Improved LST broth media and uses

By modifying the LST broth culture medium and adding components such as Rpf recombinant protein, the problem of detecting VBNC-state Escherichia coli was solved, achieving efficient and economical culture and detection of VBNC-state Escherichia coli.

CN121674261AInactive Publication Date: 2026-03-17LUDONG UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610169718.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-03-26
Filing Date
2026-02-06
Publication Date
2026-03-17
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Existing LST broth culture media cannot effectively enrich and culture E. coli in a cultureable but atypical state (VBNC), and PCR amplification technology is cumbersome and costly.

Method used

The modified LST broth medium was prepared by adding Rpf recombinant protein, magnesium sulfate, sodium pyruvate, and pyridoxal phosphate, adjusting the pH to 7.2-7.6, the culture temperature to 36℃-38℃, and the culture time to 18h-24h. The peptidoglycan hydrolase activity of Rpf recombinant protein was used to awaken VBNC state cells, magnesium sulfate provided metal ion support, sodium pyruvate scavenged reactive oxygen free radicals and provided energy, and pyridoxal phosphate regulated the expression of cellular transcription factors.

Benefits of technology

Successfully activating and culturing E. coli in the VBNC state significantly improves detection efficiency, reduces costs, and provides selectivity and stability for E. coli.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention relates to the technical field of microorganisms, and discloses an improved LST broth culture medium and application, and the improved LST broth culture medium comprises tryptone, ammonium chloride, lactose, dipotassium phosphate, monopotassium phosphate, sodium lauryl sulfate, Rpf recombinant protein, magnesium sulfate, sodium pyruvate and pyridoxal phosphate. The improved LST broth culture medium disclosed by the invention can be used for successfully enriching the VBNC-state escherichia coli, so that researchers can successfully detect the VBNC-state escherichia coli in a culture manner.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of microorganisms, in particular to an improved LST broth medium and application. BACKGROUND

[0002] LST broth medium is a commonly used medium, mainly used for microbial culture, especially in food microbial detection, for bacterial growth and separation, the main components of LST broth medium include tryptone, lactose, sodium chloride, sodium lauryl sulfate, etc.

[0003] LST broth medium is commonly used for detecting Escherichia coli or other gram-negative bacteria in food. Escherichia coli is cultured in LST broth medium, and whether there is an acid reaction or gas production is observed to determine whether there is an Escherichia coli group. LST broth medium is particularly suitable for the enrichment culture of Escherichia coli, thereby facilitating the identification of Escherichia coli in food. However, the conventional LST broth medium cannot enrich and culture Escherichia coli in the VBNC state, and cannot detect Escherichia coli from food. U.S. Patent Application US20200340040A1 uses PCR amplification technology to detect microorganisms in the VBNC state, but this technology is tedious and costly. Therefore, there is an urgent need for an LST broth medium that can successfully detect VBNC state Escherichia coli. SUMMARY

[0004] The present application provides an improved LST broth medium and application.

[0005] The technical scheme adopted by the present application is as follows.

[0006] The present application provides an improved LST broth medium, which comprises tryptone, ammonium chloride, lactose, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium lauryl sulfate, Rpf recombinant protein, magnesium sulfate (MgSO4), sodium pyruvate and pyridoxal phosphate, and the mass concentration ratio of the tryptone, ammonium chloride, lactose, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium lauryl sulfate, Rpf recombinant protein, magnesium sulfate, sodium pyruvate and pyridoxal phosphate is (15g / L-25g / L):(4g / L-6g / L):(3g / L-7g / L):(2.5g / L-3g / L):(2.5g / L-3g / L):(0.02g / L-0.04g / L):(0.9μg / L-1.1μg / L):(0.5g / L-0.7g / L):(0.55g / L-3.3g / L):(0.25mg / L-2mg / L). The nucleotide sequence of the Rpf recombinant protein is shown in SEQ ID NO. 1.

[0007] Further, the mass concentration ratio of the tryptone, ammonium chloride, lactose, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium lauryl sulfate, Rpf recombinant protein, magnesium sulfate, sodium pyruvate and pyridoxal phosphate is 20 g / L:5 g / L:5 g / L:2.75 g / L:2.75 g / L:0.03 g / L:1 μg / L:0.6 g / L:2.2 g / L:1 mg / L.

[0008] Further, the pH value of the improved LST broth medium is 7.2-7.6.

[0009] The application further provides application of the improved LST broth medium in culturing Gram-negative bacteria in a VBNC state.

[0010] The application further provides application of the improved LST broth medium in culturing Escherichia coli in a VBNC state.

[0011] Further, the culture temperature is 36-38℃, and the culture time is 18-24h.

[0012] The application has the following technical effects: The Rpf recombinant protein has good peptidoglycan hydrolase activity, can decompose the peptidoglycan of the cell wall of Escherichia coli, and make the cell wall loose, and the degraded peptidoglycan can enter the cell through the loose cell wall, thereby awakening the cells in a VBNC state. The magnesium ion in the magnesium sulfate provides a divalent metal ion for the activity of the Rpf recombinant protein, thereby being conducive to the action of the Rpf recombinant protein on the cells. The sodium pyruvate can not only be used as an active oxygen free radical scavenger to remove the active oxygen free radicals in the cells which are harmful to DNA, but also can be used as an energy material to play an important role in the glycolysis process. After the pyridoxal phosphate is added, the synergistic effect of the Rpf recombinant protein and the sodium pyruvate can be significantly improved, and the cells in a VBNC state can be awakened. DETAILED DESCRIPTION

[0013] In order to make the objects, technical solutions and advantages of the application clearer, the technical solutions of the application will be clearly and completely described below. Obviously, the described embodiments are only some of the embodiments of the application, but not all the embodiments. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the application.

[0014] In a first aspect, the embodiments of the present application provide an improved LST broth medium, the improved LST broth medium comprises tryptone, ammonium chloride, lactose, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium laurylsulfate, Rpf recombinant protein, magnesium sulfate, sodium pyruvate and pyridoxal phosphate, and the mass concentration ratio of the tryptone, the ammonium chloride, the lactose, the dipotassium hydrogen phosphate, the potassium dihydrogen phosphate, the sodium laurylsulfate, the Rpf recombinant protein, the magnesium sulfate, the sodium pyruvate and the pyridoxal phosphate is (15 g / L-25 g / L):(4 g / L-6 g / L):(3 g / L-7 g / L):(2.5 g / L-3 g / L):(2.5 g / L-3 g / L):(0.02 g / L-0.04 g / L):(0.9 μg / L-1.1 μg / L):(0.5 g / L-0.7 g / L):(0.55 g / L-3.3 g / L):(0.25 mg / L-2 mg / L).

[0015] In the embodiments, the nucleotide sequence of the Rpf recombinant protein is shown in SEQ ID NO. 1.

[0016] In the embodiments, the improved LST broth medium further comprises water.

[0017] In the embodiments, the improved LST broth medium comprises tryptone, ammonium chloride, lactose, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium laurylsulfate, Rpf recombinant protein, magnesium sulfate, sodium pyruvate and pyridoxal phosphate, and the mass concentration ratio of the tryptone, the ammonium chloride, the lactose, the dipotassium hydrogen phosphate, the potassium dihydrogen phosphate, the sodium laurylsulfate, the Rpf recombinant protein, the magnesium sulfate, the sodium pyruvate and the pyridoxal phosphate is 20 g / L:5 g / L:5 g / L:2.75 g / L:2.75 g / L:0.03 g / L:1 μg / L:0.6 g / L:2.2 g / L:1 mg / L.

[0018] In the embodiments, the pH value of the improved LST broth medium is 7.2-7.6.

[0019] In a second aspect, the application further provides the use of the improved LST broth medium in culturing gram-negative bacteria in a VBNC state.

[0020] In a third aspect, the application further provides the use of the improved LST broth medium in culturing Escherichia coli in a VBNC state.

[0021] In the embodiments, the culture temperature is 36-38℃, and the culture time is 18-24 hours.

[0022] The following describes the embodiments and comparative examples: Preparation of Escherichia coli in a VBNC state: (1) Escherichia coli ATCC25922 was inoculated in LB medium (purchased) and incubated at 37°C with 180 r / min shaking overnight (14-16 hours) and stored at 2-8°C. Fresh LB medium was inoculated with the bacteria liquid according to the volume ratio of 1:100 (V:V) to expand the culture of Escherichia coli ATCC25922.

[0023] (2) Bacterial content counting: 1 mL of the fresh culture liquid was taken and diluted by 10 times in series with sterile PBS buffer solution (10 mmol, pH=7.2-7.4). 100 μL of the diluted 10 3 times, 10 4 times, 10 5 times and 10 6 times liquid was respectively inoculated on LB agar medium and incubated at 37°C in a biochemical incubator overnight. The next day, the colonies were observed and counted.

[0024] (3) Stress induction: the bacteria were washed twice with sterile PBS buffer solution (10 mmol, pH=7.2-7.4). The bacteria were diluted to 1×10 7 CFU / mL with sterile PBS buffer solution (10 mmol, pH=7.2-7.4), equally divided, centrifuged at 10000 r / min for 10 minutes, and then the supernatant was removed. The bacteria were resuspended with the stress solution equivalent to the original volume for induction treatment. The stress solution was a PBS solution containing 20 μg / L chloramphenicol and 150 g / L NaCl. After uniform resuspension, the bacteria were incubated at 2-8°C in a refrigerator for 24 hours. The number of cultivable bacteria and the total number of viable bacteria were detected.

[0025] (4) Cultivable bacteria number determination: 100 μL of the bacteria liquid was taken and counted according to the method of step (2) above after 24 hours of stress induction to detect the number of cultivable bacteria in the bacteria liquid.

[0026] (5) Total number of viable bacteria determination: 1 mL of the bacteria liquid was taken after 24 hours of stress induction. During the induction process, a large number of bacteria died, therefore, the remaining total number of viable bacteria was detected by staining with a CTC bacterial viability detection kit (Tongren Chemical Research Institute) and using a flow cytometer. The detection result was 5.9±0.95×10 4 cell / mL.

[0027] (6) Cultivable bacteria number: the detection result was 0 CFU / mL by using the plate counting method.

[0028] (7) VBNC state bacteria content was calculated according to the following formula: VBNC state bacteria = total number of viable bacteria - cultivable bacteria number.

[0029] (8) VBNC state E. coli verification: 1 mL of prepared VBNC bacterial suspension was added into LB medium containing 10 mM sodium pyruvate and LB medium without sodium pyruvate, respectively, and cultured at 37°C for 24 hours. It was found that the LB medium containing sodium pyruvate was obviously turbid, while the LB medium without sodium pyruvate was clear. It can be seen that the VBNC state E. coli was successfully obtained by the method of the present application.

[0030] Example 1: Preparation of modified LST broth medium: Rpf recombinant protein (1 μg / L), magnesium sulfate (0.6 g / L), pyridoxal phosphate (1 mg / L), sodium pyruvate (2.2 g / L), tryptone (20 g / L), lactose (5 g / L), ammonium chloride (5 g / L), dipotassium hydrogen phosphate (2.75 g / L), potassium dihydrogen phosphate (2.75 g / L), sodium lauryl sulfate (0.03 g / L), and the balance is water. Among them, magnesium sulfate, tryptone, lactose, ammonium chloride, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium lauryl sulfate and water are mixed, and then the pH value of the medium is adjusted to 7.4, and sterilized at 121°C for 15 minutes; Rpf recombinant protein, sodium pyruvate and pyridoxal phosphate are sterilized by filtration. After the medium is sterilized at 121°C, the sterilized Rpf recombinant protein, sodium pyruvate and pyridoxal phosphate are added when the medium is cooled to 45-50°C.

[0031] The nucleotide sequence of the Rpf recombinant protein (SEQ ID NO. 1) is: ATGGATACAATGACACTATTTACGACTTCAGCTACCAGAAGCCGTCGCGCAACGGCTTCCATTGTGGCAGGCATGACCTTAGCCGGTGCGGCTGCTGTGGGCTTTTCTGCGCCAGCACAGGCAGCGACGGTGGATACCTGGGATCGTCTGGCGGAGTGCGAAAGCAACGGCACCTGGGACATCAACACCGGTAATGGCTTCTACGGCGGTGTACAGTTCACCCTGTCCAGCTGGCAGGCTGTCGGCGGCGAAGGTTATCCGCACCAGGCCTCGAAAGCGGAGCAAATCAAGCGCGCAGAGATCCTGCAAGATTTGCAAGGTTGGGGTGCCTGGCCGCTGTGTTCCCAGAAACTGGGTCTGACCCAGGCAGACGCGGACGCCGGCGATGTTGACGCAACTGAAGCGGCACCGGTTGCGGTGGAACGTACCGCTACCGTTCAGCGTCAGAGCGCTGCGGACGAAGCGGCGGCTGAGCAAGCGGCCGCGGCGGAACAAGCGGTGGTGGCGGAGGCCGAGACTATTGTTGTTAAATCTGGTGACAGCCTGTGGACCTTGGCGAATGAATACGAGGTCGAGGGTGGTTGGACGGCACTGTACGAGGCGAACAAGGGTGCGGTGAGCGATGCCGCTGTGGCGTATGTTGGCCAAGAATTGGTTCTCCCGCAGGCGTAA.

[0032] The nucleotide sequence of the Rpf protein of M. luteus before mutation is shown in SEQ ID NO. 2, and SEQ ID NO. 2 is: ATGGACACCATGACTCTCTTCACCACTTCCGCCACCCGCTCCCGCCGTGCCACCGCCTCGATCGTCGCGGGCATGACCCTCGCCGGCGCCGCCGCCGTGGGCTTCTCCGCCCCGGCCCAGGCCGCCACCGTGGACACCTGGGACCGCCTCGCCGAGTGCGAGTCCAACGGCACCTGGGACATCAACACCGGCAACGGCTTCTACGGCGGCGTGCAGTTCACCCTGTCCTCCTGGCAGGCCGTCGGCGGCGAAGGCTACCCGCACCAGGCCTCGAAGGCCGAGCAGATCAAGCGCGCCGAGATCCTCCAGGACCTGCAGGGCTGGGGCGCGTGGCCGCTGTGCTCGCAGAAGCTGGGCCTGACCCAGGCTGACGCGGACGCCGGTGACGTGGACGCCACCGAGGCCGCCCCGGTCGCCGTGGAGCGCACGGCCACCGTGCAGCGCCAGTCCGCCGCGGACGAGGCTGCCGCCGAGCAGGCCGCTGCCGCGGAGCAGGCCGTCGTCGCCGAGGCCGAGACCATCGTCGTCAAGTCCGGTGACTCCCTCTGGACGCTCGCCAACGAGTACGAGGTGGAGGGTGGCTGGACCGCCCTCTACGAGGCCAACAAGGGCGCCGTCTCCGACGCCGCCGTGGCCTACGTCGGCCAGGAGCTCGTCCTGCCGCAGGCCTGA.

[0033] The source of the Rpf recombinant protein is that the amino acid sequence of the Rpf protein of Micrococcus luteus is mutated, the mutated nucleotide sequence is sent to Shengong Bioengineering (Shanghai) Co., Ltd. for synthesis, and the Rpf recombinant protein of the application is obtained.

[0034] The Rpf recombinant protein of sequence SEQ ID NO. 1 and the Rpf protein are subjected to enzyme activity test, and it is found that the enzyme activity of the Rpf recombinant protein of sequence SEQ ID NO. 1 in the application is 317 U / mL, while the enzyme activity of the original protein without mutation is 83 U / mL. It can be seen that the enzyme activity of the mutated protein is increased by more than 2 times.

[0035] Example 2: Preparation of modified LST broth medium: Rpf recombinant protein (1 μg / L), magnesium sulfate (0.6 g / L), pyridoxal phosphate (0.25 mg / L), sodium pyruvate (0.55 g / L), tryptone (20 g / L), lactose (5 g / L), ammonium chloride (5 g / L), dipotassium hydrogen phosphate (2.75 g / L), potassium dihydrogen phosphate (2.75 g / L), sodium lauryl sulfate (0.03 g / L), and the balance being water. Among them, magnesium sulfate, tryptone, lactose, ammonium chloride, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium lauryl sulfate and water are mixed, and then the pH value of the medium is adjusted to 7.4, and high pressure sterilization at 121°C for 15 minutes; Rpf recombinant protein, sodium pyruvate and pyridoxal phosphate are sterilized by filtration. When the medium after 121°C high pressure sterilization is cooled to 45-50°C, the sterilized Rpf recombinant protein, sodium pyruvate and pyridoxal phosphate are added.

[0036] Example 3: Preparation of modified LST broth medium: Rpf recombinant protein (1 μg / L), magnesium sulfate (0.6 g / L), pyridoxal phosphate (0.5 mg / L), sodium pyruvate (1.1 g / L), tryptone (20 g / L), lactose (5 g / L), ammonium chloride (5 g / L), dipotassium hydrogen phosphate (2.75 g / L), potassium dihydrogen phosphate (2.75 g / L), sodium lauryl sulfate (0.03 g / L), and the balance being water. Among them, magnesium sulfate, tryptone, lactose, ammonium chloride, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium lauryl sulfate and water are mixed, and then the pH value of the medium is adjusted to 7.4, and high pressure sterilization at 121°C for 15 minutes; Rpf recombinant protein, sodium pyruvate and pyridoxal phosphate are sterilized by filtration. When the medium after 121°C high pressure sterilization is cooled to 45-50°C, the sterilized Rpf recombinant protein, sodium pyruvate and pyridoxal phosphate are added.

[0037] Example 4: Preparation of modified LST broth medium: Rpf recombinant protein (1 μg / L), magnesium sulfate (0.6 g / L), pyridoxal phosphate (2 mg / L), sodium pyruvate (3.3 g / L), tryptone (20 g / L), lactose (5 g / L), ammonium chloride (5 g / L), dipotassium hydrogen phosphate (2.75 g / L), potassium dihydrogen phosphate (2.75 g / L), sodium lauryl sulfate (0.03 g / L), and the balance being water. Among them, magnesium sulfate, tryptone, lactose, ammonium chloride, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium lauryl sulfate and water are mixed, and then the pH value of the medium is adjusted to 7.4, and high pressure sterilization at 121°C for 15 minutes; Rpf recombinant protein, sodium pyruvate and pyridoxal phosphate are sterilized by filtration. When the medium after 121°C high pressure sterilization is cooled to 45-50°C, the sterilized Rpf recombinant protein, sodium pyruvate and pyridoxal phosphate are added.

[0038] Comparative Example 1: Preparation of modified LST broth medium: Rpf recombinant protein (1 μg / L), magnesium sulfate (0.6 g / L), tryptone (20 g / L), lactose (5 g / L), ammonium chloride (5 g / L), dipotassium hydrogen phosphate (2.75 g / L), potassium dihydrogen phosphate (2.75 g / L), sodium lauryl sulfate (0.03 g / L), and the balance being water. Among them, the tryptone, lactose, ammonium chloride, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium lauryl sulfate and water are mixed, and then the pH value of the medium is adjusted to 7.4, and high pressure sterilization at 121°C for 15 minutes; the Rpf recombinant protein is sterilized by filtration. When the medium after 121°C high pressure sterilization is cooled to 45-50°C, the sterilized Rpf recombinant protein is added.

[0039] Comparative Example 2: Preparation of modified LST broth medium: sodium pyruvate (1.1 g / L), tryptone (20 g / L), lactose (5 g / L), ammonium chloride (5 g / L), dipotassium hydrogen phosphate (2.75 g / L), potassium dihydrogen phosphate (2.75 g / L), sodium lauryl sulfate (0.03 g / L), and the balance being water. Among them, the tryptone, lactose, ammonium chloride, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium lauryl sulfate and water are mixed, and then the pH value of the medium is adjusted to 7.4, and high pressure sterilization at 121°C for 15 minutes; the sodium pyruvate is sterilized by filtration. When the medium after 121°C high pressure sterilization is cooled to 45-50°C, the sterilized sodium pyruvate is added.

[0040] Comparative Example 3: Preparation of modified LST broth medium: pyridoxal phosphate (1 mg / L), tryptone (20 g / L), lactose (5 g / L), ammonium chloride (5 g / L), dipotassium hydrogen phosphate (2.75 g / L), potassium dihydrogen phosphate (2.75 g / L), sodium lauryl sulfate (0.03 g / L), and the balance being water. Among them, the tryptone, lactose, ammonium chloride, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium lauryl sulfate and water are mixed, and then the pH value of the medium is adjusted to 7.4, and high pressure sterilization at 121°C for 15 minutes; the pyridoxal phosphate is sterilized by filtration. When the medium after 121°C high pressure sterilization is cooled to 45-50°C, the sterilized pyridoxal phosphate is added.

[0041] Comparative Example 4: Preparation of the modified LST broth medium: Rpf recombinant protein (1 μg / L), magnesium sulfate (0.6 g / L), pyridoxal phosphate (1 mg / L), tryptone (20 g / L), lactose (5 g / L), ammonium chloride (5 g / L), dipotassium hydrogen phosphate (2.75 g / L), monopotassium phosphate (2.75 g / L), sodium lauryl sulfate (0.03 g / L), and the balance being water. Among them, magnesium sulfate, tryptone, lactose, ammonium chloride, dipotassium hydrogen phosphate, monopotassium phosphate, sodium lauryl sulfate, and water are mixed, and then the pH value of the medium is adjusted to 7.4, and high-pressure sterilization at 121°C for 15 minutes; the Rpf recombinant protein and pyridoxal phosphate are sterilized by filtration. When the medium after 121°C high-pressure sterilization is cooled to 45-50°C, the sterilized Rpf recombinant protein and pyridoxal phosphate are added.

[0042] Comparative Example 5: Preparation of the modified LST broth medium: Rpf recombinant protein (1 μg / L), magnesium sulfate (0.6 g / L), pyridoxal phosphate (1 mg / L), tryptone (20 g / L), lactose (5 g / L), ammonium chloride (5 g / L), dipotassium hydrogen phosphate (2.75 g / L), monopotassium phosphate (2.75 g / L), sodium lauryl sulfate (0.03 g / L), and the balance being water. Among them, magnesium sulfate, tryptone, lactose, ammonium chloride, dipotassium hydrogen phosphate, monopotassium phosphate, sodium lauryl sulfate, and water are mixed, and then the pH value of the medium is adjusted to 7.4, and high-pressure sterilization at 121°C for 15 minutes; the Rpf recombinant protein and pyridoxal phosphate are sterilized by filtration. When the medium after 121°C high-pressure sterilization is cooled to 45-50°C, the sterilized Rpf recombinant protein and pyridoxal phosphate are added.

[0043] Comparative Example 6: Preparation of the modified LST broth medium: Rpf recombinant protein (1 μg / L), magnesium sulfate (0.6 g / L), pyridoxal phosphate (1 mg / L), tryptone (20 g / L), lactose (5 g / L), ammonium chloride (5 g / L), dipotassium hydrogen phosphate (2.75 g / L), monopotassium phosphate (2.75 g / L), sodium lauryl sulfate (0.03 g / L), and the balance being water. Among them, magnesium sulfate, tryptone, lactose, ammonium chloride, dipotassium hydrogen phosphate, monopotassium phosphate, sodium lauryl sulfate, and water are mixed, and then the pH value of the medium is adjusted to 7.4, and high-pressure sterilization at 121°C for 15 minutes; the Rpf recombinant protein and pyridoxal phosphate are sterilized by filtration. When the medium after 121°C high-pressure sterilization is cooled to 45-50°C, the sterilized Rpf recombinant protein and pyridoxal phosphate are added.

[0044] The modified LST broth medium obtained in the examples and comparative examples was used to culture VBNC state Escherichia coli. The VBNC state Escherichia coli culture conditions: the culture temperature was 36-38°C, and the culture time was 24 h.

[0045] The modified LST broth medium obtained in the examples and comparative examples is tested: (1) Determination of the components of the modified LST broth medium: Preparation of the medium: The modified LST broth medium of the examples and comparative examples is prepared respectively.

[0046] Dilution of the bacterial solution: The working bacterial suspension of VBNC state Escherichia coli is adjusted with sterile PBS buffer solution, and the total number of viable bacteria in the VBNC state is adjusted to 10000 cell / mL.

[0047] Inoculation and culture: 0.1 mL of the working bacterial suspension of VBNC state Escherichia coli is taken and inoculated into the medium of the examples and comparative examples, respectively, and three repeated experiments are set for each medium. Incubate at 37°C for 24 hours. Take 1 mL of the culture solution and dilute it 10 times in series with sterile PBS buffer solution (10 mmol, pH = 7.2-7.4). Take 100 μL of the bacterial solution at an appropriate dilution and spread it on a tryptone soy peptone agar medium, and incubate it in a biochemical incubator at 37°C overnight. The next day, observe and count the colonies.

[0048] Counting: Count the number of colonies grown on the plate, and the results are shown in Table 1.

[0049] Taking the modified LST broth medium of Example 1 as an example, further research is carried out.

[0050] (2) Nutritional capacity (semi-quantitative test of growth rate) of the modified LST broth medium: Referring to the semi-quantitative detection method of GB4789.28-2024, the enrichment effect of the modified LST broth medium on VBNC state Escherichia coli is detected.

[0051] Adjust the prepared VBNC state Escherichia coli ATCC25922 bacterial suspension with sterile PBS buffer solution, adjust the total number of viable bacteria to 1000 cell / mL, and take 0.1 mL of the bacterial suspension of VBNC state Escherichia coli and inoculate it into 9.9 mL of the national standard medium (i.e. LST broth medium, formula: tryptone 20 g / L, lactose 5 g / L, sodium chloride 5 g / L, potassium hydrogen phosphate 2.75 g / L, potassium dihydrogen phosphate 2.75 g / L, sodium lauryl sulfate 0.03 g / L) and the modified LST broth medium obtained in the examples of the present application, respectively, and inoculate three parallel tubes for each medium or each component medium, and incubate at 37°C for 18 hours.

[0052] Plate counting: Take 10 μL of the enriched culture and evenly spread it on a TSA agar plate. If the number of colonies on the TSA agar plate is greater than 10 CFU, it is determined that the growth rate of the medium is good.

[0053] (3) Selectivity test of improved LST broth medium: 1x10 3 ~ 5x10 3 CFU Enterococcus faecalis CMCC (B) 32482 or Staphylococcus aureus ATCC 6538 were inoculated into 10 mL of national standard medium and improved LST broth medium, respectively, with three parallel tubes for each. Incubate at 37°C for 18 hours. The medium should be clear. Take 10 μL of the enriched culture and evenly spread it on TSA plates. The number of Enterococcus faecalis and / or Staphylococcus aureus colonies on the TSA plates should be less than 100 CFU, indicating good selectivity of the medium.

[0054] (4) Reproducibility test of improved LST broth medium: According to GB4789.28-2024, semi-quantitative test method was used to detect the reproducibility of the medium within and between batches. From 3 batches of improved LST broth medium, 3 boxes were randomly selected from each batch to evaluate the nutritional performance of the medium on Escherichia coli and VBNC state Escherichia coli and the selectivity on Staphylococcus aureus and Enterococcus faecalis. Each batch of reagent kit was tested in triplicate. The detection method is as follows: Medium preparation and dispensing: Prepare the national standard medium and dispense it quantitatively, 9.9 mL / tube. Take the improved LST broth medium to be tested and dispense it quantitatively, 9.9 mL / tube; Growth rate qualitative determination: Refer to the semi-quantitative detection method of GB4789.28-2024; (5) Clinical sample detection: Water samples from different sampling points of a canteen in Yantai City (10 water samples) and water samples from different sampling points of a water storage tank (10 water samples). According to "GB4789.3-2016 National Food Safety Standard Food Microbiological Examination Escherichia coli Count", MPN counting method was used for detection. According to "Drinking Water Health Standard" (GB / T5749-2022), total coliform bacteria should not be detected.

[0055] Sample dilution and inoculation fermentation: Dilute the water sample by 10 times, select 3 appropriate consecutive dilutions, take 1 mL of each dilution and inoculate into 3 9 mL national standard medium or improved LST broth medium. At the same time, take 1 mL of sterile saline as a blank control. Incubate at 37°C for 24 hours. Observe whether there are bubbles in the catheter. If gas is produced, perform a re-fermentation test (confirmation test); if no gas is produced, continue to culture for 48 hours. The gas-producing tube is positive for coliform bacteria, and the non-gas-producing tube is negative for coliform bacteria.

[0056] Recovery test (confirmation test): 1 loop of culture was taken from the modified LST broth medium producing gas with a loop, and was inoculated into a brilliant green lactose bile salt broth (BGLB) tube and incubated at 37°C for 48 hours. The gas-producing tube was the coliform positive tube.

[0057] Reporting of the most probable number (MPN) of coliforms: The MPN table was searched to report the MPN value of coliforms per mL of sample.

[0058] Results and analysis: Table 1 Test results of the culture medium of the examples and comparative examples

[0059] Table 2 Growth rate quantitative test results of the culture medium of Example 1

[0060] Note: a: Turbidity calculation: 0 indicates no turbidity; 1 indicates very slight turbidity; 2 indicates severe turbidity, and is determined according to the GB 4789.28-2013 evaluation standard; b: After enrichment, count the TSA plate.

[0061] Table 3 Reproducibility test results of the culture medium of Example 1

[0062] Note: a: Turbidity calculation: 0 indicates no turbidity; 1 indicates very slight turbidity; 2 indicates severe turbidity, and is determined according to the GB 4789.28-2013 evaluation standard; b: After enrichment, count the TSA plate.

[0063] Table 4 Results of the culture medium test of Example 1 clinical water samples

[0064] Note: a: Turbidity calculation: 0 indicates no turbidity; 1 indicates very slight turbidity; 2 indicates severe turbidity, and is determined according to the GB 4789.28-2013 evaluation standard; b: After enrichment, count the TSA plate.

[0065] The improved LST broth medium of the present application adds Rpf recombinant protein, the Rpf recombinant protein has good activity, can decompose the peptidoglycan of the VBNC state Escherichia coli cell wall, so that the cell wall becomes loose, and the degraded peptidoglycan can enter the Escherichia coli cell through the loose cell wall, thereby awakening the Escherichia coli. In the culture medium, the magnesium ion of magnesium sulfate provides a divalent metal ion for the activity of the Rpf recombinant protein, thereby facilitating the action of the Rpf recombinant protein on the VNBC state Escherichia coli.

[0066] As can be seen from Table 1, the VBNC state Escherichia coli was successfully cultured in the culture medium of Comparative Example 1 due to the addition of Rpf recombinant protein and magnesium sulfate. Sodium pyruvate was added in the culture medium of Comparative Example 2, which not only can act as a scavenger of active oxygen free radicals to remove the active oxygen free radicals in the cell which can damage DNA, but also can act as an energy material to play an important role in the glycolysis process. Therefore, in Comparative Example 2, the addition of sodium pyruvate alone can also promote the Escherichia coli to eliminate the VBNC state. The culture medium of Comparative Example 4 simultaneously adds Rpf recombinant protein, magnesium sulfate and sodium pyruvate, and its effect is slightly stronger than that of Comparative Example 2. On this basis, the addition of pyridoxal phosphate significantly promotes the Escherichia coli to eliminate the VBNC state, and the Escherichia coli cultured in Examples 1-4 is at least 6 times that of Comparative Example 4.

[0067] Further research on Examples 1-3 found that the addition amount of pyridoxal phosphate increases with the increase of sodium pyruvate, and the number of cultured VBNC state Escherichia coli cells increases. However, as shown by the comparison between Reference Example 3 and Example 4, when the addition amount of pyridoxal phosphate is further increased, the number of cultured VBNC state Escherichia coli cells starts to have no obvious increase or difference, which indicates that pyridoxal phosphate can regulate the expression of cell transcription factors and recovery-related genes by regulating the Rpos gene. This mechanism has a synergistic effect on the regulation of intracellular oxidation-reduction reaction by sodium pyruvate, and cooperatively regulates the formation and recovery of the VBNC state of the cell by regulating the intracellular ROS level and the anti-peroxidase system. Therefore, the mass concentration ratio of tryptone, ammonium chloride, lactose, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium lauryl sulfate, Rpf recombinant protein, magnesium sulfate, sodium pyruvate and pyridoxal phosphate is further optimized to be 20g / L:5g / L:5g / L:2.75g / L:2.75g / L:0.03g / L:1μg / L:0.6g / L:2.2g / L:1mg / L.

[0068] The growth rate test results in Table 2 show that the improved LST broth medium of the present application can successfully culture Escherichia coli and VBNC state Escherichia coli.

[0069] The Enterococcus faecalis and Staphylococcus aureus are inoculated into the improved LST broth culture medium of the application respectively, are uniformly coated, and the plates are placed at 37°C for culture for 18-24 hours, and it is found that the Enterococcus faecalis and Staphylococcus aureus are all inhibited, and no colony growth. It can be seen that the improved LST broth culture medium of the application has good selectivity.

[0070] The results in Table 3 show that the improved LST broth culture medium of the application has good repeatability, can successfully culture Escherichia coli and VBNC state Escherichia coli, and has stable selectivity, and has no culture effect on Enterococcus faecalis and Staphylococcus aureus.

[0071] The results in Table 4 show that the LST broth culture medium obtained in Example 1 of the application can be successfully applied to detect VBNC state Escherichia coli in water samples.

Claims

1. A modified LST broth medium, characterized in that, The improved LST broth medium comprises tryptone, ammonium chloride, lactose, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium laurylsulfate, Rpf recombinant protein, magnesium sulfate, sodium pyruvate and pyridoxal phosphate, and the mass concentration ratio of the tryptone, ammonium chloride, lactose, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium laurylsulfate, Rpf recombinant protein, magnesium sulfate, sodium pyruvate and pyridoxal phosphate is (15g / L-25g / L):(4g / L-6g / L):(3g / L-7g / L):(2.5g / L-3g / L):(2.5g / L-3g / L):(0.02g / L-0.04g / L):(0.9μg / L-1.1μg / L):(0.5g / L-0.7g / L):(0.55g / L-3.3g / L):(0.25mg / L-2mg / L); The nucleotide sequence of the Rpf recombinant protein is shown as SEQ ID NO.

1.

2. The modified LST broth medium according to claim 1, characterized in that, The mass concentration ratio of the tryptone, ammonium chloride, lactose, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium laurylsulfate, Rpf recombinant protein, magnesium sulfate, sodium pyruvate and pyridoxal phosphate is 20g / L:5g / L:5g / L:2.75g / L:2.75g / L:0.03g / L:1μg / L:0.6g / L:2.2g / L:1mg / L.

3. The modified LST broth medium according to claim 1, characterized in that, The pH value of the improved LST broth medium is 7.2-7.

6.

4. Use of the improved LST broth medium according to any one of claims 1-3 in culturing gram-negative bacteria in a VBNC state.

5. Use of the improved LST broth medium according to any one of claims 1-3 in culturing Escherichia coli in a VBNC state.

6. Use according to claim 5, characterized in that, The culture temperature is 36-38℃, and the culture time is 18-24h.

Citation Information

Patent Citations

  • Method for quantitatively detecting VBNC state bacteria

    US20200340040A1

  • Genetically engineered bacterium for producing resuscitation promoting factors and application of genetically engineered bacterium

    CN106967660A

  • Resuscitation culture medium for VBNC bacteria and preparation method and application thereof

    CN110484465A