-03-17GANSU ACAD OF SCI INST OF BIOLOGY
View PDF 13 Cites 0 Cited by

Patent Information

Application Number
CN202610045831.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-14
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Existing probiotic products have low survival rates in the complex environment of gastric acid, bile salts and intestines, limited functions, and insufficient antioxidant properties, making them difficult to apply efficiently and stably in livestock and poultry production. Furthermore, research on the compatibility effects between different bacterial strains is insufficient.

Method used

A strain of Saccharomyces cerevisiae YSJ-21 was screened and combined with Bacillus licheniformis B289 and Lactobacillus casei Ssd3 to prepare a probiotic composition. This composition was added to the basic animal diet to improve the animals' growth performance, antioxidant properties and meat quality.

Benefits of technology

It significantly improves the growth performance, antioxidant properties and meat quality of broiler chickens and lambs, provides a new probiotic agent for livestock and poultry farming, and solves the problems of survival rate and functional deficiencies in existing technologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674243A_ABST
    Figure CN121674243A_ABST
Patent Text Reader

Abstract

The invention discloses saccharomyces cerevisiae, a probiotic agent and application of the probiotic agent in improvement of animal growth performance, and belongs to the technical field of microbial agents. The saccharomyces cerevisiae is obtained by screening, and is characterized in that the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.20630. The saccharomyces cerevisiae, the bacillus licheniformis B289 and the casei casei Ssd3 are compounded to prepare the probiotic microbial agent, and the probiotic microbial agent is found to be capable of remarkably improving the growth performance, the oxidation resistance, the meat quality and the like of chickens and sheep, so that a theoretical basis is laid for providing a new probiotic microbial agent for livestock and poultry breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial inoculants, and in particular to a strain of brewer's yeast, a probiotic inoculant, and its application in improving animal growth performance. Background Technology

[0002] With the intensive development of livestock farming, the overuse of antibiotics has become a significant obstacle to the industry's sustainable development, leading to increasingly prominent problems such as increased drug resistance, drug residues, and environmental pollution. Therefore, finding safe and green feed additives to replace or reduce antibiotic use has become a hot topic in current livestock research. Probiotics, as a natural and environmentally friendly microbial preparation, can improve animal production performance and health by regulating the balance of intestinal flora, enhancing immune function, and promoting nutrient absorption, thus showing broad application prospects.

[0003] However, commercially available probiotic products still have many limitations in practical applications. Many strains have low survival rates in the complex environment of stomach acid, bile salts, and the intestines, making it difficult for them to colonize the gut and exert their effects. Some strains have limited functions and insufficient antioxidant and drug resistance, making it difficult to cope with the stress conditions commonly encountered in intensive farming. In addition, research on the compatibility effects between different strains is still insufficient, and the synergistic mechanism of compound probiotic agents needs further exploration, which limits their efficient and stable application in livestock and poultry production.

[0004] Therefore, screening probiotic strains with excellent tolerance, antioxidant properties, and adaptability, and developing highly efficient and stable compound probiotic formulations, have become key to promoting the large-scale application of probiotics in feed. This technology aims to address the above issues by providing a high-performance yeast probiotic and its compound application scheme with common probiotics, in order to provide new technical support for healthy livestock and poultry farming. Summary of the Invention

[0005] The purpose of this invention is to provide a strain of brewing yeast, a probiotic agent, and its application in improving animal growth performance, in order to solve the problems existing in the prior art. When the brewing yeast YSJ-21 screened by this invention is combined with Bacillus licheniformis B289 and Lactobacillus casei Ssd3, it was found that it can significantly improve the growth performance, antioxidant properties, and meat quality of chickens and sheep, which lays a theoretical basis for providing new probiotic agents for livestock and poultry farming.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a strain of Saccharomyces cerevisiae, which has the preservation number CGMCC No. 20630.

[0008] The present invention also provides the application of the aforementioned brewing yeast in the preparation of antioxidant agents.

[0009] The present invention also provides an antioxidant microbial agent, including the aforementioned brewer's yeast.

[0010] The present invention also provides a probiotic composition comprising the aforementioned Saccharomyces cerevisiae, Bacillus licheniformis B289, and Lactobacillus casei Ssd3.

[0011] Preferably, the brewing yeast, Bacillus licheniformis B289 and Lactobacillus casei Ssd3 are compounded in the form of bacterial powder with a mass ratio of 1:1:1;

[0012] The Bacillus licheniformis B289 has the accession number CICC 20514, and the Lactobacillus casei Ssd3 has the accession number CICC 20290.

[0013] The present invention also provides the use of the probiotic composition in any of the following:

[0014] (1) Application in the preparation of probiotic agents or feeds that enhance the antioxidant properties of animals;

[0015] (2) Application in the preparation of probiotic agents or feeds that improve animal growth performance;

[0016] (3) Preparation of probiotic agents to improve the quality of animal meat or their application in feed;

[0017] (4) Application in the preparation of probiotic agents or feeds that improve animal slaughter performance;

[0018] (5) Preparation of probiotics that improve the beneficial flora of animal intestines or their application in feed.

[0019] Preferably, the animals include chickens and sheep.

[0020] The present invention also provides a probiotic preparation comprising the aforementioned probiotic composition.

[0021] The present invention also provides a feed comprising the aforementioned probiotic agent and a basal diet, wherein the probiotic agent is added to the basal diet at an amount of 0.5%-1.0% w / w.

[0022] The present invention also provides a method for improving the antioxidant properties, growth performance, meat quality and / or slaughter performance of animals, comprising the step of feeding the animals the feed, wherein the animals include chickens and sheep.

[0023] The present invention discloses the following technical effects:

[0024] This invention screened a probiotic strain, YSJ-21, which exhibits excellent resistance to acid, bile salts, artificial gastrointestinal fluids, and drugs, and possesses antioxidant properties. Molecular biological identification confirmed it to be *Saccharomyces cerevisiae* YSJ-21. A probiotic agent prepared by combining this strain with specific *Bacillus licheniformis* B289 and *Lactobacillus casei* Ssd3 was added to the basal animal diet and fed to animals (this invention uses chickens and sheep as examples). It was found that compared to the combination of *Bacillus licheniformis* B289 and *Lactobacillus casei* Ssd3, the addition of *Saccharomyces cerevisiae* YSJ-21 significantly improved certain growth performance, antioxidant properties, and meat quality in broilers and lambs, demonstrating a positive effect on livestock and poultry growth and providing a new probiotic agent for livestock and poultry farming. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 YSJ-21 strain was cultured on PDA solid plates;

[0027] Figure 2 Phylogenetic tree of strain NJ of YSJ-21 constructed based on ITS gene sequence;

[0028] Figure 3 For the determination of acid resistance of strain YSJ-21;

[0029] Figure 4 The results of the bile salt tolerance assay for strain YSJ-21;

[0030] Figure 5 The results of the YSJ-21 strain's tolerance to artificial gastrointestinal fluid;

[0031] Figure 6 To investigate the effects of adding different probiotic agents on the genus-level diversity of gut bacteria in lambs;

[0032] Figure 7 To investigate the effects of adding different probiotic agents on the relative abundance of dominant gut bacteria in lambs at the species level.

[0033] Figure 8 The effect of adding different probiotic agents on the relative abundance of dominant intestinal fungi in lambs at the cecal microbiota level;

[0034] Figure 9To investigate the effects of adding different probiotic preparations on the relative abundance of dominant intestinal fungi at the species level in lambs. Detailed Implementation

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0040] Example 1: Isolation and Identification of Saccharomyces cerevisiae

[0041] 1. Isolation of strains

[0042] Silage samples were collected from a livestock farm in Ganzhou District, Zhangye City, Gansu Province, and brought back to the laboratory in sampling bags for later use. 10 g of soil sample was weighed and cut into lengths of approximately 1 cm. The sample was added to a sterile Erlenmeyer flask containing glass beads and 90 mL of pure water, and incubated at 30℃ and 200 rpm for 30 min on a shaker. After standing for 5 min, 1 mL of the supernatant was added to a test tube containing 9 mL of sterile water, and serially diluted to 10⁻⁶.-2 -10 -6 Prepare a sample suspension at a concentration of g / mL. Take 100 μL of the diluted sample bacterial suspension (10 g / mL) for later use. -2 -10 -6 The yeast extract (g / mL) was evenly spread onto a PDA solid plate (0.5% yeast extract, 1% peptone, 1% sodium chloride, 2% agar, and the remainder water) using a spreader. Three replicates were prepared for each concentration. The plates were inverted and incubated at 30°C. The growth of colonies on the plates was observed. Different morphological strains were picked and streaked onto the PDA plate for purification. Finally, a microbial strain, designated YSJ-21, was isolated. Figure 1 As shown.

[0043] The preparation method of the above PDA solid plates is as follows: wash, peel and cut potatoes into pieces, boil them in water for 30 minutes, filter the potato pieces with 6 layers of gauze to obtain filtrate; add the corresponding amount of glucose and agar, dissolve them and add water to 1000 mL; sterilize the culture medium at 121℃ for 20 minutes with 100 kPa high-pressure steam; pour the sterilized culture medium into sterilized petri dishes.

[0044] 2. Identification of strains

[0045] DNA was extracted from strain YSJ-21 using a kit (Tiangen Biotech (Beijing) Co., Ltd.). The ITS gene sequence of the strain was amplified using fungal ITS-specific primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′, SEQ ID NO.1) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′, SEQ ID NO.2), and the amplified products were sent for sequencing (Shanghai Sangon Biotech). The sequenced ITS sequences were submitted to the NCBI website for alignment analysis. A Neighbor Joining phylogenetic tree based on the ITS sequences was constructed using MEGA 12 software, with the Kimura 2-paremeter computational model. Sequence alignment revealed that *Saccharomyces cerevisiae* YSJ-21 shares 99.90% similarity with the published strains *Saccharomyces cerevisiae* IFM 40210 (LC413771.1) and *Saccharomyces cerevisiae* strain NCIM3107 (CP009950.1). A phylogenetic tree constructed based on the ITS gene sequence showed that strain YSJ-21 is most closely related to *Saccharomyces cerevisiae* IFM 40210 (LC413771.1) and *Saccharomyces cerevisiae* strain NCIM3107 (CP009950.1). Figure 2 In summary, based on the results of ITA sequence alignment analysis, the strain YSJ-21 is Saccharomyces cerevisiae.

[0046] The ITS sequence is as follows (SEQ ID NO.3):

[0047] GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATC.

[0048] The selected Saccharomyces cerevisiae YSJ-21 was deposited on September 11, 2020, at the China General Microbiological Culture Collection Center (CGMCC); the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; the accession number is: CGMCC No. 20630.

[0049] Example 2: Prebiotic Analysis of Saccharomyces cerevisiae

[0050] 1. Study on the acid and bile salt tolerance activities of Saccharomyces cerevisiae YSJ-21

[0051] (1) Determination of acid resistance of strains

[0052] Saccharomyces cerevisiae YSJ-21 was inoculated into PDA liquid medium and cultured at 28 ℃ for 48 h. The cells were collected by centrifugation at 8000 r / min, 4 ℃ for 10 min, and washed twice with an equal volume of sterile physiological saline. The cells were then resuspended in an equal volume of sterile physiological saline to prepare the test bacterial suspension. The test bacterial suspension was inoculated into PDA liquid medium with pH values ​​of 2.0, 3.0, and 3.5 at an inoculation rate of 2%, and cultured at 30 ℃ for 24 h. Viable cell counts were performed at 0 h and 48 h using the colony plate count method. The survival rate was calculated using the following formula:

[0053] Survival rate = N1 / N0 × 100%

[0054] In the formula: N0 is the number of viable bacteria at 0 h, in CFU / mL; N1 is the number of viable bacteria after 24 h of culture, in CFU / mL.

[0055] Depend on Figure 3 It can be seen that Saccharomyces cerevisiae YSJ-21 grows well in PDA liquid medium with pH values ​​of 2.0, 3.0 and 3.5. Among them, the survival rate of the strain still reaches 94.34% at pH value of 2.0.

[0056] (2) Determination of bile salt tolerance of strains

[0057] The above-mentioned bacterial suspensions were inoculated at a 2% (V / V) inoculum into PDA liquid medium containing 0.3 g / 100 mL, 0.4 g / 100 mL, and 0.5 g / 100 mL ox bile salts, respectively, and incubated at 30°C for 24 h. Viable bacteria were counted at 0 h and 24 h using the colony plate counting method, and the survival rate was calculated using the same method as above.

[0058] Saccharomyces cerevisiae YSJ-21 grows well in PDA liquid medium containing ox bile salts, see [reference needed]. Figure 4When the ox bile salt content in the culture medium was 0.3 g / 100 mL, the survival rate of the strain reached 86.43%.

[0059] 2. Determination of the tolerance of Saccharomyces cerevisiae YSJ-21 to artificial gastrointestinal fluid.

[0060] Saccharomyces cerevisiae YSJ-21 was inoculated into PDA liquid medium and cultured at 28 ℃ for 48 h. The cells were collected by centrifugation at 8000 r / min and 4 ℃ for 10 min. The cells were washed twice with an equal volume of sterile physiological saline and then suspended in an equal volume of sterile physiological saline to prepare the test bacterial solution.

[0061] Take 1 mL of the test bacterial culture and inoculate it into 9 mL of sterile pH 2.5 artificial gastric fluid. After mixing, incubate at 30°C for 3 h. Measure the viable bacterial count at 0 h and 3 h using the plate count method to calculate the survival rate. Then, take 1 mL of the bacterial culture treated with artificial gastric fluid and inoculate it into 9 mL of sterile artificial intestinal fluid. Incubate at 30°C for 4 h and 8 h. Measure the viable bacterial count at 0 h, 4 h, and 8 h using the plate count method to calculate the survival rate.

[0062] Artificial gastric fluid survival rate (%) = N1 / N0 × 100%

[0063] Artificial intestinal fluid survival rate (%) = N2 / N0 × 100%

[0064] In the formula, N0 is the number of viable bacteria (CFU / mL) at 0 h; N1 is the number of viable bacteria (CFU / mL) inoculated into artificial gastric fluid at 3 h; and N2 is the number of viable bacteria (CFU / mL) inoculated into artificial intestinal fluid at 4 h or 8 h.

[0065] The artificial gastric fluid was prepared by adding 3.0 g / L pepsin to sterile PBS, adjusting the pH to 2.5 with 0.1 mol / L HCl, and then filtering it through a 0.22 μm sterile membrane for sterilization. The artificial intestinal fluid was prepared by adding 1.0 g / L trypsin and 1.8% ox bile salt to sterile PBS, adjusting the pH to 8.0 with 0.1 mol / L NaOH, and then filtering it through a 0.22 μm sterile membrane for sterilization.

[0066] After culturing *Saccharomyces cerevisiae* YSJ-21 in artificial gastric juice for 24 h, the results were as follows: Figure 5 As shown, the colony count increased from 3.18 × 10⁻⁶. 9 CFU / mL decreased to 2.51 x 10⁻⁶ 9 The bacterial count was CFU / mL, and the survival rate of the strain was 78.93%. After 24 h of culture in artificial intestinal fluid, the colony count at 0 h was 2.51 × 10⁻⁶. 9 CFU / mL, colony count at 4 h was 1.63 × 10⁻⁶. 9CFU / mL; colony count at 8 h was 1.96 × 10⁻⁶. 9 The CFU / mL concentration and the survival rate of the strain were 77.13%, indicating that Saccharomyces cerevisiae YSJ-21 has good tolerance to artificial gastrointestinal fluid.

[0067] 3. Drug susceptibility testing of strains

[0068] After activating the brewer's yeast YSJ-21, the bacterial concentration was adjusted to 1.0 × 10⁻⁶. 8 For CFU / mL, 100 μL of bacterial suspension was spread onto PDA solid medium. After drying, E-test strips for erythromycin, ampicillin, penicillin, chloramphenicol, amikacin, clindamycin, tetracycline, ceftazidime, ciprofloxacin, and azithromycin were respectively affixed to the PDA solid medium and incubated at 30℃ for 24 h. The MIC value was determined based on the size of the inhibition zone. A blank control was used with a PDA solid plate without antibiotics, and the diameter of the inhibition zone was measured with calipers. The diameter of the inhibition zone of Saccharomyces cerevisiae YSJ-21 against 10 antibiotics is shown in Table 1. The more sensitive the strain to the antibiotic, the weaker the activity around the drug sensitivity test strip, and the larger the transparent zone (inhibition zone) formed. Saccharomyces cerevisiae YSJ-21 was highly sensitive to erythromycin, ampicillin, penicillin, chloramphenicol, tetracycline, ciprofloxacin, and azithromycin, and moderately sensitive to clindamycin and ceftazidime.

[0069] Table 1 Antibiotic susceptibility test of Lactobacillus fermentum

[0070]

[0071] Note: R: low sensitivity; I: moderate sensitivity; S: high sensitivity; "-": no inhibition zone; the diameter of the drug sensitivity tablet is 6 mm.

[0072] 4. Determination of the hydrophobicity of the bacterial surface

[0073] The bacterial strain was inoculated into PDA liquid medium and cultured at 30℃ for 24 h. The cells were collected by centrifugation at 8000 rpm for 5 min at 4℃, washed twice with 50 mmol / L phosphate buffer, and the precipitate was resuspended in buffer. Using the buffer as a blank control, the bacterial concentration was adjusted, and the initial absorbance A0 was measured at 600 nm. 2 mL of the bacterial suspension was taken, 2 mL of xylene was added, vortexed at high speed for 2 min, and allowed to stand for 10 min to separate the layers. The absorbance A of the lower aqueous phase was measured at 600 nm. The hydrophobicity of the lactic acid bacteria cell surface was calculated using the following formula:

[0074] Hydrophobicity (%) = (A0 - A) / A0 × 100%

[0075] In the formula, A0 is the initial absorbance; A is the absorbance of the bacterial solution after mixing with xylene.

[0076] Cell surface hydrophobicity is a crucial factor determining the non-specific adhesion of bacterial strains. High hydrophobicity indicates strong adhesion ability. The criteria for hydrophobicity are: 71%–100% is strongly hydrophobic, 36%–70% is moderately hydrophobic, and below 35% is weakly hydrophobic. The surface hydrophobicity of *Saccharomyces cerevisiae* YSJ-21 is 42%, classifying it as moderately hydrophobic.

[0077] 5. Determination of the superoxide anion scavenging capacity of the strain

[0078] The strain was inoculated into PDA liquid medium and cultured at 30℃ for 24 h. Then, 0.5 mL of the sample was taken and 1 mL each of Tris-HCl (150 mmol / L; pH 8.2), pyrogallol (1.2 mmol / L), and diethylenetriaminepentaacetic acid (3 mmol / L) were added, resulting in a total reaction volume of 3.5 mL. After incubating in a water bath at 25℃ for 10 min, the absorbance at 325 nm was measured. The calculation formula is as follows:

[0079] Superoxide anion scavenging rate (%) = [1-(A 11 -A 10) / (A 01 -A 00) ] × 100%

[0080] In the formula, A 00 Absorbance of no sample and pyrogallol; A 01 : Absorbance of sample without pyrogallol; A 10 : Sample containing pyrogallol, absorbance without pyrogallol; A 11 : Absorbance of the sample and pyrogallol.

[0081] Superoxide anion free radicals primarily damage cell membranes, including vascular endothelial cell membranes and substructures, and trigger a series of harmful biochemical reactions, seriously affecting human health. Saccharomyces cerevisiae YSJ-21 exhibits a superoxide anion scavenging rate of 54%.

[0082] 6. Determination of the strain's ability to scavenge DPPH free radicals

[0083] The strain was inoculated into PDA liquid medium and cultured at 30℃ for 24 h. Then, 2 mL of the sample was mixed thoroughly with 2 mL of DPPH anhydrous ethanol solution (0.2 mmol / L), and reacted at room temperature in the dark for 30 min. After centrifugation at 6000 rpm for 10 min, the supernatant was collected and the absorbance value (A) was measured at 517 nm. i The blank group used an equal volume of anhydrous ethanol instead of DPPH anhydrous ethanol solution A0, and the control group used an equal volume of blank solvent instead of sample solution A. j The zeroing point was set using an equal volume of distilled water and ethanol mixture. The calculation formula is as follows:

[0084] Clearance rate (%) = 100 - (A) i -A0) / A j × 100%

[0085] In the formula, A0: blank absorbance; A j : Compare absorbance values; A i : Sample absorbance value.

[0086] The ability of a microbial strain to scavenge DPPH free radicals indicates its antioxidant capacity. Saccharomyces cerevisiae YSJ-21 scavenged 92% of DPPH free radicals.

[0087] Example 3: Preparation of microbial inoculants

[0088] 1. Preparation of yeast probiotic inoculum

[0089] Saccharomyces cerevisiae YSJ-21 was inoculated onto PDA solid agar slant medium and cultured at 30℃ for 48 h to obtain the seed slant. The Saccharomyces cerevisiae was then inoculated from the seed slant onto PDA liquid agar slant and cultured with shaking at 27℃ and 200 rpm for 48 h to obtain the liquid seed. To further expand the Saccharomyces cerevisiae culture, 250 mL of the liquid seed was inoculated into a 50 L fermenter using PDA liquid agar slant medium and cultured at 30℃ and 200 rpm for 36 h. Then, 2500 mL of the bacterial culture from the 50 L fermenter was inoculated into a 500 L fermenter using PDA liquid agar slant medium and cultured at 30℃ and 200 rpm for 36 h. The yeast fermentation broth was then collected, and the effective viable cell count of the liquid inoculum was controlled to 3.4 × 10⁻⁶ using an extraction and concentration device. 10 The liquid brewing yeast agent was then converted into a solid powder using a low-temperature spray drying device at CFU / mL, with an effective viable count of 1.5 × 10⁻⁶ cells / mL. 9 CFU / mL refers to the YSJ-21 microbial inoculant for brewing yeast.

[0090] 2. Preparation of Bacillus licheniformis inoculant

[0091] The Bacillus licheniformis B289 strain involved in this invention was purchased from the China Industrial Microbial Culture Collection Center, accession number: CICC 20514. This strain is used as a feed additive. This invention has verified through experiments that this strain has good acid resistance, bile salt resistance, artificial gastrointestinal fluid resistance, drug resistance, and antioxidant properties.

[0092] Bacillus licheniformis B289 seed culture was inoculated slant onto LB liquid medium and cultured with shaking at 28℃ and 200 rpm for 24 h to obtain liquid seed culture. To further expand the culture of Bacillus licheniformis B289, 250 mL of the liquid seed culture was inoculated into a 50 L fermenter on LB liquid medium and cultured at 28℃ and 200 rpm for 24 h. Then, 2500 mL of the bacterial culture from the 50 L fermenter was inoculated into a 500 L fermenter on LB liquid medium and cultured at 28℃ and 200 rpm for 24 h. The fermentation broth was then collected, and the effective viable count of the liquid bacterial agent was controlled to 3 × 10⁻⁶ using an extraction and concentration device. 10 The liquid Bacillus licheniformis inoculant was then converted into a solid powder using a low-temperature spray drying device, with an effective viable count of 1.5 × 10⁻⁶ CFU / mL. 9 CFU / mL indicates Bacillus licheniformis B289 microbial inoculant.

[0093] The above LB liquid culture medium consisted of 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, and 1000 mL distilled water, with pH adjusted to 7.0, and was autoclaved at 121°C for 20 min.

[0094] 3. Preparation of Lactobacillus casei inoculum

[0095] The *Lactaseibacillus paracasei* Ssd3 strain involved in this invention was purchased from the China Industrial Microbial Culture Collection Center, accession number: CICC 20290. This strain is used for silage. This invention has experimentally verified that this strain has good acid resistance, bile salt resistance, artificial gastrointestinal fluid resistance, drug resistance, and antioxidant properties.

[0096] The *Lactobacillus casei* Ssd3 seed culture was inoculated slant onto MRS liquid medium and cultured with shaking at 37°C and 100 rpm for 24 h to obtain the liquid seed. To further expand the culture of *Lactobacillus casei* Ssd3, 250 mL of the liquid seed was inoculated into a 50 L fermenter on MRS liquid medium and cultured at 37°C and 100 rpm for 24 h. Then, 2500 mL of the bacterial culture from the 50 L fermenter was inoculated into a 500 L fermenter on MRS liquid medium and cultured at 37°C and 100 rpm for 24 h. The fermentation broth was then collected, and the effective viable count of the liquid bacterial agent was controlled to 3 × 10⁻⁶ using an extraction and concentration device. 10The liquid Lactobacillus casei inoculum was converted into a solid powder using a low-temperature spray drying device at CFU / mL, with an effective viable count of 1.5 × 10⁻⁶ CFU / mL. 9 CFU / mL is the inoculum of Lactobacillus casei Ssd3.

[0097] The above-mentioned MRS liquid culture medium consisted of: 10.0 g casein peptone (trypsin digested), 10.0 g beef extract, 5.0 g yeast extract, 20.0 g glucose, 1.0 g Tween 80, 5.0 g sodium acetate, 2.0 g triammonium citrate, 2.0 g K2HPO4, 0.2 g MgSO4·7H2O, 0.05 g MnSO4·H2O, and 1000.0 mL distilled water, with a pH of 6.2–6.5. The medium was autoclaved at 121°C for 15 min.

[0098] Example 4: Effects of probiotic agents on the growth of broiler chickens

[0099] 1. Test materials

[0100] Experimental animals: 1-day-old Sanhuang broiler chickens.

[0101] The probiotic agents used in the experiment were divided into two groups. Group 1 consisted of a 1:1 mass ratio of *Bacillus licheniformis* B289 and *Lactobacillus casei* Ssd3. Group 2 consisted of a 1:1 mass ratio of *Saccharomyces cerevisiae* YSJ-21, *Bacillus licheniformis* B289, and *Lactobacillus casei* Ssd3. The effective viable count of both groups was 1.5 × 10⁻⁶. 9 CFU / mL.

[0102] 2. Experimental Design

[0103] Three hundred and seventy-five one-day-old Sanhuang broiler chickens were randomly divided into five groups, with five replicates per group and seventy-five chickens per replicate. The control group was fed a basal diet, while the four experimental groups were fed a basal diet supplemented with 0.50% and 1.0% of the probiotic agent used in experimental groups 1 and 2, respectively. The basal diet was based on NRC 1994, and its formulation and nutritional components are shown in Table 2. The experimental period was 42 days (days 1–21 and 22–42).

[0104] Table 2. Basal Diet Formulation and Nutritional Components (Air-dried Basal)

[0105]

[0106] Note: ① The premix provides the following per kilogram of feed: Vitamin A 15000 IU, Vitamin D3 4050 IU, Vitamin E 20 IU, Vitamin K3 2.4 mg, Vitamin B12 0.03 mg, Vitamin B1 2.4 mg, Vitamin B2 6.6 mg, Vitamin B6 2.4 mg, Biotin 0.12 mg, Niacin 30 mg, Folic Acid 1.5 mg, Copper 10 mg, Iron 120 mg, Manganese 150 mg, Zinc 100 mg, Iodine 0.8 mg, Selenium 0.45 mg. ② Metabolizable energy is a calculated value, and the remaining nutrients are measured values.

[0107] 3. Feeding Management and Sample Collection

[0108] The experiment involved free access to feed and water, and chickens were raised according to standard chicken farm management procedures. All one-day-old broiler chickens were vaccinated against Marek's disease with a bivalent vaccine. The lighting duration in the chicken house was 24 hours from day 1 to 7 of the experiment, and 20 hours thereafter. The temperature in the chicken house was maintained at 33-35℃ from day 1 to 3 of the experiment. After day 4, the temperature was gradually decreased, and by day 28, it was maintained at approximately 20℃ until the end of the experiment. On day 42 of the experiment, three broiler chickens were randomly selected from each replicate, and blood was collected from the subwing vein using vacuum blood collection tubes. After tilting and settling for 20 minutes, the blood was centrifuged for 10 minutes (3500 rpm), and the serum was aliquoted into 1.5 mL centrifuge tubes and then stored at -20℃ for later analysis.

[0109] 4. Determination of growth performance of broiler chickens

[0110] On the first and last days of the experiment, broiler chickens were weighed according to the experimental design, and their average daily weight gain was calculated. The daily feed consumption of the chickens was also measured, and the average daily feed intake and feed conversion ratio were calculated.

[0111] Table 3 shows the effects of adding different probiotic agents to the basal feed on the growth performance of broilers. Compared with the control group, the addition of probiotic agents was significantly beneficial to the growth of broilers. Different probiotic agents and different dosages of probiotic agents had different effects on the growth performance of broilers. In experimental group 1, the final weight of broilers with a probiotic agent dosage of 1.0% was significantly higher than that with a dosage of 0.5%, and the feed conversion ratio was significantly lower. In experimental group 2, there were no significant differences in any indicators. There were no significant differences in any indicators between experimental group 1 and experimental group 2 with a probiotic agent dosage of 1.0%. However, the final weight and average daily weight gain of broilers with a probiotic agent dosage of 0.5% were significantly higher in experimental group 2 than in experimental group 1, while the feed conversion ratio was significantly lower in experimental group 2 than in experimental group 1. Therefore, the optimal dosage of probiotic agents is 1.0%, and the probiotic agent in experimental group 2 has a better effect on the growth performance of broilers than that in experimental group 1.

[0112] Table 3 Effects of probiotic inoculants on broiler growth performance

[0113]

[0114] Note: Different letters in the same row indicate significant differences (P<0.05), while the presence or absence of the same letter indicates no significant differences (P>0.05).

[0115] 5. Determination of antioxidant indexes in broiler serum

[0116] The activities of glutathione peroxidase, catalase, superoxide dismutase, total antioxidant capacity, and malondialdehyde content in broiler serum were determined using reagent kits from Nanjing Jiancheng Bioengineering Institute.

[0117] The results of adding probiotic agents to the feed of experimental groups 1 and 2 on the antioxidant activity of broiler serum are shown in Table 4. The antioxidant performance of broiler serum in the probiotic agent group was significantly better than that in the control group. In experimental group 1, the malondialdehyde (MDA) content in the 1.0% group was significantly lower than that in the 0.5% group. There were no significant differences in any indicators in experimental group 2. The MDA content in experimental group 1 with a 1.0% addition was significantly higher than that in experimental group 2, while there were no significant differences in other indicators. Therefore, the optimal addition amount of probiotic agent in experimental group 1 is 1.0%, and the addition amount of probiotic agent in experimental group 2 is 0.5% from a cost perspective. Overall, the probiotic agent group in experimental group 2 is superior to that in experimental group 1.

[0118] Table 4. Effects of probiotic preparations on antioxidant indices in broiler serum.

[0119]

[0120] Note: Different letters in the same row indicate significant differences (P<0.05), while the presence or absence of the same letter indicates no significant differences (P>0.05).

[0121] 6. Determination of slaughter performance of broiler chickens

[0122] On the last day of the experiment, after fasting for 12 hours, three broiler chickens were randomly selected from each replicate, and their live weight was measured before slaughter. The slaughter weight, semi-eviscerated weight, fully eviscerated weight, breast muscle weight, leg muscle weight, and abdominal fat weight of the broiler chickens were measured, and the dressing percentage, semi-eviscerated percentage, fully eviscerated percentage, breast muscle percentage, leg muscle percentage, and abdominal fat percentage of the broiler chickens were calculated.

[0123] The effects of adding probiotics to the feed of experimental groups 1 and 2 on the slaughter performance of broilers are shown in Table 5. Compared with the control group, the broilers in the probiotic-added groups had better slaughter performance. In experimental group 1, the eviscerated yield of the 1.0% group was significantly higher than that of the 0.5% group, while the abdominal fat percentage was significantly lower than that of the 0.5% group. There were no significant differences in any indicators in experimental group 2. The abdominal fat percentage of experimental group 1 with an added amount of 0.5% was significantly higher than that of experimental group 2. There were no significant differences in any indicators between the two experimental groups with an added amount of 1.0%.

[0124] Table 5. Effects of probiotic inoculants on broiler slaughter performance

[0125]

[0126] Note: Different letters in the same row indicate significant differences (P<0.05), while the presence or absence of the same letter indicates no significant differences (P>0.05).

[0127] 7. Determination of Broiler Chicken Quality

[0128] Meat quality testing shall be conducted in accordance with the "Determination of Meat Quality of Livestock and Poultry" (NY / T 1333-2007), as follows:

[0129] pH determination: The pH of the breast muscle samples was measured at three different locations 45 minutes after slaughter using a portable pH meter; after being placed at 4℃ for 24 hours, the pH was measured again. 24h ;

[0130] Flesh color determination: The brightness (L) of fresh cut surfaces from three different locations of the pectoral muscle was measured using a DR-18 three-diameter colorimeter. ∗ ), redness (a ∗ ) and yellowness (b ∗ )value;

[0131] Shear force measurement: The pectoral muscle was placed in a plastic bag, bathed in water at 85℃ for 30 minutes, cooled to room temperature, trimmed into strips with a diameter of 1 cm, and cut perpendicular to the muscle fiber direction using a muscle tenderness meter (C-LM3B digital display muscle tenderness meter) to measure the shear force.

[0132] Cooked meat percentage determination: Weigh about 100g of breast muscle (m1), steam it for 30 minutes, cool it for 2 hours and weigh it again (m2), and calculate the cooked meat percentage according to the following formula;

[0133] Cooked meat yield (%) = (m2 / m1) × 100;

[0134] Water loss rate determination: Use a circular sampler with a diameter of 2.523 cm to cut an appropriate amount of pectoral muscle and weigh it (m1). Then place it between two layers of gauze, with 18 layers of filter paper and a plastic plate on the top and bottom. Use a steel ring expansion compression device to pressurize it to 35 kg and keep it for 5 min. Immediately take out the meat sample and weigh it (m2). Calculate the water loss rate according to the following formula.

[0135] Water loss rate (%) = [(m1 - m2) / m1] × 100%

[0136] The results are shown in Table 6. The overall quality of broiler meat in the group with probiotics added to the feed was better than that in the control group. Different addition amounts and different probiotic agents had different effects on chicken quality. In experimental group 1, the yellowness level was b... ∗ Both the yellowness and shear strength were significantly lower at an addition rate of 1.0% than at 0.5% in group 2. ∗ The addition amount of 1.0% was significantly lower than that of 0.5%; when the probiotic agent addition amount was 0.5%, the shear force of experimental group 2 was significantly lower than that of experimental group 1, while when the addition amount was 1.0%, there was no significant difference in the indicators of the two experimental groups; indicating that the optimal addition amount of the two probiotic agents is 1.0%, however, the probiotic agent group of experimental group 2 was better than that of experimental group 1 overall.

[0137] Table 6. Effects of probiotic inoculants on broiler chicken quality

[0138]

[0139] Note: Different letters in the same row indicate significant differences (P<0.05), while the presence or absence of the same letter indicates no significant differences (P>0.05).

[0140] Example 5: Effects of probiotic preparations on lamb growth

[0141] 1. Test materials

[0142] Experimental animals: 30-day-old Hu sheep lambs;

[0143] The experimental microbial agents were divided into two groups. Group 1 consisted of a 1:1 mass ratio of *Bacillus licheniformis* B289 and *Lactobacillus casei* Ssd3. Group 2 consisted of a 1:1 mass ratio of *Saccharomyces cerevisiae* YSJ-21, *Bacillus licheniformis* B289, and *Lactobacillus casei* Ssd3. The effective viable count of both groups of probiotic agents was 1.5 × 10⁻⁶. 9 CFU / mL.

[0144] 2. Experimental Design

[0145] Seventy-five healthy 30-day-old Hu sheep lambs with similar body condition and an initial weight of (7.54±0.32) g were selected. The lambs were randomly divided into three groups, with five replicates per group and five lambs per replicate. During the feeding experiment, the probiotic agent added to both groups was 1.0%. The control group (CK) was fed starter feed. The starter feed formula for lambs was designed according to the "Standards for Meat Sheep Feeding" (NY / T 816—2004). The starter feed for lambs was pelleted feed, and the formula composition and nutritional level are shown in Table 7.

[0146] Table 7 Composition and Nutritional Levels of Starter Feed for Lambs (Air-dried Basis)

[0147]

[0148] Note: The premix provides 1.10 g of iron, 0.73 g of copper, 0.31 g of manganese, 0.26 g of zinc, 0.01 g of iodine, 0.02 g of selenium, 0.22 g of cobalt, 76190 IU of vitamin A, 429 IU of vitamin D3, 170 IU of vitamin E, 3.32 mg of vitamin B12, 28.00 mg of vitamin B2, 22.63 mg of vitamin B6, 137.13 mg of vitamin B12, and 181.01 mg of nicotinic acid per kilogram of starter feed. Digestible energy is a calculated value, while the others are measured values.

[0149] 3. Feeding Management and Sample Collection

[0150] Lambs were given starter feed daily, leaving a small amount of feed in the troughs for free access for 30 days. During the experiment, standard feeding and management practices were followed. On the last day of the experiment, three lambs were randomly selected from each replicate. 10 mL of blood was collected from the jugular vein using a blood collection tube, allowed to stand at an angle for 20 minutes, and then centrifuged at 3500 rpm for 10 minutes. The serum was aliquoted into 1.5 mL centrifuge tubes and stored at -20°C for analysis. Fresh feces were randomly collected from each replicate and stored in sterile centrifuge tubes, transported on dry ice until DNA extraction.

[0151] 4. Determination of growth performance indicators in lambs

[0152] On the mornings of the first and last days of the experiment, lambs were weighed on an empty stomach in replicates. The initial and final weights of the lambs were recorded, and the average daily weight gain was calculated. The weight of the starter feed was weighed daily, and the average daily feed intake was calculated.

[0153] The effects of adding probiotic preparations to feed on the growth performance of lambs are shown in Table 8. The final weight, average daily weight gain, and average daily feed intake of lambs in the probiotic-added experimental group were significantly higher than those in the control group. However, there were no significant differences in the final weight, average daily weight gain, average daily feed intake, and average daily feed intake of lambs in experimental group 1 and experimental group 2.

[0154] Table 8 Effects of probiotic preparations on lamb growth performance

[0155]

[0156] Note: Different letters in the same row indicate significant differences (P<0.05), while the presence or absence of the same letter indicates no significant differences (P>0.05).

[0157] 5. Determination of antioxidant indicators in lamb serum

[0158] The activities of glutathione peroxidase, catalase, and superoxide dismutase in serum, as well as the total antioxidant capacity and malondialdehyde concentration, were determined using a kit, and the procedure was performed according to the kit instructions.

[0159] The effects of probiotic preparations on the antioxidant capacity of lamb serum are shown in Table 9. Compared with the control group, the antioxidant capacity of lamb serum in the probiotic preparation groups was significantly improved, indicating that probiotic preparations have a positive effect on the body's antioxidant capacity. The levels of glutathione peroxidase and superoxide dismutase in experimental group 2 were significantly higher than those in experimental group 1, while malondialdehyde (MDA) was significantly lower in experimental group 2. This indicates that experimental group 2 better improved the antioxidant capacity of lambs. Improved antioxidant capacity in animals plays a crucial role in reducing stress and disease incidence, and has a positive impact on animal antioxidant performance.

[0160] surface Effects of probiotic preparations on antioxidant indices in lamb serum

[0161]

[0162] Note: Different letters in the same row indicate significant differences (P<0.05), while the presence or absence of the same letter indicates no significant differences (P>0.05).

[0163] 6. Determination of Lamb Meat Quality

[0164] The determination method is the same as that used for chicken products in Example 4 above.

[0165] The effects of adding different probiotic agents on lamb meat quality are shown in Table 10. Except for the shear force of the probiotic agent group being significantly lower than that of the CK group, there were no significant differences in the other indicators, indicating that the addition of probiotics improved the meat quality of lamb to a certain extent. Among them, all indicators of experimental group 2 were better than those of experimental group 1, but there was no significant difference in the indicators.

[0166] Table 10 Effects of probiotic preparations on lamb meat quality

[0167]

[0168] Note: Different letters in the same row indicate significant differences (P<0.05), while the presence or absence of the same letter indicates no significant differences (P>0.05).

[0169] 7. Detection of intestinal microbial diversity in lambs

[0170] Fresh fecal samples randomly collected from each experimental group were stored on dry ice and transported until DNA extraction. Total fecal DNA was extracted using a DNA extraction kit (Beijing Tiangen). The DNA was stored in Tris-EDTA buffer solution (TE) and transported on dry ice to Biomarker (Beijing, China) for Illumina Novaseq sequencing. PCR primers were designed using Primer 5.0 software based on the characteristics of the sequencing regions. The primers for the bacterial 16S rRNA V4 region were 515F-907R (515F: 5'-GTGCCAGCMGCCGCGGTAA-3', SEQ ID NO.4; 907R: 5'-CCGTCAATTCMTTTRAGTTT-3', SEQ ID NO.5), and the primers for the fungal ITS rRNA V5 region were ITS1F-ITS2 (ITS1F: 5'-CTTGGTCATTTAGAGGAAGTAA-3', SEQ ID NO.6; ITS2: 5'-GCTGCGTTCTTCATCGATGC-3', SEQ ID NO.7). PCR reaction system (25 μL): 2.5 μL 10 × Ex Taq Buffer, 1 μL dNTPs (2.5 mmol / L), 0.5 μL each of forward and reverse primers (10 μmol / μL), 0.1 mL TaKaRa Ex Taq, add water to 25 μL, mix and centrifuge. Amplification program: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 7 min. The PCR amplification products were purified, quantified, and homogenized to form sequencing libraries. The constructed libraries underwent quality control, and those that passed quality control were sequenced using Illumina Novaseq 6000 paired-end sequencing. The raw sequencing sequences were quality controlled, including low-quality filtering and length filtering, to obtain high-quality sequences.

[0171] (1) Analysis of the diversity of dominant gut bacteria at the genera level

[0172] The effects of adding probiotic agents on the genus-level diversity of gut bacteria in lambs were analyzed using high-throughput sequence detection. Figure 6As shown, the common dominant bacterial genera in the lamb intestines of the three treatment groups were Rummeliibacillus, Rikenellaceae, Ruminococcus, and Lactobacillus. The main intestinal bacteria in experimental group 1 were Ruminobacter spp. (20.87%), Lactobacillus spp. (19.27%), Bifidobacterium spp. (14.03%), uncultured Muribaculaceae (7.24%), and Ruminococcus spp. (5.95%). The main intestinal bacteria in experimental group 2 were Wencanella spp. (24.48%), uncultured Muribaculaceae (12.09%), Eubacterium spp. (8.86%), Bacteroides spp. (6.86%), and Ruminococcus spp. (4.23%). The main CK group was Escherichia coli and Shigella spp. (16.46%), Fusobacterium spp. (10.35%), Ruminococcus spp. (10.34%), Ruminobacterium spp. (9.97%), and Acinetobacter spp. (7.78%).

[0173] In summary, at the genus level, the probiotic agent in experimental group 1 significantly increased the abundance of *Ruminobacter* and *Lactobacillus* (20.87% and 19.27%, respectively), while the probiotic agent in experimental group 2 significantly increased the abundance of *Wenkenella* and uncultured *Muribaculaceae* (24.48% and 12.09%, respectively). In contrast, the dominant bacterial genera in the control group were *Escherichia coli*, *Shigella*, and *Fusobacterium* (16.46% and 10.35%, respectively). Therefore, the addition of different probiotic agents can produce significant differences in the types and abundance of dominant bacteria in the lamb's gut microbiota, and all have a positive impact.

[0174] (2) Analysis of the diversity of dominant gut bacteria species

[0175] Figure 7To analyze the relative abundance of dominant bacteria in the lamb gut at the species level by adding different probiotic agents. The dominant bacterial species in experimental group 1 were uncultured Lactobacillus (20.86%), uncultured Lactobacillus acidophilus (19.21%), uncultured Bifidobacterium (14.03%), uncultured Muribaculaceae (7.23%), and Ruminococcus (5.95%). The dominant bacterial species in experimental group 2 were uncultured Wenkenella (24.48%), uncultured Muribaculaceae (12.09%), uncultured Coprostanoligenes (8.86%), uncultured Bacteroides (6.51%), and uncultured Ruminococcus (4.23%). The dominant bacterial species in the control group were uncultured Escherichia coli (16.46%), uncultured Fusobacterium (10.35%), uncultured Ruminococcus (10.34%), uncultured Ruminobacterium (9.27%), and uncultured Acinetobacter (7.78%). At the species level, the addition of different probiotic preparations produced significant differences in the types and abundance of dominant bacteria in the lamb's gut microbiota, and all probiotic groups were beneficial to the abundance of dominant bacteria in the lamb's gut microbiota.

[0176] (3) Analysis of the diversity of dominant gut fungal genera

[0177] Figure 8 The relative abundance of cecal microorganisms at the genus level of dominant fungi in the lamb gut was determined by adding different probiotic preparations. The common dominant fungi in the gut at the genus level for different probiotic preparations were Aspergillus, Feramyces, Fusarium, Pichia, Neocallimastix, and Enterocarpus. The dominant fungal genera in experimental group 1 were *Pichia pastoris* (10.62%), *Aspergillus* (7.51%), *Enterocarpus* (6.76%), *Feramyces* (5.92%), and *Saccharomyces cerevisiae* (4.43%). In experimental group 2, the dominant genera were *Neopyrocephala* (11.26%), *Aspergillus* (9.52%), *Feramyces* (8.82%), *Penicillium* (2.51%), and *Botrytis* (2.14%). The control group (CK) mainly consisted of *Aspergillus* (12.63%), *Fusarium* (5.49%), *Penicillium* (3.01%), *Penicillium pseudocarpa* (2.85%), and *Purpureocillium* (2.73%). Therefore, at the genus level, the addition of different probiotic agents resulted in differences in the types and abundance of dominant fungi in the lamb's intestinal microbiota, and had a positive effect on improving the lamb's intestinal fungal flora.

[0178] (4) Analysis of the diversity of dominant gut fungi species

[0179] Figure 9 To investigate the relative abundance of dominant intestinal fungi at the species level in lambs when different probiotic preparations are added. The dominant fungi in experimental group 1 were Pichia pastoris (10.62%), Enterocarpus grenotii (6.76%), Feramyces austinii (5.92%), Aspergillus flavus (5.55%), and Saccharomyces cerevisiae (4.43%) at the species level; the dominant fungi in experimental group 2 were Neocallimastix californiae (11.26%), Feramyces austinii (8.82%), Aspergillus flavus (6.43%), Botryotrichum domesticum (2.23%), and Enterocarpus grenotii (2.04%); the dominant fungi in the control group were Aspergillus flavus (9.61%), Paecilomyces penicillatus (2.83%), Lithocarpus lilacinus (2.71%), Botryotrichum domesticum (2.07%), and Fusarium oxysporum (1.70%). At the species level, the addition of different probiotic agents has a significant effect on the species and abundance of dominant fungi in the lamb's gut microbiota. All probiotic groups are beneficial to the abundance of dominant fungi in the lamb's gut microbiota.

[0180] In summary, the *Saccharomyces cerevisiae* YSJ-21 screened in this invention exhibits excellent resistance to acid, bile salts, and artificial gastrointestinal fluids, as well as good drug resistance and antioxidant properties. It was deposited on September 11, 2020, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No: 20630. Two powdered probiotic agents were developed by progressively expanding the mixture of *Saccharomyces cerevisiae* YSJ-21 with purchased *Bacillus licheniformis* B289 and *Lactobacillus casei* Ssd3: Experimental Group 1 consisted of a 1:1 volume ratio of *Bacillus licheniformis* B289 and *Lactobacillus casei* Ssd3; Experimental Group 2 consisted of a 1:1:1 volume ratio of *Saccharomyces cerevisiae* YSJ-21, *Bacillus licheniformis* B289, and *Lactobacillus casei* Ssd3. The effective viable count of both groups was 1.5 × 10⁻⁶. 9 CFU / mL.

[0181] Animal feeding trials revealed that, in the feeding and growth of broiler chickens and lambs, the addition of two probiotic agents showed that, in terms of growth performance, serum antioxidant index, dressing percentage, and meat quality, experimental group 2 was generally better than experimental group 1. Furthermore, in the diversity analysis of dominant bacteria and fungi in the intestinal microbiota, the two probiotic agents exhibited different probiotic effects. Specifically, the addition of the brewer's yeast YSJ-21 from this invention significantly improved some growth performance characteristics of broiler chickens and lambs, demonstrating a positive effect on the growth of livestock and poultry.

[0182] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A strain of Saccharomyces cerevisiae, characterized in that, The preservation number of the Saccharomyces cerevisiae is CGMCC No. 20630.

2. Use of the Saccharomyces cerevisiae of claim 1 in the preparation of an antioxidant bacterial agent.

3. An antioxidant bacterial agent, characterized in that, The Saccharomyces cerevisiae of claim 1.

4. A probiotic composition, characterized in that, The Saccharomyces cerevisiae of claim 1, Bacillus licheniformis B289 and S. casei Ssd3.

5. The probiotic composition as claimed in claim 4, wherein, The Saccharomyces cerevisiae, Bacillus licheniformis B289 and S. casei Ssd3 are compounded in the form of bacterial powder, and the mass ratio is 1:1:

1. The preservation number of the Bacillus licheniformis B289 is CICC 20514, and the preservation number of the S. casei Ssd3 is CICC 20290.

6. Use of the probiotic composition of any one of claims 4-5 in any one of: (1) the preparation of a probiotic bacterial agent or feed for improving the antioxidant performance of animals; (2) the preparation of a probiotic bacterial agent or feed for improving the growth performance of animals; (3) the preparation of a probiotic bacterial agent or feed for improving the meat quality of animals; (4) the preparation of a probiotic bacterial agent or feed for improving the slaughter performance of animals; (5) the preparation of a probiotic bacterial agent or feed for improving the intestinal flora of animals.

7. Use according to claim 6, wherein The animals include chickens and sheep.

8. A probiotic bacterial agent, characterized in that, The probiotic composition of claim 4.

9. A feed, characterized in that, The probiotic bacterial agent of claim 8 and the basic feed, and the addition amount of the probiotic bacterial agent in the basic feed is 0.5%-1.0% w / w.

10. A method for improving the antioxidant performance, growth performance, meat quality and / or slaughter performance of an animal, characterized in that, The step of feeding the animals with the feed of claim 9, wherein the animals include chickens and sheep.

Citation Information

Patent Citations

  • Saccharomyces cerevisiae, yeast preparation including the same, feed, and preparation and use thereof

    CN101463329A

  • Preparation method for fermented feed for corn-bean pulp type daily ration

    CN102018098A

  • Preparation method of multifunctional live microorganism preparation for forage

    CN102860408A

  • Mixed fermentation feed and preparation method and application method of mixed fermentation feed

    CN103039699A

  • Yeast for high-activity feed, and its application

    CN103074240A