RNA-carried pesticide nanomotor capable of efficiently killing sogatella furcifera and preparation method of RNA-carried pesticide nanomotor

Abstract

The invention discloses an RNA-carried pesticide nanomotor capable of efficiently killing sogatella furcifera and a preparation method of the RNA-carried pesticide nanomotor, and belongs to the technical field of plant protection. The method comprises the following steps: S1, preparing silicon dioxide nanoparticles with a virus surface imitating branch morphology; s2, carrying out mask-assisted selective functionalization and polyelectrolyte layer-by-layer self-assembly, and asymmetrically loading glucose oxidase and sucrase on the surfaces of the nanoparticles; s3, synthesizing double-stranded RNA (Ribonucleic Acid) of the targeted sogatella furcifera chitin synthase gene; and S4, loading the double-stranded RNA on a product obtained in the step S2. The nano-motor disclosed by the invention can decompose cane sugar in rice juice by utilizing a double-enzyme cascade reaction to generate a chemical gradient, so that autonomous chemotactic movement is realized, a vascular bundle end wall barrier of rice is effectively broken through, and an RNA pesticide is efficiently delivered to target pests, so that efficient and specific killing of sogatella furcifera is realized. The method has the advantages of being simple in synthesis, controllable in size, excellent in movement performance, large in loading capacity, environmentally friendly and the like.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant protection and nanobiotechnology, and particularly relates to a nanomotor for targeted delivery of RNA pesticides to efficiently kill the rice pest white-backed planthopper and a preparation method thereof. BACKGROUND

[0002] The white-backed planthopper (Sogatella furcifera) is a migratory pest that seriously damages rice production, mainly sucking the phloem sap of rice and transmitting viral diseases, causing huge yield losses. At present, the control of the white-backed planthopper mainly relies on chemical insecticides, but long-term and large-scale use has led to serious insecticide resistance of the pests, as well as problems such as pesticide residues, environmental pollution and killing of natural enemies.

[0003] RNA interference (RNAi) technology provides a new strategy for green pest control. By delivering double-stranded RNA (dsRNA) targeting essential genes of pests (such as chitin synthase genes), the expression of the genes can be specifically silenced, leading to death or growth and development inhibition of the pests. Compared with traditional chemical pesticides, RNA pesticides have the advantages of strong targeting, difficulty in developing resistance, environmental friendliness, etc. However, dsRNA molecules are easily degraded by nucleases in the field environment, and it is difficult for them to effectively penetrate plant tissues and pest body walls to reach target sites, especially the "end wall barrier" (composed of multiple layers of sieve plates with sieve pores) existing in the vascular bundle of rice, which seriously hinders the passive transport of macromolecular substances, resulting in extremely low delivery efficiency of RNA pesticides and unsatisfactory control effect.

[0004] In recent years, nanocarriers have been widely studied for improving the stability and delivery efficiency of RNA. However, traditional nanoparticles rely on passive diffusion or plant transpiration, and cannot actively cross complex biological barriers, so the delivery efficiency is still limited. Nanomotors are micro / nanoparticles that can convert environmental chemical energy, light energy, etc. into their own kinetic energy, and have the ability of autonomous motion, which provides a possibility to break through biological barriers. However, the combination of nanomotor technology and RNA pesticide delivery, especially for the control of plant pests, is still in its infancy, and there is a lack of integrated systems that can simultaneously meet the requirements of efficient loading, autonomous motion, barrier penetration and targeted insect killing.

[0005] Therefore, it is of great significance to develop a nanocarrier system that can autonomously move, actively break through the barrier of plant tissues, and efficiently load and deliver RNA pesticides, for the efficient and green control of the white-backed planthopper. SUMMARY

[0006] In order to solve the problems of low RNA pesticide delivery efficiency, difficulty in breaking through the end wall barrier of rice, and lack of target movement ability in the prior art, the application provides a RNA pesticide-loaded nanomotor for efficiently killing white-backed planthoppers and a preparation method thereof. The nanomotor integrates a variety of functions such as virus-like morphology, double-enzyme driving, autonomous chemotaxis and RNA loading, and can actively deliver RNA pesticides to target pests like a "Trojan horse".

[0007] The technical scheme adopted by the application is as follows: The preparation method of the RNA pesticide-loaded nanomotor for efficiently killing white-backed planthoppers comprises the following steps: S1, preparing virus-like morphology silica nanoparticles: using cetyltrimethylammonium bromide (CTAB) as a template agent and tetraethyl orthosilicate (TEOS) as a silicon source, a reaction is carried out in a two-phase system composed of an alkaline aqueous phase and a cyclohexane oil phase at 40-80 DEG C for 20-90 hours. After the reaction is completed, centrifugation, water washing, ethanol washing and acetone refluxing at 40-80 DEG C for 6-30 hours are carried out to remove the template agent, so that porous silica nanoparticles with virus-like "branching" morphology on the surface are obtained. The branching structure significantly increases the specific surface area, which is beneficial to subsequent functional modification and loading.

[0008] S2, asymmetric loading of enzymes (construction of Janus nanomotor): after the silica nanoparticles obtained in step S1 are dispersed, they are semi-embedded and fixed on the surface of a glass slide precoated with a paraffin film by means of centrifugation. Then the glass slide is sequentially immersed in different concentrations of polyelectrolyte solutions (such as polyallylamine hydrochloride PAH and sodium polystyrene sulfonate PSS), glucose oxidase solution and sucrose solution, and layer-by-layer self-assembly is carried out. After each immersion, water washing is carried out. In this process, since the nanoparticles are only partially exposed to the solution, asymmetric loading of enzymes on one side of the nanoparticles is realized, forming a Janus structure. Finally, the paraffin film is dissolved with tetrahydrofuran, the modified nanoparticles are released, centrifuged and collected and washed, and a nanomotor precursor with asymmetrically loaded glucose oxidase and sucrose on the surface is obtained. The two enzymes can catalytically decompose sucrose in cascade: sucrose is hydrolyzed into glucose and fructose by sucrose, and glucose oxidase further oxidizes glucose to produce gluconic acid and hydrogen peroxide, and the reaction process can generate a chemical gradient and drive the movement of the nanomotor.

[0009] S3, Preparation of RNA pesticide: find the coding sequence (CDS) of the chitin synthase gene of white-backed planthopper from a public database (such as NCBI), and select a specific sequence of about 300 bp. Clone the sequence into a vector suitable for dsRNA production, such as L4440, to construct a recombinant plasmid. Transform the plasmid into DE3 competent cells, induce with IPTG, and use large-scale bacterial fermentation to express dsRNA. Finally, high-purity targeted dsRNA is obtained by trichloromethane extraction and isopropanol precipitation.

[0010] S4, Loading of RNA pesticide: redispersed nano motor precursor obtained in step S2, sequentially immersed in a solution containing a polyelectrolyte and a solution containing dsRNA obtained in step S3, and treated. After modification with a polyelectrolyte, the electrostatic adsorption between the positive charge on the surface and the negative charge on the dsRNA firmly loads the RNA on the surface of the nano motor. Alternatively, before loading the RNA, the sample can be treated with fluorescein isothiocyanate-labeled polyelectrolyte to facilitate subsequent fluorescence tracing observation. Finally, the double-enzyme-driven RNA-loaded pesticide nano motor is obtained.

[0011] As a further improvement of the present application, the virus-like morphology silica nanoparticles obtained in step S1 have a diameter of about 50-500 nm, a surface branch length of about 5-30 nm, and a BET specific surface area of about 100-900 m² / g.

[0012] As a further improvement of the present application, in step S2, the final concentration of glucose oxidase and sucrase in the loading solution is independently 2-20 mg / mL.

[0013] As a further improvement of the present application, in step S3, the length of the targeted dsRNA is 100-900 bp.

[0014] As a further improvement of the present application, the polyelectrolyte used in steps S2 and S4 can be selected from one or more of polyallylamine hydrochloride, polystyrene sulfonate sodium, hyaluronic acid, polyacrylic acid, chitosan, sodium alginate, etc.

[0015] The present application also provides a double-enzyme-driven RNA-loaded pesticide nano motor prepared by the above method.

[0016] The application further provides application of the double-enzyme driven RNA-loaded pesticide nanomotor in prevention and treatment of white-backed planthoppers in rice. In application, the nanomotor is dispersed in sterile water to configure a suspension of 1-50 mg / mL, and is applied to rice plants by spraying or the like. The nanomotor can utilize its self-movement ability to move along the sucrose concentration gradient in the vascular bundle of rice, effectively break through the end wall barrier, and finally be ingested by the feeding planthopper to release dsRNA and induce RNAi effect, resulting in death of the pest.

[0017] The application has the following beneficial effects: 1) Efficient barrier penetration and targeted delivery: the virus-like morphology increases the specific surface area and interaction with tissues; the asymmetrically loaded double-enzyme system converts the sucrose chemical energy in the environment into self-movement kinetic energy, so that the nanomotor has chemotactic movement ability, can actively break through the rice end wall barrier which is difficult for traditional nanocarriers to overcome, and realizes efficient and targeted delivery of RNA pesticides.

[0018] 2) Excellent insecticidal effect and environmental friendliness: the loaded dsRNA can specifically silence essential genes of white-backed planthoppers, has high insecticidal efficiency, and is safe to non-target organisms, avoiding the broad-spectrum toxicity and residual pollution of chemical pesticides.

[0019] 3) Performance controllable and good stability: the size, morphology, enzyme loading amount and RNA loading amount of the nanomotor can be controlled in the preparation process. The prepared nanomotor has good storage stability at 4℃, and is convenient for transportation and use.

[0020] 4) Provide a new prevention and treatment strategy: the application creatively combines biomimetic materials, nanomotor driving technology and RNA interference pesticides, and provides a new technical route and product prototype for green and precise prevention and control of plant pests. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 is a preparation flowchart of the double-enzyme driven RNA-loaded pesticide nanomotor of the application.

[0022] Figure 2 is a transmission electron microscope photo of the double-enzyme driven RNA-loaded pesticide nanomotor of the specific embodiment.

[0023] Figure 3 is an optical microscope photo of the double-enzyme driven RNA-loaded pesticide nanomotor of the specific embodiment entering the vascular bundle of rice.

[0024] Figure 4 is a motion trajectory diagram of the double-enzyme driven RNA-loaded pesticide nanomotor of the specific embodiment.

[0025] Figure 5Optical microscope images of dead white-backed planthoppers killed by the dual-enzyme-driven RNA-loaded pesticide nanomotor of the specific embodiment.

[0026] Figure 6 Left: HE-stained section of a naturally dead white-backed planthopper; right: HE-stained section of a white-backed planthopper killed by the dual-enzyme-driven RNA-loaded pesticide nanomotor of the specific embodiment. Specific Embodiment

[0027] The application will be further described in conjunction with the following examples and comparative examples. The following examples are used to illustrate the application but are not used to limit the scope of the application. The experimental methods in the examples, for which no specific conditions are indicated, are generally carried out according to the conventional conditions or according to the conditions recommended by the manufacturers. The reagents and instruments used are commercially available products, unless otherwise specified.

[0028] Example 1 S1. Preparation of virus-morphology silica nanoparticles: In a 250 mL single-neck flask, 1.0 g of cetyltrimethylammonium bromide and 50 mL of deionized water were added and stirred at 60°C water bath until dissolved. 0.8 mL of 0.1 M sodium hydroxide solution was added, and stirring was continued at 60°C for 30 minutes as phase A.

[0029] Another 20 mL of cyclohexane was taken in a beaker, and 4.0 mL of tetraethyl orthosilicate was added. After mixing, it was preheated at 60°C water bath as phase B.

[0030] Under vigorous stirring, phase B was quickly poured into phase A, and stirring was continued at 60°C for 72 hours. After the reaction was completed, the mixture was transferred to a centrifuge tube and centrifuged at 10,000 rpm for 5 minutes, and the supernatant was discarded. The precipitate was washed with deionized water and anhydrous ethanol for 3 times each. The washed precipitate was transferred to a round-bottom flask, 50 mL of acetone was added, and refluxing was carried out at 50°C oil bath for 12 hours. After cooling, centrifugation was carried out, and ethanol was used for washing for 2 times. Finally, it was dispersed in 20 mL of anhydrous ethanol for storage, and a milky white suspension was obtained. The sample was added dropwise on a copper mesh, dried, and observed by transmission electron microscopy. The particles were spherical in shape, with dense short spines on the surface, an average diameter of about 100 nm, and a branch length of about 15 nm.

[0031] S2. Preparation of Janus nanomotor precursor: A clean glass slide was taken, and a layer of melted paraffin was evenly coated on its surface and cooled and solidified. 200 μL of the silica nanoparticle ethanol dispersion obtained in step S1 was dropped on the paraffin film, and after standing for 10 minutes, it was spin-coated at a speed of 8000 rpm for 30 seconds to semi-embed the nanoparticles in the paraffin. The glass slide was placed in a 63°C oven for heating for 20 minutes to slightly melt the paraffin to better fix the particles.

[0032] The following solutions were prepared: 2 mg / mL of a sodium polystyrene sulfonate solution (with 0.5 M NaCl); 2 mg / mL of a polyallylamine hydrochloride solution (with 0.5 M NaCl); 10 mg / mL of a glucose oxidase PBS solution (pH 6.5); 10 mg / mL of a sucrose PBS solution (pH 6.5).

[0033] The glass slide with nanoparticles immobilized thereon was treated by immersion in the following order, with gentle washing in ultrapure water for 30 seconds after each immersion: ① PSS solution, 20 minutes; ② PAH solution, 20 minutes; ③ PSS solution, 20 minutes; ④ glucose oxidase solution, 30 minutes; ⑤ PAH solution, 20 minutes; ⑥ sucrose solution, 30 minutes.

[0034] After the treatment was complete, the glass slide was immersed in a glass dish containing 5 mL of tetrahydrofuran, and the paraffin was dissolved by gently shaking to cause the nanoparticles to fall off into the solution. The tetrahydrofuran dispersion was collected and centrifuged at 12,000 rpm for 8 minutes, and the supernatant was discarded. The precipitate was washed once with tetrahydrofuran and once with anhydrous ethanol, and finally the precipitate was dispersed in 1 mL of PBS buffer at pH 6.5 to obtain a Janus nanomotor precursor suspension.

[0035] S3. Preparation of a target dsRNA: A specific sequence of 300 bp in length (the nucleotide sequence of which is shown as SEQ ID NO: 1) was selected from the CDS sequence of the chitin synthase gene of the white-backed planthopper, and was entrusted to Beijing Chengke Biological Technology Co., Ltd. for synthesis and cloning into the L4440 vector to construct the recombinant plasmid pL4440-Chs.

[0036] SEQ ID NO: 1: CACGCTACTTCACTTATCTATTCATTTCCATTTGGAAAATCATTCTCTTCTTCTCCTGTACTACGCTTTTCTACAGAGGTGAAAGCATTTCGAAATTCTTCACGTCAATGTCTACAGGATTCTCTGAGCACAAAATCAGGATAACTGAGGTGCGAGCATCGTATGGAGGAACGAGCCTTCCTGATTTGGCCGATGTCCTAGCCTTTCGATTATCGATATCAACGCTGAGCAGAAGACTGCTTTGATGGTGCTAATTGTGCATATCATTGCTGCCTACTTATGCTACATTTTCGGTAAATTCGCTTGCAAGATTGTCATCCAAGGATTTAGTTATGCATTCCCCGTTAATCTGACCATTCCTGTCACAATATCTGTCCTCATTGCAATGTGTGGCCTCAGACAAGAAGATCCGTAAACGTTCCATGGCACAATTCCAGATTATCTATTCTTCGAGTCGCCGCCGATTTACTTCCTCAACGATTTCATATCTCGACAACATCTGAAATTAGGCGCAGACCTGGATAACACTTCACATTTGGACGCCCAAAGTTGAACGTCTGGCCACTACCGAGAAGCTGTTCGTGCTGCCTATGTAC Take 5 μL plasmid (100 ng / μL) into 100 μL BL21(DE3) chemically competent cells, ice bath for 30 minutes. After 42°C heat shock for 45 seconds, immediately ice bath for 2 minutes. Add 500 μL of LB liquid medium without resistance, 37°C, 180 rpm recovery culture for 1 hour. Take 200 μL of bacterial liquid to be coated on LB solid plate containing 100 μg / mL ampicillin, 37°C inverted culture overnight.

[0037] Pick a single colony to inoculate 5 mL of LB liquid medium containing ampicillin, 37°C, 220 rpm culture overnight as seed liquid. According to the ratio of 1:100, the seed liquid is transferred to 200 mL of fresh LB medium, and cultured at 37°C until the OD600 is about 0.6. Add IPTG to a final concentration of 0.5 mM, 16°C, 180 rpm induction expression for 16 hours.

[0038] The bacteria liquid after induction was centrifuged to collect the bacteria. Total RNA was extracted using a bacterial total RNA extraction kit (DP430), and further prepared into a large amount of double-stranded RNA through RT-PCR and an in vitro transcription kit, with specific steps referring to the kit instructions. Finally, the dsRNA was dissolved with enzyme-free water, the concentration was determined, and then stored at -80°C.

[0039] S4. Preparation of RNA pesticide nano motor: First, FITC-PAH was prepared for tracing: 100 mg of PAH was dissolved in 50 mL of deionized water, 1.5 g of NaCl was added, and the pH was adjusted to 9.0 with 0.1 M NaOH. 1 mg of FITC was dissolved in 1 mL of DMSO. The FITC-DMSO solution was slowly added to the PAH solution, and stirred at room temperature for 18 hours in the dark. The reaction liquid was loaded into a dialysis bag (MWCO 3500) and dialyzed in deionized water for 48 hours, with water changed every 6 hours. The liquid in the dialysis bag was collected and stored at 4°C in the dark.

[0040] 1 mL of Janus nano motor precursor suspension prepared in step S2 was taken and centrifuged to discard the supernatant. The following treatments were carried out in sequence: ① 1 mL of PSS solution (2 mg / mL containing 0.5 M NaCl) was added, vortexed and mixed, then placed for 20 minutes, centrifuged to discard the supernatant, and washed once with sterile water; ② 1 mL of FITC-PAH solution was added, and placed in the dark for 30 minutes, then centrifuged to discard the supernatant, and washed twice with sterile water; ③ 1 mL of PAH solution (2 mg / mL containing 0.5 M NaCl) was added, and placed for 20 minutes, then centrifuged to discard the supernatant, and washed twice with sterile enzyme-free water; ④ 1 mL of sterile enzyme-free water containing 200 μg of dsRNA prepared in step S3 was added, gently mixed, and placed at room temperature for 45 minutes to allow the RNA to be loaded by electrostatic interaction. The supernatant was discarded and gently washed once with sterile enzyme-free water. Finally, the precipitate was redispersed in 1 mL of sterile enzyme-free water to obtain the final double-enzyme-driven RNA pesticide nano motor with a concentration of 10 mg / mL, which was immediately used or stored at 4°C in the dark for short-term preservation.

[0041] Example Two: The difference between this example and Example One is that some parameters in steps S1 and S2 are adjusted to prepare nano motors of different sizes and enzyme loadings.

[0042] S1. Preparation of virus-like morphology silica nanoparticles: The amount of CTAB in step S1 of Example One is changed to 0.5 g, the amount of TEOS is changed to 2 mL, the volume of cyclohexane is changed to 15 mL, the reaction temperature is changed to 50 °C, and the reaction time is changed to 48 hours. The other steps are the same as Example One. The average diameter of the obtained nanoparticles is about 70 nm, and the length of the branches is about 10 nm.

[0043] S2. Preparation of Janus nanomotor precursor: The loading concentration of glucose oxidase and sucrase in step S2 of Example One is adjusted to 5 mg / mL, and the soaking time is adjusted to 20 minutes. The polyelectrolyte soaking time is adjusted to 15 minutes. The other steps are the same as Example One.

[0044] S3. Preparation of targeted dsRNA: the same as Example One.

[0045] S4. Preparation of RNA-loaded pesticide nanomotor: the same as Example One.

[0046] Example Three: The difference between this example and Example One is that the types of polyelectrolytes in step S2 and the RNA loading step in step S4 are adjusted.

[0047] S1. Preparation of virus-like morphology silica nanoparticles: the same as Example One.

[0048] S2. Preparation of Janus nanomotor precursor: In step S2 of Example One, PSS and PAH are replaced by chitosan (CTS, dissolved in 1% acetic acid solution, pH adjusted to 5.5) and sodium alginate (SA). The specific soaking sequence is: ① SA solution (2 mg / mL, containing 0.2 M NaCl), 20 minutes; ② CTS solution (2 mg / mL, containing 0.2 M NaCl), 20 minutes; ③ SA solution, 20 minutes; ④ glucose oxidase solution (10 mg / mL, pH 5.5 acetic acid buffer), 30 minutes; ⑤ CTS solution, 20 minutes; ⑥ sucrase solution (10 mg / mL, pH 5.5 acetic acid buffer), 30 minutes. The washing and subsequent separation steps are the same as Example One.

[0049] S3. Preparation of targeted dsRNA: the same as Example One.

[0050] S4. Preparation of RNA-loaded pesticide nanomotor: Omit the FITC-PAH labeling step. Take 1 mL of Janus nanomotor precursor suspension prepared in step S2, centrifuge and discard the supernatant, then directly perform the polyelectrolyte / RNA assembly: ① add 1 mL of CTS solution (2 mg / mL, containing 0.2 M NaCl), treat for 20 minutes, and wash; ② add 1 mL of sterile enzyme-free water containing 200 μg of dsRNA, treat for 60 minutes, and wash. Finally, disperse in 1 mL of sterile enzyme-free water.

[0051] Comparative Example One: The difference between this comparative example and Example One is that in step S2, instead of asymmetrically loading by the mask plate semi-embedding fixation method, the silica nanoparticles are directly dispersed in a solution for uniform loading of enzymes.

[0052] Specifically, the operation of fixing the nanoparticles on the paraffin film glass slide in step S2 of Example One is omitted. Directly centrifuge 1 mL of the silica nanoparticle ethanol dispersion obtained in step S1, precipitate and disperse in 1 mL of PAH solution (2 mg / mL), and oscillate for adsorption at room temperature for 1 hour. After centrifugal washing, disperse the particles in 1 mL of mixed PBS solution containing glucose oxidase and sucrose enzyme (10 mg / mL each), oscillate for adsorption at room temperature for 2 hours. After centrifugal washing, the nanoparticles uniformly loaded with double enzymes on the surface are obtained. The subsequent steps S3 and S4 are the same as in Example One.

[0053] Comparative Example Two: The difference between this comparative example and Example One is that in step S2, only glucose oxidase is loaded, and no sucrose enzyme is loaded.

[0054] Specifically, during the layer-by-layer assembly process of step S2 of Example One, the soaking of the "sucrose enzyme solution" in step ⑥ is omitted. The other steps are exactly the same.

[0055] Comparative Example Three: The difference between this comparative example and Example One is that in step S2, only sucrose enzyme is loaded, and no glucose oxidase is loaded.

[0056] Specifically, during the layer-by-layer assembly process of step S2 of Example One, the soaking of the "glucose oxidase solution" in step ④ is omitted. The other steps are exactly the same.

[0057] Comparative Example Four: The difference between this comparative example and Example One is that in step S1, solid silica microspheres with smooth surfaces are prepared, which do not have a virus-like branched morphology.

[0058] Specifically: the classic Stöber method was used to synthesize silica microspheres. 2 mL TEOS was added to a mixed solution containing 20 mL anhydrous ethanol, 5 mL deionized water and 1 mL ammonia water, and stirred at room temperature for 6 hours. Centrifugation, washing with ethanol and water, to obtain smooth silica microspheres with an average diameter of about 100 nm. Replace the product of step S1 of Example One with this microsphere, and all subsequent steps are the same as Example One.

[0059] Comparative Example Five: The difference between this comparative example and Example One is that no enzyme is loaded, only as a carrier for RNA.

[0060] Specifically: the entire step S2 of Example One is omitted. The virus-like morphology silica nanoparticles obtained in step S1 are directly used for RNA loading in step S4. In step S4, the particles are first treated with a PAH solution to make their surface positively charged, and then directly loaded with dsRNA.

[0061] Comparative Example Six: This comparative example uses the commonly used liposome to deliver dsRNA in the prior art.

[0062] Specifically: according to the method disclosed in the journal "Molecular Pharmaceutics" (2019, 16, 5, 2265-2277), cationic liposomes encapsulating dsRNA with the same sequence as Example One are prepared. The main materials are DOTAP and cholesterol, with a molar ratio of 1:1, and are prepared by the thin film hydration method.

[0063] The samples prepared in Examples One to Three and Comparative Examples One to Six were tested for the following properties, and the results are summarized in Tables 1 and 2.

[0064] 1. Nanomotor morphology and size characterization: The morphology was observed using a transmission electron microscope, and the hydrated particle size and Zeta potential were measured using a dynamic light scattering instrument. The product of Example One had a clear branch structure, as shown in Figure 2 The polydispersity index of the particle size of all samples was less than 0.2.

[0065] 2. Motion performance test: An inverted microscope equipped with a high-speed CMOS camera was used in a self-made observation pool. The observation pool was filled with 0.5 M sucrose solution (simulating rice sap). 10 μL of sample dispersion (diluted to about 0.1 mg / mL) was injected into the pool, and the motion video of the nanoparticles was recorded. The motion trajectory (as shown in Figure 4 ) and average motion speed were analyzed using nanoparticle tracking analysis software.

[0066] 3. Barrier penetration experiment (in vitro model): A microfluidic chip was used to simulate the sieve plate end wall barrier of rice. The main channel of the chip was filled with 1% agarose gel to simulate the sieve plate, and the two sides were liquid reservoirs. One side was added with sample dispersion liquid containing 0.5 M sucrose, and the other side was pure water. The number and rate of fluorescently labeled nanomotors crossing the gel barrier from the high sucrose side to the other side were observed and quantitatively analyzed under a fluorescence microscope at different times.

[0067] 4. RNA loading rate and protection effect evaluation:The RNA concentration in the supernatant before and after loading was determined using the Quant-iT RiboGreen RNA kit, and the loading rate was calculated. The RNA-loaded nanomotors and the same amount of free RNA were placed in a solution containing RNase A at the same time, and after incubation at 37°C for different times, the integrity of the RNA was extracted and electrophoretically detected to evaluate the protection effect.

[0068] 5. Bioassay of insecticidal effect: It was carried out in an artificial climate chamber. Selecting rice seedlings of uniform growth, 15 healthy 3rd instar white-backed planthopper nymphs were inoculated in each pot. After 24 hours, each sample (concentration was 10 mg / mL, and the amount of dsRNA was 200 ppm) was uniformly sprayed on the rice plants using a handheld sprayer. The same amount of sterile water was sprayed as a blank control, and the same amount of free dsRNA solution was sprayed as a positive control. Each treatment was repeated 3 times. The number of live insects was investigated at 72 hours and 120 hours after treatment, and the mortality rate or the reduction rate of insect population was calculated. The results are shown in Table 2.

[0069] 6. In vivo delivery visualization verification: FITC-labeled RNA-loaded nanomotors (without dsRNA) prepared in Example 1 were sprayed on rice seedlings. After 24 hours, the rice stems were taken to make hand-cut sections, and the fluorescence distribution was observed under a laser confocal microscope. The results are shown in Figure 3 It can be seen that the fluorescence signal has been distributed inside the vascular bundle. Table 1: Physicochemical properties and motion performance of nanomotors

[0070] Table 2: Results of insecticidal bioassay

[0071] Results analysis: Driving and motion performance (Comparative Examples 1, 2 and 3): Example 1 has the highest motion speed (8.7 μm / s) and barrier penetration efficiency (85.2%). The speed of Comparative Example 1 (uniform enzyme loading) decreased significantly, which proves that the asymmetric Janus structure is crucial for efficient driving.

[0072] Virus-like morphology (comparative example four): The RNA loading rate of comparative example four (smooth microspheres) (65.4%) was significantly lower than that of example one (92.3%), and its barrier penetration efficiency was also lower. This proves that the virus-like branched morphology not only provides a large specific surface area for efficient loading, but its unique surface structure may also be more conducive to moving and penetrating in a complex biological environment.

[0073] Correlation between movement ability and insecticidal effect: Comparing example one and comparative example five (no enzyme and no movement), the latter, although having a high RNA loading rate, has a very poor insecticidal effect (120-hour mortality rate of 25.5%), which is comparable to that of free dsRNA. This strongly indicates that the autonomous movement ability of the nanomotor is the key to achieving efficient delivery and excellent insecticidal effect. Comparative example six (liposomes) has weak RNA protection ability and lacks movement, and its effect is between that of free RNA and the moving nanomotor.

[0074] As can be seen from the test results of example one, comparative example two, comparative example three and comparative example five in Table 2, when the nanomotor completely loads glucose oxidase and sucrose, the insecticidal effect on white-backed planthoppers is best (120-hour corrected mortality rate reaches 94.2%) (example one). However, when only a single enzyme is loaded (comparative example two loads only glucose oxidase, and comparative example three loads only sucrose), the 120-hour corrected mortality rate is sharply reduced to 35.6% and 32.2%, respectively. In particular, when the nanomotor does not load any enzyme (comparative example five), its insecticidal effect (25.5%) is not significantly different from that of free dsRNA (18.7%), and it loses effective control ability. Combined with the movement performance data in Table 1, the movement speeds of comparative examples two, three and five in 0.5M sucrose solution are all less than 1 μm / s, indicating that their autonomous movement ability is severely insufficient. This series of comparisons strongly proves that glucose oxidase and sucrose in the nanomotor of the present application constitute an indispensable synergistic driving system, and the cascade reaction of the two enzymes collectively converts the chemical energy of sucrose in the environment into the directional movement energy of the nanomotor; this autonomous movement ability is the core key to the nanomotor breaking through the biological barrier, achieving efficient delivery and ultimately producing excellent insecticidal effect. Without either of the enzymes, the nanomotor basically loses the ability to move chemotactically, and its delivery efficiency and final control effect are also greatly reduced.

[0075] Overall effect of the present application: In combination with Tables 1 and 2, the dual-enzyme-driven RNA-loaded pesticide nanomotor (examples one to three) provided by the present application is significantly superior to all comparative examples in terms of movement performance, barrier penetration, RNA loading and protection, and final insecticidal effect, demonstrating the overall synergistic advantages and creativity of the technical solution.

Claims

1. A method for preparing a high-efficiency RNA-loaded pesticide nanomotor for killing white-backed planthoppers, characterized in that, The method comprises the following steps: S1, preparing virus-like morphology silica nanoparticles: using cetyltrimethylammonium bromide as a template agent, tetraethyl orthosilicate as a silicon source, and reacting in a two-phase system of an alkaline aqueous phase and a cyclohexane oil phase, then centrifuging, washing, and refluxing in acetone to obtain virus-like morphology silica nanoparticles with branch structures on the surface; S2, asymmetric loading of enzymes: embedding the silica nanoparticles obtained in step S1 in a paraffin film-coated glass slide, immersing in a solution containing polyelectrolyte, glucose oxidase, and sucrase for layer-by-layer self-assembly, then separating and washing the product from the glass slide using tetrahydrofuran to obtain a nanomotor precursor with asymmetrically loaded glucose oxidase and sucrase on the surface; S3, preparation of RNA pesticides: designing and synthesizing target double-stranded RNA according to the CDS sequence of the chitin synthase gene of white-backed planthoppers; S4, loading of RNA pesticides: immersing the nanomotor precursor obtained in step S2 in a solution containing polyelectrolyte and double-stranded RNA obtained in step S3 for treatment, loading the double-stranded RNA on the surface of the nanomotor through electrostatic interaction to obtain a double-enzyme driven RNA pesticide-loaded nanomotor.

2. The production method according to claim 1, characterized by, In step S1, the virus-like morphology silica nanoparticles have a diameter of 50-500 nm, a surface branch length of 5-30 nm, and a BET specific surface area of 100-900 m² / g.

3. The preparation method according to claim 1, characterized in that, In step S2, the polyelectrolyte is at least one selected from polyallylamine hydrochloride, sodium polystyrene sulfonate, hyaluronic acid, polyacrylic acid, chitosan, sodium alginate, polylactic acid-glycolic acid copolymer, and polylactic acid; the concentration of the glucose oxidase and the sucrase in the loading solution is independently 2-20 mg / mL.

4. The method of claim 1, wherein, In step S2, mask plate assisted functionalization is used to load the glucose oxidase and the sucrase mainly on one side of the nanoparticles to form a Janus structure.

5. The preparation method according to claim 1, characterized in that, In step S3, the length of the target double-stranded RNA is 100-900 bp, and preferably a 300 bp specific fragment of the chitin synthase gene of white-backed planthoppers.

6. The production method according to claim 5, wherein The nucleotide sequence of the specific fragment is shown in SEQ ID NO: 1: SEQ ID NO: 1: CACGCTACTTCACTTATCTATTCATTTCCATTTGGAAAATCATTCTCTTCTTCTCCTGTACTACGCTTTTCTACAGAGGTGAAAGCATTTCGAAATTCTTCACGTCAATGTCTACAGGATTCTCTGAGCACAAAATCAGGATAACTGAGGTGCGAGCATCGTATGGAGGAACGAGCCTTCCTGATTTGGCCGATGTCCTAGCCTTTCGATTATCGATATCAACGCTGAGCAGAAGACTGCTTTGATGGTGCTAATTGTGCATATCATTGCTGCCTACTTATGCTACATTTTCGGTAAATTCGCTTGCAAGATTGTCATCCAAGGATTTAGTTATGCATTCCCCGTTAATCTGACCATTCCTGTCACAATATCTGTCCTCATTGCAATGTGTGGCCTCAGACAAGAAGATCCGTAAACGTTCCATGGCACAATTCCAGATTATCTATTCTTCGAGTCGCCGCCGATTTACTTCCTCAACGATTTCATATCTCGACAACATCTGAAATTAGGCGCAGACCTGGATAACACTTCACATTTGGACGCCCAAAGTTGAACGTCTGGCCACTACCGAGAAGCTGTTCGTGCTGCCTATGTAC.

7. The production method according to claim 5 or 6, characterized by, The specific method for synthesizing double-stranded RNA in step S3 is: transforming the plasmid vector containing the target sequence into DE3 competent cells, extracting double-stranded RNA by the chloroform / isopropanol method after IPTG induction expression; in step S4, before loading the RNA, the nanomotor precursor is treated with fluorescently labeled polyelectrolyte for tracing.

8. The production method according to any one of claims 1 to 7, characterized by, The specific process of asymmetrically loading enzyme in step S2 includes: sequentially immersing the glass slide fixed with nanoparticles in polyelectrolyte solution, glucose oxidase solution, polyelectrolyte solution, and sucrose solution for cyclic immersion, and washing with water after each immersion.

9. The double-enzyme-driven RNA-loaded pesticide nanomotor prepared by the method of any one of claims 1-8.

10. The application of the double-enzyme-driven RNA-loaded pesticide nanomotor in the control of Sogatella furcifera (Horváth) according to claim 9, characterized in that, The method comprises the steps of dispersing the nanomotor of claim 9 in water to prepare a suspension with a concentration of 1-50 mg / mL, and spraying the suspension on rice plants damaged by white-backed planthoppers. The method comprises the steps of dispersing the nanomotor of claim 9 in water to prepare a suspension with a concentration of 1-50 mg / mL, and spraying the suspension on rice plants damaged by white-backed planthoppers.

Images