Gene FgPIP1 for regulating and controlling polar growth and pathogenicity of top end of fusarium graminearum and application of gene FgPIP1
By knocking out the FgPIP1 gene in Fusarium graminearum, the ΔFgpip1 mutant was obtained, which solved the problem of apical polarity growth and pathogenicity regulation in Fusarium graminearum, achieving effective control of wheat scab and providing a green control method.
Patent Information
- Application Number
- CN202511854833.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-10
- Publication Date
- 2026-03-17
AI Technical Summary
Existing technologies are insufficient to effectively control the apical polarity growth and pathogenicity of Fusarium graminearum, leading to frequent outbreaks of wheat scab and causing serious losses to grain production.
By knocking out the FgPIP1 gene in Fusarium graminearum, the ΔFgpip1 mutant was obtained, which affected mycelial growth and reduced pathogenicity. This mutant was prepared using genetic engineering technology.
Significantly reducing colony diameter and decreasing pathogenicity to wheat ears provides a new method for the green and ecological control of Fusarium graminearum, and reveals the pathogenic mechanism.
Smart Images

Figure CN121674428A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant disease control, specifically involving a gene that regulates the apical polarity and pathogenicity of Fusarium graminearum. FgPIP1 And its applications. Background Technology
[0002] Fusarium graminearum ( Fusarium graminearum Fusarium head blight (FHB) is a plant pathogenic fungus that mainly infects economic crops such as wheat, corn, and barley. It causes Fusarium head blight, a devastating disease of wheat worldwide (Walter S, Nicholson P, Doohan FM. Action and reaction of hostand pathogen during Fusarium head blight disease. New Phytol. 2010 Jan;185(1):54-66.). With the dramatic changes in climate today, the occurrence of FHB is becoming increasingly frequent, causing increasingly serious losses to the food economy and making it a major problem of particular concern and urgent need for solutions in various countries. Secondary metabolites produced by Fusarium graminearum, such as deoxynivalenol (DON), nivalenol (NIV), and zearalenone (ZEA), can inhibit protein synthesis and have serious toxicity. DON, NIV, and ZEA have been classified as Group 3 carcinogens by the World Health Organization, posing a huge threat to humans and animals (Cleveland TE, Dowd PF, Desjardins AE, Bhatnagar D, Cotty PJ. United States Department of Agriculture-Agricultural Research Service research on pre-harvest prevention of mycotoxins and mycotoxigenic fungi in US crops. Pest Manag Sci. 2003 Jun-Jul;59(6-7):629-42.).
[0003] The apical growth of mycelia is closely related to the development of plant diseases. *Fusarium graminearum* primarily invades host cells through apical hyphae via surface openings, wounds, stomata, or the formation of infection pads. Therefore, identifying and characterizing key genes regulating the apical growth and pathogenicity of *Fusarium graminearum* can provide new scientific evidence for efficient, green, and long-lasting ecological control of Fusarium head blight, and offer new targets for fungicide development. Summary of the Invention
[0004] The purpose of this invention is to provide a gene that regulates the apical polarity and pathogenicity of Fusarium graminearum. FgPIP1 And its applications, the gene deletion Δ Fgpip1 The mutant not only affected the apical growth of Fusarium graminearum mycelium, but also reduced pathogenicity to wheat ears, indicating that... FgPIP1 This gene is crucial for regulating apical growth and pathogenicity in wheat ears within Fusarium graminearum. It is significant for the green ecological control of Fusarium graminearum and is also an important gene resource for studying the apical growth and pathogenic mechanisms of this fungus.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of this invention provides a gene that regulates the apical polarity and pathogenicity of Fusarium graminearum. FgPIP1 Application in the control of wheat scab, the gene FgPIP1 The nucleotide sequence is shown in SEQ ID NO. 1.
[0006] Furthermore, the gene FgPIP1 The amino acid sequence of the encoded protein is shown in SEQ ID NO. 2.
[0007] Furthermore, the wheat scab is caused by Fusarium graminearum.
[0008] Furthermore, by knocking out genes FgPIP1 This aims to inhibit the growth of vegetative mycelia of Fusarium graminearum and reduce its pathogenicity to wheat scab.
[0009] The second aspect of the present invention provides FgPIP1 Gene knockout mutant Δ Fgpip1 The mutant Δ Fgpip1 It uses genetic engineering to knock out FgPIP1 Genes were prepared.
[0010] Furthermore, the mutant Δ Fgpip1 Compared to the wild-type strain, the growth of vegetative mycelia was significantly reduced, the mycelial tips branched more, and the pathogenicity to wheat ears was significantly reduced.
[0011] The third aspect of the present invention provides the above-described mutant Δ Fgpip1 Application in the control of wheat scab, which is caused by Fusarium graminearum.
[0012] The fourth aspect of this invention provides the above-mentioned gene regulating the pathogenicity of Fusarium graminearum. FgPIP1 Application in the pathogenic mechanism of Fusarium graminearum infection in wheat ears.
[0013] The advantages of this invention are: This invention will FgPIP1 After the gene was successfully knocked out from the wild-type strain PH-1 of Fusarium graminearum, the resulting FgPIP1 Gene knockout mutant Δ Fgpip1 The colony diameter decreased, and the pathogenicity to wheat ears was reduced. These results indicate... FgPIP1 The gene mainly regulates the apical polar growth of Fusarium graminearum and the pathogenicity of wheat ears, and plays an important role in the prevention and control of Fusarium graminearum wheat scab. Attached Figure Description
[0014] Figure 1 The results are from the bioinformatics analysis of FgPip1.
[0015] Figure 2 Fusarium graminearum FgPIP1 A schematic diagram of the homologous substitution principle in gene knockout (A) and a diagram of Southern hybridization results (B), using... EcoR V(E) enzyme digestion of wild-type and mutant genomic DNA yielded a 4385 bp band in the wild-type PH-1 strain, and the mutant Δ Fgpip1 A band of size 6498 bp was obtained, which is consistent with the predicted band size.
[0016] Figure 3 Wild-type PH-1, FgPIP1 Gene deletion mutant (Δ) Fgpip1 ) and replenishment strain Δ Fgpip1-C Colony morphology (A) and colony diameter (B) on complete culture medium (CM), as shown in the figure. P A value less than 0.05 indicates a significant difference.
[0017] Figure 4 Subcellular localization of the FgPip1-GFP fusion protein in Fusarium graminearum hyphae.
[0018] Figure 5 Wild-type PH-1, FgPIP1 Gene deletion mutant (Δ) Fgpip1 ) and replenishment strain Δ Fgpip1-C The pathogenicity of wheat ears (A) and the corresponding pathogenicity index (B) are shown in the figure. P A value less than 0.05 indicates a significant difference. Detailed Implementation
[0019] To make the content of this invention easier to understand, the technical solution of this invention will be further described below with reference to specific embodiments, but this invention is not limited thereto.
[0020] The formulation and preparation method of some of the culture media used in the examples are as follows: Complete culture medium (CM) / L: 10 g sucrose, 6 g yeast extract, 6 g acid-hydrolyzed casein, 20 g agar powder, and double-distilled water to a final volume of 1 L.
[0021] Starch yeast culture medium (SYM) / L: 3 g sucrose, 10 g soluble starch, 2 g yeast extract, 20 g agar powder, and double-distilled water to a final volume of 1 L.
[0022] All the above culture media were autoclaved at 121°C for 20 min.
[0023] In this patent, the wild-type strain of *Fusarium graminearum* is PH-1. FgPIP1 Genes in italics FgPIP1 The protein is represented by the orthogonal variant FgPip1. FgPIP1 Gene deletion mutants are represented by Δ Fgpip1 This indicates that the reinjected strain was Δ Fgpip1-C This invention identifies a protein, FgPip1 (FgPea2), that interacts with FgPea2 by searching its mass spectrometry data. i nteracting p rotein 1 Furthermore, the mutant Δ, which regulates the pathogenicity of Fusarium graminearum, Fgpip1 The corresponding gene is FgPIP1 Its nucleotide sequence is SEQ ID NO. 1, and the amino acid sequence of the protein it encodes is SEQ ID NO. 2.
[0024] Figure 1 The results of bioinformatics analysis of FgPip1 show that FgPip1 is found in Aspergillus nidulans (…). Aspergillus nidulans Neurospora crassa ( ) Neurospora crassa Rice blast fungus ( Magnaporthe oryzae ), Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum ), gray mold ( Botrytis cinerea Homologous proteins exist in filamentous fungi such as , while in Saccharomyces cerevisiae ( ) Saccharomyces cerevisiae ), Creta yeast ( Schizosaccharomyces pombe ) and Candida albicans ( Candida albicans No homologous proteins are found in single-celled fungi such as *Ustilago maydis*, nor in basidiomycetes such as *Smuts cornensis*. Furthermore, no homologous proteins are found in humans (…). Homo sapiens ), house mice ( Mus musculus mammalian cells such as rice ( ) Oryza sativa Arabidopsis thaliana ( ) Arabidopsis thaliana The presence of no homologous protein in plant cells such as Fibromyasthenia suggests that the FgPip1 protein is specifically present in filamentous fungi.
[0025] Example 1: Fusarium graminearum FgPIP1 Gene knockout and replacement strain acquisition First, target fragments A (882 bp) and B (842 bp) were amplified from the genomic DNA of *Fusarium graminearum* strain PH-1 using primers FgPIP1-AF / FgPIP1-AR and FgPIP1-BF / FgPIP1-BR, respectively. Hygromycin phosphotransferase gene fragments H1 (798 bp) and H2 (918 bp) were amplified from plasmids containing the hygromycin gene using primers HYG-F / HY-R and YG-F / HYG-R, respectively. Next, the obtained fragments A and H1, and H2 and B, were ligated using SOE-PCR to obtain fragments AH and HB, respectively. Then, protoplasts of wild-type strain PH-1 were prepared using an enzymatic digestion method. Fragments AH and HB (approximately 3 μg each) were simultaneously added to the prepared protoplasts, followed by protoplast transformation mediated by polyethylene glycol (PEG3350). Invert the plates containing the culture medium and incubate them at 28°C for 3-5 days. Pick single colony transformants and extract genomic DNA from each transformant. Verify the candidate transformants using the primers FgPIP1-OF / FgPIP1-OR and FgPIP1-UA / H853, respectively. Further verify the single-copy insertion strains using Southern blotting, as follows: Figure 2 A, Experimental results show Δ Fgpip1-1, Δ Fgpip1-2, Δ Fgpip1-3 and Δ Fgphm1-4 For the correct single-copy insertion mutant ( Figure 2 B), which can be used for subsequent phenotypic determination.
[0026] Obtaining the complement strain: The complement fragment was amplified from the wild-type PH-1 strain genomic DNA using the following primers FgPIP1-CF / FgPIP1-CR and ligated into the pKNTG2 vector. The correctly sequenced vector was then transformed into Δ Fgpip1 In the protoplasts of the mutant, the complemented strain Δ was obtained. Fgpip1-C .
[0027] The primer sequences used are: FgPIP1-AF: 5'-CCCCTGAAGGGTTTGTTAT-3'; FgPIP1-AR: 5'-TTGACCTCCACTAGCTCCAGCCAAGCCGGTAGAGGCGTGAGGAGTG-3'; FgPIP1-BF: 5'-GAATAGAGTAGATGCCGACCGCGGGTTTTGGAGTATGATGATGGGAGT-3'; FgPIP1-BR: 5'-AGCGGATAGAGGGAGTGTC-3'; FgPIP1-OF: 5'- TGGATGGGTATGACGATTTG -3'; FgPIP1-OR: 5'-CATTTGCTGTGCCGTATTT-3'; FgPIP1-UA: 5'-AAAGAGGGCGGCAAATGAC-3'; H853: 5'-GACAGACGTCGCGGTGAGTT-3'; HYG-F: 5'-GGCTTGGCTGGAGCTAGTGGAGGTCAA-3'; HY-R: 5'-GTATTGACCGATTCCTTGCGGTCCGAA-3'; YG-F: 5'-GATGTAGGAGGGCGTGGATATGTCCT-3'; HYG-R: 5'-AACCCGCGGTCGGCATCTACTCTATTC-3'; FgPIP1-CF: 5'-AGGGAACAAAAGCTGGGGTACCTGCGATAGAATCTGTCGTAGC-3'; FgPIP1-CR: 5'-GCCGCCGCCGCCGCCAAGCTTGACGTTGCCACTGAGCGTCT-3'.
[0028] Example 2: Δ Fgpip1 Colony growth analysis of deletion mutants In order to observe FgPIP1 Does gene deletion affect the mycelial growth of Fusarium graminearum? This was investigated by comparing wild-type PH-1 and... FgPIP1 Deletion mutant (Δ) Fgpip1 ) and replenishment strains (Δ Fgpip1-C Transferred to complete culture medium (CM) and incubated upside down at 28°C for 3 days. Observe colony morphology and measure colony diameter. Figure 3 As shown in AB, compared with wild-type strain PH-1 and complement strain Δ Fgpip-C In comparison, Δ Fgpip1 The mutant colony diameter was significantly smaller, while the hyphal tips had more branches, indicating that... FgPIP1Gene deletion significantly affects the colony growth and hyphal branching of Fusarium graminearum.
[0029] Example 3: Subcellular localization of FgPip1 protein in Fusarium graminearum To observe which parts of Fusarium graminearum the FgPip1 protein is localized to, we used the complement strain Δ containing green fluorescent protein (GFP). Fgpip1-C FgPip1-GFP was inoculated into SYM yeast medium, and the fluorescence signal was observed. The results showed that FgPip1-GFP specifically aggregated at the tips of hyphae and co-localized with the polar body complex component FgPea2-mCherry, indicating that FgPip1 is mainly localized in the acrosome at the hyphal tips. Figure 4 ).
[0030] Example 4: Fusarium graminearum Δ Fgpip1 Pathogenicity analysis of mutants to wheat ears To analyze whether FgPip1 is involved in the pathogenicity of Fusarium graminearum, wild-type PH-1 and ΔPip1 were compared. Fpip1 Mutants and complement strains Δ Fgpip1-C Inoculate the middle of the wheat ear during the flowering stage, and mark the inoculation point with a marker. Figure 5 A, black spots), bagged and kept moist for 7 days, photographed after 14 days and the incidence of disease in different strains was statistically analyzed. For example... Figure 5 As shown in A, Δ Fgpip1 The mutant exhibits significantly reduced pathogenicity to wheat ears, showing only mild lesions at the inoculation site that fail to spread to adjacent grains, with a pathogenicity index of approximately 3. Figure 5 B), while wild-type PH-1 and the reintroduced strain Δ Fgpip-C The lesions on the inoculated wheat ears were very obvious and extended to the entire ear, with a pathogenicity index of around 16, indicating that FgPip1 is essential for Fusarium graminearum infection of wheat ears.
[0031] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.
Claims
1. Genes that modulate apical growth and pathogenicity of Fusarium graminearum FgPIP1 Use in the control of wheat scab, characterized in that: The nucleotide sequence of the gene FgPIP1 is shown as SEQ ID NO.
1.
2. Use according to claim 1, characterized in that: The gene FgPIP1 The amino acid sequence of the encoded protein is set forth in SEQ ID NO.
2.
3. Use according to claim 1, characterized in that: The wheat scab is caused by Fusarium graminearum.
4. Use according to claim 1, characterized in that: By knocking out genes FgPIP1 To achieve inhibition of the growth of vegetative hyphae of F. graminearum and reduction of pathogenicity to wheat scab.
5. A kind FgPIP1 Gene knockout mutant Δ Fgpip1 Its features are: The mutant Δ Fgpip1 is prepared by knocking out FgPIP1 the gene by genetic engineering means.
6. The mutant Δ of claim 5 Fgpip1 characterized in that The mutant Δ Fgpip1 Compared with the wild type strain, the hyphal growth was significantly decreased and the hyphal tip branches were more.
7. The mutant Δ of claim 5 Fgpip1 characterized in that The mutant Δ Fgpip1 The pathogenicity to wheat spikes was significantly decreased compared with the wild type strain.
8. Mutant Δ according to any one of claims 5 to 7 Fgpip1 Use in the control of wheat scab, characterized in that The wheat scab is caused by Fusarium graminearum.