Yarrowia lipolytica engineering bacterium for synthesizing beta-farnesene based on Snf1-mediated metabolic remodeling and application of Yarrowia lipolytica engineering bacterium
By introducing the β-farnesene synthesis pathway and non-oxidative glycolysis pathway into Yersinia lipolytica, blocking the glycolysis pathway, and utilizing Snf1-mediated metabolic remodeling and glucose-oleic acid co-culture, a high-yield β-farnesene-producing yeast strain was constructed. This solved the problems of high cost and environmental pollution in traditional methods, and realized the efficient synthesis and industrial application of β-farnesene.
Patent Information
- Application Number
- CN202511829202.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-03-17
AI Technical Summary
Traditional methods for producing β-farnesene are costly and cause serious environmental pollution. Existing metabolic engineering strategies have failed to effectively overcome the limitations of yeast metabolic regulation, resulting in the diversion of carbon flow in terpene synthesis to byproducts.
By introducing the β-farnesene synthesis pathway and the non-oxidative glycolysis pathway to block the glycolysis pathway, and by utilizing Snf1-mediated metabolic remodeling to activate Snf1 kinase, combined with a glucose-oleic acid co-culture fermentation process, a high-yield β-farnesene-producing Yersinia lipolytica engineered strain was constructed.
The strain achieved efficient synthesis of β-farnesene with a yield of 82.1 g/L, significantly enhancing its ability to utilize lipid carbon sources and demonstrating promising prospects for industrial application.
Smart Images

Figure CN121674245A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial and fermentation engineering technology, specifically relating to a Snf1-mediated metabolic remodeling of Yersinia lipophila engineered strain for synthesizing β-farnesene and its application. Background Technology
[0002] The information disclosed in the background section of this invention is intended only to enhance the understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] β-Farnese (C 15 H 24 β-Farnese is a non-cyclic sesquiterpene produced by plants and has been widely used in agricultural and industrial production, including pesticides, lubricants, surfactants, cosmetics, and biofuels. β-Farnese is also a precursor for the synthesis of many products, such as vitamin E and squalene. Traditional production methods, such as natural extraction, are costly due to low plant content and limited raw materials, while chemical synthesis faces problems such as complex equipment, high energy consumption, and environmental pollution. Microbial synthesis based on synthetic biology and metabolic engineering has emerged as a breakthrough approach.
[0004] Yeast *Yarrowia lipolytica* exhibits significant advantages in terpene synthesis due to its high acetyl-CoA metabolic flux, multi-substrate utilization, and mature gene editing system. However, the overproduction of terpenes is often limited by its inherent metabolic regulation, with excess carbon flux being diverted to the synthesis of byproducts such as citric acid, lipids, or sugar alcohols. Current metabolic engineering strategies primarily focus on enhancing terpene biosynthetic pathways without disrupting the cell's inherent metabolic characteristics, which restricts the directionality of carbon flux towards target products. Therefore, there is an urgent need to reshape its global metabolism to alter the inherent characteristics of yeast metabolism. Summary of the Invention
[0005] The purpose of this invention is to provide an engineered *Yersinia lipolytica* strain that synthesizes β-farnesene based on Snf1-mediated metabolic remodeling and its applications. Specifically, this invention constructs a high-yield β-farnesene-producing yeast engineered strain through Snf1-mediated metabolic remodeling. *Yersinia lipolytica* (… Yarrowia lipolytica Po1f was the starting strain. Evolutionary pressure was applied by first introducing the β-farnesene synthesis pathway and the non-oxidative glycolysis (NOG) pathway, and by knocking out phosphofructokinase (pfk1) to block the glycolysis pathway, thereby forcing the strain to reshape its metabolic network. GLK1 and REG1The inactivation of β-farnesene leads to the sustained activation of Snf1 kinase, thereby driving global metabolic remodeling, effectively alleviating the rigid limitations of yeast metabolic regulation and significantly enhancing its ability to utilize lipid carbon sources. Through further metabolic engineering and optimization of the glucose-oleic acid co-culture fermentation process, the efficient synthesis of β-farnesene was achieved. Based on the above research results, this invention is thus completed.
[0006] Specifically, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a *Yersinia lipolytica* engineered strain that synthesizes β-farnesene based on Snf1-mediated metabolic remodeling. Specifically, the engineered *Yersinia lipolytica* strain is a *Yersinia lipolytica* strain that reconstructs the central carbon metabolism of *Yersinia lipolytica* by introducing a β-farnesene synthesis pathway and a non-oxidative glycolysis pathway, and by blocking the traditional glycolysis pathway. The introduced β-farnesene synthesis pathway includes overexpression of acetyl-CoA acetyltransferase / HMG-CoA reductase and HMG-CoA synthase, mevalonate kinase, and fusion expression of β-farnesene synthase and endogenous farnesyl pyrophosphate synthase. The introduced non-oxidative glycolysis pathway includes the introduction of phosphatidylcholinesterase and phosphotransacetase. The blocking of the traditional glycolysis pathway includes knockout of phosphofructokinase.
[0007] The starting strain is Yersinia lipophila Po1f; The acetyl-CoA acetyltransferase / HMG-CoA reductase is derived from Enterococcus faecalis .
[0008] The HMG-CoA synthase is an HMG-CoA synthase mutant (EfmvaS) A110G ), which also originated from Enterococcus faecalis .
[0009] The mevalonate kinase is derived from Methanosarcina mazei .
[0010] The β-farnesene synthase is the β-farnesene synthase mutant AanFS. K197T / F180H Its origin Artemisia annua ; The phosphatosterolase comes from Clostridium acetobutylicum The phosphotransacetase is derived from Thermoanaerobacterium saccharolyticum .
[0011] Furthermore, the engineered *Yarrowia lipolytica* strain also includes its endogenous... REG1 and GLK1 The mutation further enhances endogenous REG1 and GLK1 Inactivation; GLK1 It encodes glucokinase, which catalyzes the phosphorylation of glucose. REG1It is a regulatory subunit of the type I protein phosphatase Glc7p, involved in the regulation of the glucose repression pathway. In yeast, the Reg1-Glc7 complex, through negative regulation of Snf1 kinase activity, co-mediates the glucose repression effect with Mig1. Endogenous in *Yarrowia lipolytica*. REG1 and GLK1 The combined inactivation of Snf1 kinase leads to sustained activation, thereby driving global metabolic remodeling and increasing the synthesis of β-farnesene.
[0012] Furthermore, the engineered *Yarrowia lipolytica* strain also includes overexpression of farnesyl pyrophosphate synthase fused with β-farnesene synthase (ERG20AanFS). K197T / F180H Any one or more of the following: mevalonate kinase (MmMK), mevalonate pyrophosphate decarboxylase (ERG8), isopentenyl pyrophosphate isomerase (ERG19), phosphatidyl alcoholase (xPK), phosphoryltransacetase (PTA), and ATP citrate lyase (ACL1).
[0013] Furthermore, the engineered *Yarrowia lipophila* strain also includes endogenous genes. LEU2 Overexpression and knockout of acetyl-CoA synthase (ACS) can further increase the yield of β-farnesene.
[0014] In this invention, gene knockout and mutation (inactivation) of targeted chromosomes can be achieved through CRISPR-Cas9-mediated gene editing, without any specific limitations.
[0015] In a second aspect, the present invention provides the application of the above-described engineered Yersinia lipolytica strain in the synthesis of β-farnesene.
[0016] A third aspect of the present invention provides a method for the industrial production of β-farnesene, the method comprising: fermenting and culturing the above-mentioned engineered Yersinia lipolyticis, and separating and purifying β-farnesene.
[0017] Furthermore, during the fermentation process, glucose and oleic acid were added as carbon sources, and a glucose-oleic acid co-culture fermentation process was established to achieve the efficient synthesis of β-farnesene.
[0018] The initial concentrations of glucose and oleic acid were 5-50 g / L, further reduced to 20 g / L. Fermentation conditions were controlled at 30°C, pH 6.0, aeration rate of 1.0 vvm, and stirring speed of 700 rpm.
[0019] When the glucose in the fermentation medium is almost depleted, glucose is replenished, and oleic acid is added every 24 hours.
[0020] A fourth aspect of the present invention provides the use of the above-described engineered *Yarrowia lipolyticis* strain and / or the above-described method for the industrial production of β-farnesene in any one or more of the following: (a) Chemical industry; (b) Medicine; (c) Biofuels; (d) Agriculture.
[0021] The beneficial technical effects of one or more of the above technical solutions are as follows: The above-mentioned technical solution, through a Snf1-mediated global metabolic remodeling strategy, effectively alleviates the rigid limitations of metabolic regulation in *Yersinia lipolytica*, significantly enhancing the strain's utilization of lipid carbon sources and providing a favorable metabolic environment for the efficient synthesis of terpenoids. A high-yield *Yersinia lipolytica* engineered strain was successfully constructed. After 14 days of fed-batch fermentation in a 5 L bioreactor, the final yield of β-farnesene reached 82.1 g / L, the highest yield reported to date in *Yersinia lipolytica*, demonstrating promising prospects for industrial application. The glucose-oleic acid co-culture fermentation process established by the above-mentioned technical solution fully leverages the metabolic advantages of the engineered strain, achieving efficient utilization of carbon sources.
[0022] In summary, the metabolic remodeling strategies and engineered strain construction methods provided by the above technical solutions are not only applicable to the synthesis of β-farnesene, but also provide key engineering strategies and mechanistic insights for the microbial synthesis of other high-value terpenoids, and have broad application value. Attached Figure Description
[0023] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0024] Figure 1 The yield of β-farnesene in the engineered strain after initial introduction of the β-farnesene synthesis pathway in YPD medium shake flask culture for 96 hours in this embodiment of the invention.
[0025] Figure 2 In this embodiment of the invention, the strain EAVKΔpfk was cultured in YPD medium for 96 hours in shake flasks, and phosphatidylcholinesterase (xPK) and phosphoryltransferase (PTA) were introduced into the strain to affect the final OD. 600 The effects of glucose consumption and β-farnesene synthesis.
[0026] Figure 3 In this embodiment of the invention, the culture was carried out in YPD medium for 96 hours in shake flasks. REG1 and GLK1Growth and metabolism of the combined deletion strain ALE-XP-2. (A) Maximum specific growth rate of strains EAVK, EAVKΔpfk-XP, and ALE-XP-2. (B) β-method mud yield of strains EAVK, EAVKΔpfk-XP, and ALE-XP-2. (C) Glucose yield of β-method mud in strains EAVK, EAVKΔpfk-XP, and ALE-XP-2. (D) Citric acid accumulation of strains EAVK, EAVKΔpfk-XP, and ALE-XP-2.
[0027] Figure 4 The yield of β-farnesene after metabolic modification of strain ALE-XP-2 was measured in YPD medium after 96 hours of shake-flask culture in this embodiment of the invention.
[0028] Figure 5 To illustrate how the synergistic utilization of glucose and oleic acid enhances the production of β-farnesene in this embodiment of the invention. (A) Batch fermentation curve of strain EP2-9 under synergistic utilization of glucose and oleic acid. (B) Consumption of glucose and oleic acid after 14 days of culture. Detailed Implementation
[0029] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0030] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0031] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the materials, reagents, instruments, and methods used in the following examples are all conventional materials, reagents, instruments, and methods in the art and are commercially available.
[0032] Example 1 I. Materials and Methods 1. Unless otherwise specified, the experimental methods used in the following examples, including plasmid construction, enzyme digestion, preparation of competent cells, and transformation, are all conventional methods. Specific experimental conditions can be determined through simple experiments if necessary.
[0033] 2. Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0034] 3. The main endogenous genes of *Yarrowia lipolytica* involved in this invention PFK1 ( YALI1_D20222g ), GLK1 ( YALI1_E18539g ), REG1 ( YALI1_B21855g ), ERG20 (Y ALI1_E06759g ), ERG8 ( YALI1_E07506g ), ERG19 (YALI1_F08363g), IDI ( YALI1_ F06018g ), ACL1 ( YALI1_E413,15g ), ACS ( YALI1_F08845g ), LEU2 ( YALI1_C00464g ). 4. The heterologous gene involved in this invention, wherein... Clostridium acetobutylicum Sources of phosphatosterolase (xPK) and Thermoanaerobacterium saccharolyticum Phosphotransacetase (PTA) of the source. Enterococcus faecalis Acetyl-CoA acetyltransferase / HMG-CoA reductase (EfmvaE) and HMG-CoA synthase (EfmvaS) from [sources] A110G ), Methanosarcina mazei Mevalonate kinase (MmMK) from this source, and Artemisia annua AanFS, a β-farnesene synthase mutant derived from [source] K197T / F180H All codons were optimized based on the codon usage preferences of Yersinia lipophila, and the work was completed by General Biotechnology (Anhui) Co., Ltd.
[0035] The sequence is as follows: xPK: PTA: ATGTCCATCATCCAGAACATCATCGAGAAGGCCAAGTCTGACAAGAAGAAGATCGTTCTGCCCGAGGGCGCTGAGCCCCGAACTCTGAAGGCCGCCGAGATCGTGCTGAAGGAAGGCATTGCCGACCTGGTGCTGCTGGGCAACGAGGACGAGATCCGAAACGCCGCCAAGGACCTGGACATCTCTAAGGCCGAGATCATCGACCCCGTGAAGTCTGAGATGTTCGACCGATACGCCAACGACTTCTACGAGCTGCGAAAGAACAAGGGCATCACCCTGGAAAAGGCCCGAGAGACTATCAAGGACAACATCTACTTCGGCTGCATGATGGTCAAGGAAGGCTACGCCGACGGCCTGGTGTCTGGCGCCATCCACGCCACCGCCGACCTGCTGCGACCCGCCTTCCAGATCATCAAGACTGCCCCTGGCGCCAAGATCGTGTCCTCGTTCTTCATCATGGAAGTGCCCAACTGCGAGTACGGCGAGAACGGCGTGTTCCTGTTCGCCGACTGCGCTGTGAACCCCTCGCCTAACGCCGAGGAACTGGCCTCTATCGCCGTGCAGTCTGCCAACACCGCTAAGAACCTGCTGGGCTTCGAGCCCAAGGTGGCCATGCTGTCTTTCTCGACCAAGGGCTCTGCCTCTCACGAGCTGGTGGACAAGGTGCGAAAGGCTACCGAGATCGCCAAGGAACTGATGCCCGACGTGGCCATCGACGGCGAACTGCAGCTGGACGCCGCTCTGGTGAAGGAAGTGGCCGAGCTGAAGGCTCCCGGCTCTAAGGTGGCCGGCTGCGCCAACGTGCTGATCTTCCCCGACCTGCAGGCCGGCAACATCGGCTACAAGCTGGTGCAGCGACTGGCCAAGGCCAACGCCATCGGACCCATCACTCAAGGCATGGGCGCTCCCGTGAACGACCTGTCTCGAGGCTGCTCTTACCGAGACATCGTGGACGTGATCGCCACCACCGCTGTGCAGGCCCAGTAA(SEQ ID NO.2)。 EfmvaE: EfmvaS A110G : MmMK: ATGGTCTCCTGCTCTGCTCCTGGAAAGATCTACCTGTTCGGAGAGCACGCCGTTGTCTACGGCGAGACTGCCATCGCCTGTGCCGTGGAGCTGCGAACGAGAGTGCGAGCTGAGCTCAATGACAGTATCACAATTCAGTCGCAGATTGGTCGGACGGGCCTCGACTTTGAGAAGCACCCCTACGTTTCCGCAGTCATTGAGAAGATGCGAAAGAGCATTCCCATCAACGGCGTATTCCTCACAGTGGACTCTGACATTCCTGTTGGCTCTGGTCTGGGATCATCTGCTGCTGTTACAATTGCTTCCATTGGAGCTCTAAACGAGCTGTTTGGCTTCGGGCTGTCTCTGCAGGAGATTGCCAAGCTGGGCCATGAAATCGAGATCAAGGTCCAGGGGGCAGCATCGCCAACCGACACCTATGTGTCCACCTTCGGTGGAGTGGTAACGATCCCCGAGCGACGAAAACTCAAGACTCCTGACTGTGGTATTGTCATCGGCGATACCGGCGTGTTCTCGTCCACTAAGGAGCTTGTTGCCAACGTTAGACAACTGCGCGAATCCTACCCCGATCTCATAGAACCGCTCATGACCTCTATTGGCAAGATTTCACGAATCGGAGAACAGTTGGTCCTATCGGGAGACTACGCCTCTATTGGCCGGCTTATGAACGTGAATCAAGGTCTGCTCGATGCTCTTGGGGTCAACATTCTGGAGTTGAGCCAGCTCATCTATTCTGCCCGTGCTGCCGGCGCGTTTGGAGCCAAAATCACTGGCGCTGGAGGAGGCGGCTGCATGGTGGCGTTGACTGCCCCTGAAAAGTGCAACCAGGTGGCCGAGGCCGTGGCTGGTGCAGGAGGTAAGGTGACCATCACCAAGCCCACCGAGCAGGGTCTTAAAGTTGATGGAAGCTGA(SEQ ID NO.5) AanFS K197T / F180H : 5. The main *Yarrowia lipophila* strain involved in this invention Yarrowia lipolytica Po1f ( MatA , Leu2-270 , URA3-302 , xpr2-322 , axp-2 ); EAVK (Expression of ERG20mAanFS , EfMvaE , EfMvaS A110G , MmMK in Po1f); EAVK pfk (EAVK with PFK1 knockout); EAVK pfk-XP (Expression of xPK and PTA in EAVK pfk); ALE-XP-2 (EAVK pfk-XP with GLK1 and REG1 null mutations). EP2-9 (Expression of ERG20 , mAanFS , IDI , MmMK , ERG8 , ERG19 , xPK , PTA , ACL1 , LEU2 , and ACS Knockout in ALE-XP-2). 6. CRISPR-Cas9-mediated gene editing was used to achieve targeted gene knockout and mutation on chromosomes. First, an expression cassette was constructed using helper plasmids, then digested with restriction endonucleases to obtain a linearized integrated fragment. This fragment was then transformed into competent *Yarrowia lipolytica* cells using lithium acetate conversion. The fragment randomly integrated into the genome via *Yarrowia lipolytica*'s endogenous non-homologous end joining (NHEJ) repair mechanism. Positive clones were screened by plating on selective media and further confirmed by colony PCR.
[0036] 7. Culture media used for culturing *Yersinia lipolytica* include: YPD culture, SD or YNB basal medium (with the appropriate amino acid mixture added as needed), and yeast extract peptone glucose-oleic acid (YPDO) medium. Single colonies of *Yersinia lipolytica* were inoculated into 3 mL of liquid medium and cultured at 30°C and 220 rpm for 24 hours. Subsequently, 2% (v / v) of the culture was transferred to a 300 mL shake flask containing 50 mL of fresh liquid medium and cultured under the same temperature and stirring conditions. Samples were collected every 24 hours for subsequent physiological and metabolic parameter analysis. For *Escherichia coli* DH5α strain, LB medium containing 50 mg / L ampicillin was used for overnight culture on a shaker at 37°C and 220 rpm for routine plasmid construction.
[0037] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride.
[0038] LB solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 2% agar powder.
[0039] YPD liquid medium: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose.
[0040] YPD solid medium: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, 2% agar powder.
[0041] SD liquid selective medium: 26.7 g / L SD basal medium, with an appropriate concentration of amino acid-deficient mixture added, and pH adjusted to 6.0.
[0042] SD solid selective medium: SD liquid selective medium with 2% agar powder added.
[0043] YNB liquid medium: 1.7 g / L yeast nitrogen, 5 g / L ammonium sulfate, with amino acid mixtures selectively added according to the nutritional deficiencies of the strains, and carbon sources such as glucose added as needed.
[0044] YNB solid selective medium: YNB liquid medium with 2% agar powder added.
[0045] YPDO liquid medium: 10 g / L yeast extract, 20 g / L peptone, 10 g / L glucose, 10 g / L oleic acid.
[0046] 8. Production of β-farnesene by shake-flask fermentation The strain was pre-cultured in 3 mL YPD medium and incubated in a shaker at 30°C and 220 rpm for 24 hours. A 2% (v / v) inoculum was transferred to a 300 mL shake flask containing 50 mL YPD medium and incubated at 30°C and 220 rpm for 96 hours. Samples were collected for OD analysis. 600 Glucose consumption, byproduct accumulation, and β-farnesene production.
[0047] β-Farnesene Production via Feed-in Fermentation in a 9.5 L Fermenter Fed-batch fermentation was conducted in a 5 L bioreactor. The seed culture procedure was as follows: the strain was inoculated into a 50 mL shake flask containing 15 mL of YPD medium and cultured with shaking at 30°C and 220 rpm for 24 hours. The entire culture was then transferred to a 1000 mL shake flask containing 300 mL of YPD medium and cultured under the same conditions for another 24 hours. Finally, all the culture was inoculated into a bioreactor containing 12.5% dodecane for fed-batch fermentation. Glucose and oleic acid were added as carbon sources, and fermentation conditions were controlled at 30°C, pH 6, aeration rate of 1.0 vvm, and stirring speed of 700 rpm. When the glucose in the fermentation medium was almost depleted, glucose was fed in, and oleic acid was added every 24 hours.
[0048] 10. Biomass Detection Biomass was determined by measuring absorbance at 600 nm using a UV-1800 ultraviolet spectrophotometer.
[0049] 11. HPLC detection of compounds Glucose consumption and the generation of metabolites (such as citric acid) were analyzed by high-performance liquid chromatography (HPLC) using an Aminex HPX-87H column (BioRad) and a differential detector. The mobile phase was 5 mM H₂SO₄, the flow rate was 0.6 mL / min, and the column oven temperature was maintained at 65°C.
[0050] 12. GC detection of β-farnesene β-Farnesne was captured in dodecane and analyzed by gas chromatography (GC). The detection method was configured as follows: the syringe and detector temperatures were set to 280°C and 290°C, respectively. The column oven temperature was initially held at 80°C for 1 minute, then increased to 250°C at a rate of 10°C per minute and held for 1 minute, followed by a further increase to 280°C at a rate of 10°C per minute and a final hold for 10 minutes. The split ratio was set to 50:1.
[0051] II. Experimental Results 1. First, we introduced the β-farnesene synthesis pathway into *Yersinia lipolytica* by fusion expression of the β-farnesene synthase mutant (AanFS). K197T / F180H The engineered strain EA produced 0.124 g / L of β-farnesene by combining it with farnesyl pyrophosphate synthase (ERG20). Subsequently, a novel enzyme was introduced from... Enterococcus faecalis Acetyl-CoA acetyltransferase / HMG-CoA reductase (EfmvaE) and HMG-CoA synthase mutant (EfmvaS) A110G This resulted in a 263% increase in β-farnesene production in strain EAV, reaching 0.45 g / L. To further optimize the pathway, [the following was observed]: Methanosarcina mazei The β-farnesene yield of the final strain EAVK reached 0.55 g / L from the mevalonate kinase (MmMK) source.
[0052] 2. To direct carbon flow to acetyl-CoA, we deleted endogenous phosphofructokinase (pfk1). Disruption of the glycolysis pathway prevented the strain from growing in glucose basal medium (YNB) and severely inhibited its growth in glucose-rich medium (YPD). Subsequently, we expressed acetyl-CoA from the EAVKΔpfk strain. Clostridium acetobutylicum Phosphoketolase (xPK) and from Thermoanaerobacterium saccharolyticum The phosphotransacetase (PTA) was detected. However, the growth of the strain only recovered slightly.
[0053] 3. REG1 and GLK1 The maximum specific growth rate of the combined deletion strain ALE-XP-2 in YPD medium was 0.160 h⁻¹. - ¹, significantly higher than strain EAVK pfk-XP (0.095 h) - ¹), but slightly lower than the pfk1 non-knockout strain EAVK (0.189 h). - ¹)( Figure 3 A); the yield of β-farnesene was 53% higher than that of strain EAVK, reaching 0.83 g / L ( Figure 3 B); glucose consumption was reduced by 23% compared to strain EAVK, while the yield of β-farnesene increased by 106%, reaching 0.033 g / g glucose ( Figure 3 C); the accumulation of the byproduct citric acid was also significantly reduced ( Figure 3 D).
[0054] 4. By overexpressing farnesyl pyrophosphate synthase fused with β-farnesene synthase (ERG20AanFS) K197T / F180HKey enzyme genes, including mevalonate kinase (MmMK), mevalonate pyrophosphate decarboxylase (ERG8), isopentenyl pyrophosphate isomerase (ERG19), phosphatidylketolase (xPK), phosphotransacetase (PTA), and ATP citrate lyase (ACL1), were systematically enhanced to strengthen the mevalonate pathway precursor supply and β-farnesene synthesis module. This resulted in strain EP2-7 achieving a β-farnesene yield of 2.11 g / L after 96 hours of shake-flask fermentation, a 159% increase compared to strain ALE-XP-2. Furthermore, overexpression... LEU2 Increased biomass accumulation led to a β-farnesene yield of 3.0 g / L for strain EP2-8, a 44% increase compared to EP2-7. When acetyl-CoA synthase (ACS) was removed, the β-farnesene yield of strain EP2-9 reached 3.6 g / L, a 20% increase compared to strain EP2-8.
[0055] 5. Fed-batch fermentation of engineered strain EP2-9 was conducted in a 5 L fermenter to evaluate its β-farnesene production capacity. In the batch fermentation, the initial concentrations of glucose and oleic acid were both approximately 20 g / L. Fermentation conditions were controlled at 30°C, pH 6.0, aeration rate of 1.0 vvm, and stirring speed of 700 rpm. When the glucose in the fermentation medium was almost depleted, glucose was fed back in, while oleic acid was added every 24 hours. After 14 days of fermentation, a total of 249 g / L of glucose and 135 g / L of oleic acid were consumed. The final yield of β-farnesene reached 82.1 g / L, which is the highest yield reported to date in *Yarrowia lipolytica*.
[0056] Matters not covered in this invention are common knowledge.
[0057] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Yarrowia lipolytica engineering bacteria based on Snfl mediated metabolic remodeling to synthesize β-farnesene, characterized in that, The Yarrowia lipolytica engineering strain is specifically Yarrowia lipolytica as a starting strain, and the central carbon metabolism of Yarrowia lipolytica is restructured by introducing a β-farnesene synthesis pathway and a non-oxidative glycolysis pathway, and blocking a traditional glycolysis pathway; wherein the introduction of the β-farnesene synthesis pathway comprises overexpression of acetyl-CoA acetyltransferase / HMG-CoA reductase and HMG-CoA synthase, methylmalonyl kinase, and fusion expression of β-farnesene synthase and endogenous farnesyl pyrophosphate synthase; the introduction of the non-oxidative glycolysis pathway comprises introduction of phosphoketolase and transacetylase; and the blocking of the traditional glycolysis pathway comprises knocking out phosphofructokinase.
2. The engineered Yarrowia lipolytica strain of claim 1, wherein, The starting strain is Yarrowia lipolytica Po1f.
3. The engineered Yarrowia lipolytica strain of claim 1, wherein, The acetyl-CoA acetyltransferase / HMG-CoA reductase is derived from Enterococcus faecalis ; The HMG-CoA synthase is a HMG-CoA synthase mutant (EfmvaS A110G ), which is derived from Enterococcus faecalis ; The mevalonate kinase is derived from Methanosarcina mazei ; The beta-farnesene synthase is beta-farnesene synthase mutant AanFS K197T / F180H derived from Artemisia annua ; The phosphoketolase is derived from Clostridium acetobutylicum The transacetylase is derived from Thermoanaerobacterium saccharolyticum .
4. The engineered Yarrowia lipolytica strain of claim 1, wherein, The Yarrowia lipolytica engineered bacteria also include mutations in their endogenous REG1 and GLK1 , and further mutations inactivating endogenous REG1 and GLK1 .
5. The engineered Yarrowia lipolytica strain of claim 1, wherein the Yarrowia lipolytica strain is Yarrowia lipolytica strain Yl 187. The Yarrowia lipolytica engineered bacteria also include overexpression of any one or more of farnesyl pyrophosphate synthase fused to beta-farnesene synthase (ERG20AanFS K197T / F180H ), mevalonate kinase (MmMK), pyrophosphomevalonate decarboxylase (ERG8), isopentenyl pyrophosphate isomerase (ERG19), phosphoketolase (xPK), phosphotransacetylase (PTA), and ATP citrate lyase (ACL1).
6. The engineered Yarrowia lipolytica strain of claim 1, wherein, The Yarrowia lipolytica engineered bacteria also include LEU2 overexpression of the genes of the mevalonate pathway and knockout of acetyl-CoA synthase.
7. The Yarrowia lipolytica engineering strain according to any one of claims 1-6 is applied to synthesis of β-farnesene.
8. A method for the industrial production of β-farnesene, characterized by, The method comprises fermenting the Yarrowia lipolytica engineering strain according to any one of claims 1-6, and isolating and purifying to obtain β-farnesene.
9. The method of claim 8, wherein, During the fermentation culture, glucose and oleic acid are added as carbon sources.
10. The Yarrowia lipolytica engineering strain according to any one of claims 1-6 and / or the method for industrial production of β-farnesene according to claim 8 is applied to any one or more of the following: (a) chemical industry; (b) medicine; (c) biofuel; (d) agriculture.