Application of different transcripts of potato StB3-like in anthocyanin biosynthesis
By integrating single-molecule real-time sequencing and next-generation sequencing technologies, alternative splicing transcripts of the potato StB3-like gene were identified, solving the problem of unclear regulatory mechanisms of anthocyanin accumulation in potatoes, achieving precise optimization of anthocyanin content, and cultivating colored potato varieties with high nutritional value.
Patent Information
- Application Number
- CN202610133797.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-30
- Publication Date
- 2026-03-17
AI Technical Summary
In the current technology, the regulatory mechanism of anthocyanin accumulation in potatoes is not fully understood, which limits the improvement of anthocyanin content and antioxidant activity in colored potatoes, making it difficult to achieve efficient breeding through gene regulation.
By integrating single-molecule real-time sequencing and next-generation sequencing technologies, the transcriptome of potato varieties with different colors was analyzed, and three alternative splicing transcripts of the StB3-like gene (StB3-like-1, -2, and -3) were identified. These transcripts were co-expressed with StAN1, which significantly increased anthocyanin accumulation.
The regulatory function of the StB3-like gene in anthocyanin biosynthesis was clarified, enabling precise optimization of anthocyanin content and the cultivation of a new type of colored potato variety with a stable increase in anthocyanin content, thereby enhancing its nutritional value and market competitiveness.
Smart Images

Figure CN121674471A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and relates to the integration of single-molecule real-time sequencing and next-generation sequencing technologies to reveal the alternative splicing-mediated regulatory mechanism of anthocyanin accumulation in potatoes, particularly concerning potatoes. StB3-like Applications of different transcripts in anthocyanin biosynthesis. Background Technology
[0002] As a dual-purpose crop (grain and vegetable), potatoes are rich in starch, protein, potassium, phosphorus, and other minerals, as well as vitamins B and C. They possess nutritional and health benefits such as anti-aging, regulating gastrointestinal function, and controlling blood pressure. Compared to traditional white or yellow-fleshed varieties, colored potatoes not only exhibit greater phenotypic diversity, but also have 3-4 times higher anthocyanin content and 2.5-3 times higher antioxidant activity.
[0003] Anthocyanins are an important class of flavonoid compounds, widely found in the cell sap of various plant organs, and belong to the water-soluble phenolic pigments. Colored potatoes possess excellent photothermal stability, high yield, strong environmental adaptability, and low production costs, making them a promising source of natural pigments and antioxidants with broad application prospects in the field of functional food development.
[0004] Alternative splicing refers to the process by which a single precursor messenger RNA (pre-mRNA) produces multiple mature messenger RNAs (mRNAs) through different splicing mechanisms, ultimately enabling the same gene to encode multiple different proteins. There are five main types of alternative splicing in organisms: exon skipping (ES), variable 5' splice site (A5), variable 3' splice site (A3), intron retention (IR), and mutually exclusive exons (MEE). Studies have shown that alternative splicing plays a crucial role in many physiological processes in plants, including stress response, diurnal rhythm regulation, and growth and development. For example, in cornflower... CcbHLH1 Alternative splicing of genes can prevent them from interacting with... CcMYB6-1 Synergistic activation of the anthocyanin synthesis pathway ultimately results in white petals; in tea trees CsbHLH133 Different splicing variants of the gene can respond to various abiotic stresses through specific regulatory modes, thereby regulating the synthesis of geraniol; in chili peppers CA10g11690 Alternative splicing of genes is involved in regulating the development of purple exocarps. The above studies indicate that alternative splicing events play a crucial role in anthocyanin accumulation in plants. Although some alternative splicing events have been identified at different developmental stages of plants, the underlying regulatory mechanisms still require further investigation, and related research urgently needs to be carried out. Summary of the Invention
[0005] To address the shortcomings of the existing technologies, this invention integrates SMRT sequencing and RNA-seq technologies to perform transcriptome analysis on three growth stages of three potato varieties with different colors: tuber development, tuber enlargement, and tuber harvest. This analysis identified differentially expressed genes and alternative splicing-related genes in the anthocyanin synthesis pathway and confirmed... StB3- like The co-expression of three alternative splicing transcripts of the gene with StAN1 has a differential regulatory effect on anthocyanin accumulation, laying a solid foundation for further research on the molecular mechanism of potato anthocyanins.
[0006] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution: One of the objectives of this invention is to provide StB3-like The application of genes in the regulation of anthocyanin biosynthesis, the aforementioned StB3-like The nucleotide sequence of the gene is shown in SEQ ID NO. 1.
[0007] Furthermore, the aforementioned StB3-like The gene includes three transcripts, StB3-like-1, StB3-like-2 and StB3-like-3, whose nucleotide sequences are shown in SEQ ID NO.2 to SEQ ID NO.4.
[0008] Furthermore, among the three transcripts, StB3-like-2 and StB3-like-3, when co-expressed with StAN1, have a positive regulatory effect on anthocyanin biosynthesis and can significantly increase anthocyanin accumulation.
[0009] The second objective of this invention is to provide a primer combination for amplifying the three transcripts, the nucleotide sequences of which are shown in SEQ ID NO.5~SEQ ID NO.8.
[0010] A third objective of this invention is to provide a reagent kit containing the aforementioned primer combination.
[0011] The fourth objective of this invention is to provide a recombinant expression vector containing the three transcripts mentioned above.
[0012] The fifth objective of this invention is to provide a host bacterium containing the three transcripts or the recombinant expression vector.
[0013] The sixth objective of this invention is to provide the application of the primer combination, the kit, the recombinant expression vector, or the host bacterium in anthocyanin biosynthesis breeding in crops.
[0014] Furthermore, the crop can be any one of the crops whose coloring depth needs to be improved.
[0015] Furthermore, the crop can be any one of the crops that can produce anthocyanin-containing products.
[0016] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention analyzes the accumulation characteristics of anthocyanins in potatoes of different colors (yellow, red and purple potatoes) at different developmental stages (tuber formation period, tuber enlargement period and tuber maturity period), including the expression characteristics of related anthocyanins and the expression level of key structural genes.
[0017] (2) This invention preliminarily clarified the regulatory functions of potato StB3-like-1, -2, and -3 genes in anthocyanin biosynthesis. Transient overexpression experiments confirmed that co-injection of StB3-like-2 / -3 with StAN1 promoted anthocyanin accumulation, while co-injection of StB3-like-1 with StAN1 had no significant effect on anthocyanin accumulation. Quantitative analysis of anthocyanins... StB3-like The three alternative splicing transcripts can differentially regulate the biosynthesis and accumulation of specific anthocyanin compounds.
[0018] (3) The StB3-like-1, -2, -3 genes and their related primers, vectors and host bacteria provided by the present invention can be directly applied to potato molecular breeding. By regulating the expression level of these genes, the anthocyanin content of potatoes can be precisely optimized. This can provide nutritionally fortified varieties for the development of functional foods and has broad application prospects.
[0019] In summary, this invention provides a pathway for the biosynthesis of anthocyanins in potatoes and identifies genes related to anthocyanin synthesis in potatoes. StB3-like The application of the three transcripts in anthocyanin biosynthesis can help to efficiently cultivate new colored potato varieties with stable anthocyanin content, thereby enhancing their nutritional value and market competitiveness, making them more suitable for the development and application of functional foods, natural pigments and healthy dietary products. Attached Figure Description
[0020] Figure 1 The CDS, APA, and AS events predicted by SMRT sequencing data analysis in Example 1 of this invention; Figure 2 Analysis of differentially expressed genes in Example 1 of this invention; Figure 3 This study analyzes the expression levels of anthocyanin-related genes at different developmental stages in three varieties of the present invention, as described in Example 1 of this invention. Figure 4 This is an analysis of the expression patterns of transcription factor families in transcripts from Example 1 of the present invention; Figure 5This invention provides a preliminary functional identification of StB3-like-1,-2, and-3 in anthocyanin synthesis using a tobacco instantaneous color development experiment in Example 1. Figure 6 Anthocyanin metabolomics analysis of leaves from different transcript injection groups in Example 1 of this invention; Figure 7 This is an analysis of differential metabolites in leaves from different transcript injection groups in Example 1 of the present invention; Figures 8-10 The sequencing results of StB3-like-1, -2, and -3 and the alignment results of the reference gene are shown in Example 1 of this invention. Detailed Implementation
[0021] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. The reagents, products, and instruments used in the following examples are all commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventionally used methods.
[0022] The technical solution of the present invention will be further described in detail below with reference to the embodiments.
[0023] Example 1 1. Preparation of plant materials The potato clones used in this study included the yellow-skinned variety 'Xin Daping', the red-skinned variety 'Lingtian Hongmei', and the purple-skinned variety 'Heimeiren', all of which were cultivated at the Dingxi Academy of Agricultural Sciences in Gansu Province. Potato tubers were collected on day 100 (S1, tuber development stage), day 130 (S2, tuber enlargement stage), and day 150 (S3, tuber harvest stage) after sowing. Single tuber samples were collected from each plant at each growth stage for each variety, with an average of 5 tubers per plant. All samples were replicated in triplicate. After collection, the samples were rapidly flash-frozen in liquid nitrogen and then stored at -80°C for later use.
[0024] 2. RNA extraction, library construction, and real-time single-molecule sequencing RNA was extracted from potato tubers using the TaKaRa polysaccharide-polyphenol RNA extraction kit. RNA integrity and concentration were assessed by 1% agarose gel electrophoresis and a Nanodrop ND-2000 nucleic acid analyzer. Subsequently, full-length cDNA was synthesized using the SMARTer™ PCR cDNA synthesis kit with mRNA as a template, and amplified by PCR. End repair was performed on the amplified full-length cDNA, followed by ligation of SMRT dumbbell adapters. The cDNA was then digested with exonucleases, and sequencing libraries were constructed and high-throughput sequencing was performed. We used COG, GO, KEGG, KOG, Pfam, Swiss-Prot, eggNOG, and NR to perform functional annotation of proteins encoded by new transcripts, and also predicted coding sequences (CDSs), polyA sites, and AS events.
[0025] Experimental results are as follows Figure 1 As shown.
[0026] 3. Differentially expressed gene analysis Using functional annotation and classification from databases such as KEGG, we analyzed differentially expressed genes in three potato clones, including related anthocyanin biosynthesis characteristics and expression levels of key structural genes.
[0027] Experimental results are as follows Figure 2 , Figure 3 As shown.
[0028] 4. Alternative splicing analysis and expression analysis of anthocyanin biosynthesis structural genes and transcription factors By alternative splicing analysis of structural genes and transcription factors related to anthocyanin biosynthesis, transcription factors that may be involved in anthocyanin biosynthesis were screened out, and their expression levels were analyzed.
[0029] Experimental results are as follows Figure 4 As shown.
[0030] 5. StB3-like Cloning and Recombinant Vector Construction of Different Transcripts Through analysis of alternative splicing events, a transcription factor related to anthocyanin biosynthesis was finally identified. StB3-like ( Soltu.DM.04G010530This gene can produce three different transcripts, StB3-like-1, -2, and -3, through alternative splicing. This invention clones StB3-like-1, -2, and -3 as target genes and analyzes the roles of these three transcripts in anthocyanin biosynthesis. The target gene sequence was located based on the potato whole genome sequence. Primers for target gene amplification were used: StB3-like-1 primer sequence: 5'-atgtttcgtttttctcactgctgtt-3' (SEQ ID NO.5); StB3-like-2 primer sequence: 5'-atgcaaaaaattgacattagtttaccac-3' (SEQ ID NO.6); StB3-like-3 primer sequence: 5'-atgagtttaccacaagaagagcag-3' (SEQ ID NO.7); and reverse primer: 5'-ctatacctttggccgtgatgg-3' (SEQ ID NO.8). The primer sequences were submitted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. High-fidelity polymerase (PrimeSTAR) from Takara was used. The cDNA of purple potato variety was amplified using HS DNA Ploymerase. The specific PCR reaction system and amplification procedure are shown in Tables 1 and 2.
[0031] Table 1 PCR reaction system
[0032] Table 2 PCR amplification cycles
[0033] After the target fragment was amplified, the PCR product was detected by gel electrophoresis to verify its integrity. The verified intact PCR product was then recovered using the DNA gel extraction kit from JianShi Biotechnology; specific procedures were followed by referring to the instruction manual. The concentration of the obtained purified PCR product was determined using a micro spectrophotometer before subsequent vector ligation experiments.
[0034] Single-clone bacterial cultures with brighter bands were selected and cultured overnight, followed by plasmid extraction and sequencing. The sequencing results are as follows: Figures 8-10 As shown in the figure. Sequencing results analysis revealed that the gene sequences of the cloned StB3-like-1, -2, and -3 had similarities of 98.10%, 97.86%, and 97.82% with the reference genome, respectively.
[0035] StB3-like -1, -2, -3 nucleotides (SEQ ID NO.2~SEQ ID NO.4) such as Figures 8-10 As shown.
[0036] StB3-like (SEQ ID NO.1) >Soltu.DM.04G010530|genomic : StB3-like-1(SEQ ID NO.2): ATGTTTCGTTTTTCTCACTGCTGTTCCCAAAAGCTAATGCAAAAAATTGACATTAGTTTACCACAAGAAGAGCAGCCGGTAGAGATGGTAGACAGGAGGGAAGAGCATCCGGCAGAGACGGCAGCCAGACCGGAAAAGCAGCCAGCAGGGATGGCAAACAGACAAGGGCAAGGGGAACCAAAACCGGTGGATATCCCGGAGATAACCCCTCACTTCTTCAAGATTATCCTGTCTCCCCATGCCTCTAAATTACACATCCCTAATGAATTTGTAACCGAGCATGGCGCTAATCTGGGGGATATTGTGTTGCTTGAGGTCCCAAATGGTGTGGTATGGAAAATAAAATTGCTTAACTCTAGTGGCATGGTATGGTTAAATGAAGGCTGGAACAAATTCAAGGAGTACTATTCAATTGCTTGTGGCTACTTTTTACTCTTCAGATACAAAGGAAATTCCCAGTTCTCTGTGTTTATATTTGATTTAAGTGCTTCTGAGATTGAGTATCCTCCTGGCCCAAATGAAGATATGACACCAGAGAATCGATCTGTTCTGTGCGTGCCACCAGAGGAAAACGGGATAAACTTAACCCCACCCGGTGAGCCACCAAAGGAGAACAGGATAAACTTAACCCCACCCGATGATCCACCAGAGGAAGATGTGATATACTTACCCCCACCTGGTATTTACACCATGGAGGAGTTATCATTGTCATCCATGCCATCACGGCCAAAGGTATAG StB3-like-2(SEQ ID NO.3): ATGCAAAAAATTGACATTAGTTTACCACAAGAAGAGCAGCCGGTAGAGATGGTAGACAGGAGGGAAGAGCATCCGGCAGAGACGGCAGCCAGACCGGAAAAGCAGCCAGCAGGGATGGCAAACAGACAAGGGCAAGGGGAACCAAAACCGGTGGATATCCCGGAGATAACCCCTCACTTCTTCAAGATTATCCTGTCTCCCCATGCCTCTAAATTACACATCCCTAATGAATTTGTAACCGAGCATGGCGCTAATCTGGGGGATATTGTGTTGCTTGAGGTCCCAAATGGTGTGGTATGGAAAATAAAATTGCTTAACTCTAGTGGCATGGTATGGTTAAATGAAGGCTGGAACAAATTCAAGGAGTACTATTCAATTGCTTGTGGCTACTTTTTACTCTTCAGATACAAAGGAAATTCCCAGTTCTCTGTGTTTATATTTGATTTAAGTGCTTCTGAGATTGAGTATCCTCCTGGCCCAAATGAAGATATGACACCAGAGAATCGATCTGTTCTGTGCGTGCCACCAGAGGAAAACGGGATAAACTTAACCCCACCCGGTGAGCCACCAAAGGAGAACAGGATAAACTTAACCCCACCCGATGATCCACCAGAGGAAGATGTGATATACTTACCCCCACCTGGTATTTACACCATGGAGGAGTTATCATTGTCATCCATGCCATCACGGCCAAAGGTATAG StB3-like-3(SEQ ID NO.4): ATGAGTTTACCACAAGAAGAGCAGCCGGTAGAGATGGTAGACAGGAGGGAAGAGCATCCGGCAGAGACGGCAGCCAGACCGGAAAAGCAGCCAGCAGGGATGGCAAACAGACAAGGGCAAGGGGAACCAAAACCGGTGGATATCCCGGAGATAACCCCTCACTTCTTCAAG ATTATCCTGTCTCCCCATGCCTCTAAATTACACATCCCTAATGAATTTGTAACCGAGCATGGCGCTAATCTGGGGGATATTGTGTTGCTTGAGGTCCCAAATGGTGTGGTATGGAAAATAAAATTGCTTAACTCTAGTGGCATGGTATGGTTAAATGAAGGCTGGAACAAAT TCAAGGAGTACTATTCAATTGCTTGTGGCTACTTTTTACTCTTCAGATACAAAGGAAATTCCCAGTTCTCTGTGTTTATATTTGATTTAAGTGCTTCTGAGATTGAGTATCCTCCTGGCCCAAATGAAGATATGACACCAGAGAATCGATCTGTTCTGTGCGTGCCACCAGA GGAAAACGGGATAAACTTAACCCCACCCGGTGAGCCACCAAAGGAGAACAGGATAAACTTAACCCCACCCGATGATCCACCAGAGGAAGATGTGATATACTTAACCCCCACCTGGTATTTACACCATGGAGGAGTTATCATTGTCATCCATGCCATCACGGCCAAAGGTATAG 6. Transient expression experiment and analysis in tobacco 6.1 Tobacco Leaf Color Development Experiment The functions of StB3-like -1, -2, and -3 in regulating anthocyanin biosynthesis were preliminarily determined using a transient expression colorimetric assay in tobacco. The specific procedures are as follows: (1) Activation and culture of Agrobacterium: The bacterial culture stored at -80℃ was spread on LB solid medium containing Kan+Rif and cultured upside down in the dark at 28℃ for 2 days.
[0037] (2) Use an inoculation loop to scrape the cultured Agrobacterium, fill a loop, place it in the infection solution, and let it stand at 28°C for 1 h. Gently invert the loop to allow the bacterial solution at the bottom to float, and let it stand for another 1 h. The concentration of the bacterial solution OD600 should be between 0.8 and 1.0. Try to complete the bacterial solution injection within 3 h to avoid damage to the viability of the Agrobacterium strain.
[0038] (3) Healthy tobacco plants (Nc89) selected at the appropriate time for injection were used for tobacco. StAN1+EV was injected into one side of the tobacco leaf as a positive control, and StAN1+StB3-like-1 / -2 / -3 was injected into the other side of the leaf. The needle was removed with a 1mL syringe, and the bacterial solution was slowly injected into the back of the tobacco. After injection, the tobacco was briefly darkened and then cultured in an artificial climate chamber. Leaf color changes were observed after 3-5 days, and samples were taken for anthocyanin content determination.
[0039] 6.2 Determination of anthocyanin content The anthocyanin content in transiently expressed tobacco leaves was determined using the pH differential method. The specific experimental method was based on the instructions for the Plant Anthocyanin Content Detection Kit (BC1385, Solarbio).
[0040] Experimental results are as follows Figure 5 As shown.
[0041] from Figure 5 It can be seen that anthocyanins accumulated in leaves injected with StAN1+EV and those injected with a mixture of StAN1+StB3-like-1 / -2 / -3. Anthocyanin content analysis revealed that the highest anthocyanin content was observed in leaves injected with the mixture of StAN1+StB3-like-3, while no change was observed in leaves injected with StAN1+StB3-like-1. These results suggest that StB3-like-1 / -2 / -3 may differentially regulate anthocyanin biosynthesis.
[0042] 6.3 Detection of Differential Anthocyanin Metabolites Samples transiently overexpressing StAN1+EV and StAN1+StB3-like-1 / -2 / -3 were freeze-dried, ground, and then subjected to 50% methanol aqueous solution (containing 0.1% hydrochloric acid). The mixture was vortexed, sonicated, and centrifuged. The supernatant was then filtered through a microporous membrane (0.22 μm pore size), and anthocyanin metabolite targeting analysis was performed using UPLC-MS / MS to identify the types of anthocyanins.
[0043] Experimental results are as follows Figure 6 , Figure 7 As shown.
[0044] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. StB3-like Use of genes in the regulation of anthocyanin biosynthesis, characterized in that, The StB3-like The nucleotide sequence of the gene is shown as SEQ ID NO.
1.
2. Use according to claim 1, characterized in that, The StB3-like The gene includes three transcripts StB3-like-1, StB3-like-2 and StB3-like-3, the nucleotide sequences of which are shown as SEQ ID NO. 2~ SEQ ID NO.
4.
3. Use according to claim 2, characterized in that, Among the three transcripts, StB3-like-2 and StB3-like-3 have positive regulation on anthocyanin biosynthesis when co-expressed with StAN1, and can significantly increase the accumulation of anthocyanin.
4. A primer combination, characterized by It is used for amplifying the three transcripts in the application of claim 2, and the nucleotide sequences are shown as SEQ ID NO. 5~SEQ ID NO.
8.
5. A kit characterized in that, The primer combination of claim 4 is contained therein.
6. A recombinant expression vector, characterized in that, The three transcripts in the application of claim 2 are contained therein.
7. A host cell, wherein, The three transcripts in the application of claim 2 or the recombinant expression vector of claim 6 are contained therein.
8. The primer combination of claim 4, the kit of claim 5, the recombinant expression vector of claim 6 or the host bacteria of claim 7 are used in the breeding of crop anthocyanin biosynthesis.
9. Use according to claim 8, characterized in that, The crop is any one of crops that need to improve the color depth.
10. Use according to claim 8, characterized in that, The crop is any one of crops that can produce anthocyanin-containing products.