VabHLH016 gene capable of improving cold resistance of plants and application of VabHLH016 gene
By introducing the VabHLH016 gene into plants and constructing a recombinant expression vector, the damage problem of grapes and other plants under low temperature stress was solved, their cold resistance was enhanced, they were able to adapt to cold environments, and stable yields and increased income were promoted.
Patent Information
- Application Number
- CN202610150014.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-03
- Publication Date
- 2026-03-17
AI Technical Summary
In existing technologies, plant varieties such as grapes are easily damaged under low temperature stress, resulting in limited growth and yield loss. Traditional agricultural cold protection methods are time-consuming and inefficient, and the breeding process is complex.
The VabHLH016 gene was introduced and expressed. It was introduced into host cells such as grape or Arabidopsis thaliana through recombinant expression vectors such as pCAMBIA2300-VabHLH016-GFP, using Agrobacterium-mediated transformation or inflorescence dipping, thereby enhancing the cold resistance of the plants.
It improves the survival vitality of plants in low-temperature environments, reduces chilling injury symptoms, maintains normal physiological state, adapts to cultivation in high-latitude or cold regions, and promotes stable production and increased income in the fruit tree industry.
Smart Images

Figure CN121674473A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular breeding technology, and in particular to the VabHLH016 gene for improving plant cold resistance and its application. Background Technology
[0002] As a widely cultivated economic crop globally, grape yield and quality are largely limited by environmental temperature. Currently, the cultivation areas of mainstream high-quality Eurasian grape varieties are often constrained by severe winters and spring frosts. Under annual cyclical low-temperature stress, vines are prone to frost damage to branches and vines, bud death, and even overall frost damage, leading to direct economic losses and orchard reconstruction costs. To address this challenge, traditional agricultural practices mainly rely on physical cold protection methods, such as the winter burial technique widely used in northern production areas. While this technique has some effectiveness, it requires significant manpower and resources and may adversely affect soil structure, vine roots and stems, and mechanized field operations. Furthermore, burial cannot withstand sudden low temperatures during the growing season, such as the devastating impact of late frosts on young inflorescences and new shoots. From a breeding perspective, introducing the strong cold-resistance traits of wild grapes into cultivated varieties through conventional hybridization is a time-consuming and complex process of trait segregation.
[0003] Therefore, developing a new method and resource that can effectively integrate modern biotechnology to enhance the inherent cold resistance of superior cultivars in a targeted and efficient manner while maintaining their inherent quality traits is of great theoretical and applied value for breaking through traditional technical bottlenecks and promoting the sustainable development of the grape industry to a wider range of suitable planting areas. Summary of the Invention
[0004] The purpose of this invention is to provide the VabHLH016 gene and its application to improve the cold resistance of plants, and to solve the technical problem in the prior art that the cold resistance of grape and other plant varieties is insufficient, and they are easily damaged under low temperature stress, resulting in limited growth and yield loss.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides the application of a gene encoding the VabHLH016 protein, as shown in SEQ ID NO: 2, in improving plant cold resistance.
[0006] This invention provides the application of the VabHLH016 protein shown in SEQ ID NO: 2 in improving plant cold resistance.
[0007] This invention provides an application of a recombinant expression vector in improving the cold resistance of plants, wherein the recombinant expression vector contains the aforementioned gene.
[0008] Preferably, the recombinant expression vector is pCAMBIA2300-VabHLH016-GFP.
[0009] This invention provides an application of host cells in improving plant cold resistance, wherein the host cells contain the above-mentioned recombinant expression vector.
[0010] The present invention provides a method for preparing transgenic plants with improved cold resistance, comprising the steps of introducing the above-mentioned gene into the plant and causing it to be expressed.
[0011] Preferably, the plant is grape or Arabidopsis thaliana.
[0012] Preferably, the introduction step is achieved by Agrobacterium-mediated genetic transformation or inflorescence dipping.
[0013] This invention provides a transgenic plant with improved cold resistance, characterized in that it is prepared by the above method.
[0014] The present invention provides a kit for improving the cold resistance of plants, characterized in that it contains the above-mentioned gene, or recombinant expression vector, or host cell.
[0015] The beneficial effects of this invention are: This invention provides a VabHLH016 gene derived from wild grapes and its application scheme, which can effectively improve the cold resistance of recipient plants. The direct effect is that plants treated with this technology exhibit stronger survival vitality and milder chilling injury symptoms when exposed to low temperatures, and are better able to maintain normal physiological states. This provides new genetic resources and technical approaches to address the cultivation limitations of warm-loving crops such as grapes in high-latitude or cold regions, and has significant application value for breeding new cold-resistant varieties and ensuring stable yields and increased income in the fruit industry. Attached Figure Description
[0016] Figure 1 Gene domains (A), conserved protein domains (B), and homology analysis (C) of VabHLH016. Note: KAL6349496.1: Vitis variegata; XP_034709230.1: Vitis rivularis; WIE96196.1: Loropetalum chinense; KAK9275463.1: Liquidambar formosana; AST25607.1: Rubber tree; Figure 2 Tissue-specific expression analysis of VabHLH016 (A), low temperature (B), and expression pattern analysis under exogenous hormone treatment (CF). Note: XDL: 'Chardonnay'; ZS-1: 'Zuoshan-1'; Figure 3Subcellular localization of VabHLH016 (A) and analysis of transcriptional autoactivation activity in yeast (B). Note: A: Transient expression of VabHLH016-GFP and empty vector control in tobacco epidermal cells. Laser channels are GFP fluorescence (488 nm); mCherry fluorescence (567 nm); chloroplast autofluorescence; bright field; combined plot. mCherry red fluorescence represents nuclear protein marker. Scale bar for 35S-GFP and VabHLH016-GFP is 50 μm. B: Transcriptional activity of VabHLH016 in yeast. Yeast colonies were seeded on SD / -Trp solid medium plates supplemented with 40 μg / mL X-α-Gal and 200 ng / mL AbA to assess growth and reporter gene activation. P53-BD + T-AD and Lam-BD + T-AD were used as positive and negative controls, respectively. Figure 4 This study analyzed the phenotypic changes and physiological and biochemical parameters of wild-type and transgenic Arabidopsis thaliana lines before and after low-temperature stress treatment. Note: A: Phenotypic changes in Arabidopsis thaliana after 14 h of treatment at -4℃; BE: Physiological and biochemical parameters of Arabidopsis thaliana after 14 h of treatment at -4℃; WT: Wild-type Arabidopsis thaliana; OE: Arabidopsis thaliana overexpressing VabHLH016. Error bars represent the mean ± SD of three biological replicates. An asterisk (*) indicates a significant difference between WT and transgenic lines under the same conditions (** P < 0.01). Figure 5 This represents the expression of cold resistance-related genes in wild-type and transgenic Arabidopsis thaliana lines before and after low-temperature stress treatment. Note: Error bars represent the mean ± SD of three biological replicates; an asterisk (*) indicates a significant difference between wild-type and transgenic Arabidopsis thaliana under the same conditions. Figure 6 This study analyzed the phenotypic, fresh weight changes, and physiological and biochemical parameters of wild-type and transgenic callus before and after low-temperature stress treatment. Note: A: Phenotypic changes of callus treated at 4℃ for 10 days; B: Fresh weight changes of callus treated at 4℃ for 10 days; CF: Phenotypic and biochemical parameter changes of callus treated at 0℃ for 3 hours; WT: Wild-type callus; OE: Callus overexpressing VabHLH016 (OE-VabHLH016). Error bars represent the mean ± SD of three biological replicates. An asterisk (*) indicates a significant difference between WT and transgenic lines under the same conditions (** P < 0.01). Figure 7 The expression of cold resistance-related genes in wild-type and transgenic callus before and after low-temperature stress treatment. Note: Error bars represent the mean ± SD of three biological replicates; an asterisk (*) indicates a significant difference between wild-type and transgenic callus under the same conditions. Figure 8For the base sequence alignment of VabHLH016 and VvbHLH016; Figure 9 Codon usage preferences and protein structural characteristics of the VabHLH016 gene; Figure 10 Physicochemical property analysis of VabHLH016 protein. Note: A: Prediction of phosphorylation sites in VabHLH016 protein; B: Prediction of hydrophilic / hydrophobic amino acid composition in VabHLH016 protein; C: Prediction of signal peptide in VabHLH016 protein; D: Prediction of transmembrane structure in VabHLH016 protein. Figure 11 This document outlines the screening and identification process for transgenic Arabidopsis thaliana lines. Note: A: T0 generation Arabidopsis thaliana seeds cultured on MS plates containing Kan; B: Resistance-positive seedlings; C: Surviving resistance-positive seedlings; D: Collection and identification of positive Arabidopsis thaliana seeds; E: PCR identification; F: RT-PCR identification; G: qRT-PCR identification; WT: Wild-type Arabidopsis thaliana; OE: Arabidopsis thaliana overexpressing VabHLH016. Figure 12 Semi-quantitative and quantitative identification of 'Chardonnay' wilted callus. Note: WT: wild-type callus; OE: VabHLH016 overexpressing callus (OE-VabHLH016). Detailed Implementation
[0017] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0018] The core sequences involved in the embodiments are as follows: VabHLH016-CDS sequence VabHLH016 protein sequence: As shown in SEQ ID NO.2; Amino acid number: 663, relative molecular mass (Da): 72774.89, isoelectric point (PI): 5.52, molecular formula: C 3135 H 4958 N 910 O 1034 S 26 Total number of atoms: 10063; Number of negatively charged residues (Asp + Glu): 83; Number of positively charged residues (Arg + Lys): 70.
[0019] Example 1. Overview of the Solution To explore potential cold-resistant gene resources, this invention uses the wild grape 'Zuoshan-1' ( Vitis amurensis Using cv.'Zuoshan-1' as material, cloned... VabHLH016 Genes were analyzed and subjected to bioinformatics analysis. This was done to further elucidate... VabHLH016 This invention analyzes the expression patterns of genes under low temperature stress and exogenous hormone regulation, and verifies their cold resistance function based on this analysis, in order to provide candidate genes for cold-resistant molecular breeding.
[0020] 2 Materials and Methods 2.1 Test Materials Two-year-old potted wild grape 'Zuoshan-1' seedlings cultivated in the research greenhouse of the North Campus of Ningxia University were selected, and the fully expanded young leaves from the top 4-5 nodes were used as... VabHLH016 Cloning materials for genes and their promoters. 'Zuoshan-1' and 'Chardonnay' grapes were obtained from the Pingjibao "Ningxia Modern Agricultural Comprehensive Development Engineering Technology Research" grape demonstration base. Vitis vinifera ‘ The roots, stems, mature leaves, young leaves, and tendrils of *Chardonnay* were used for tissue expression specificity studies. Cuttings of *Zuoshan-1* grape were planted in a vermiculite-perlite-substrate (1:1:3) mixture and cultured at 25°C under 20,000 Lux, 16 h light / 8 h dark conditions for low-temperature stress and exogenous hormone expression pattern studies. Subcellular localization was performed using *Nicotiana benthamiana* materials preserved in our laboratory. All samples were frozen in liquid nitrogen and then stored at -80°C for later use.
[0021] The 'Chardonnay' callus tissue used in the experiment was provided by the Fruit Tree Institute of the College of Enology and Horticulture, Ningxia University.
[0022] 2.2 Test Methods 2.2.1 VabHLH016 Gene expression pattern analysis Plant hormone treatment of grape leaves: Fully expanded leaves of new shoots of the wild grape variety 'Zuoshan-1' were selected and sprayed with solutions of 100 μmol / L abscisic acid (ABA), 100 μmol / L methyl jasmonate (MeJA), 0.5 g / L ethephon (ETH), and 100 μmol / L salicylic acid (SA), respectively. Distilled water treatment served as a control. The treated leaves were immediately bagged to maintain local humidity, and samples were collected at 0, 0.5, 1, 3, 6, 12, 24, and 48 h after treatment. The collected samples were flash-frozen in liquid nitrogen and then stored at -80°C for later use.
[0023] Low temperature stress treatment of grape leaves: 'Zuoshan-1' potted seedlings were placed in a low temperature light incubator and treated at 4°C. Leaf samples were collected after 0, 6, 12, 24, 36 and 48 h of treatment.
[0024] RNA extraction and real-time quantitative PCR (qRT-PCR) analysis: Total RNA was extracted using the OMEGA Plant RNA Extraction Kit (R6827), followed by analysis using HiScript. ® III. The All-in-one RT Super Mix Perfect for qPCR kit (Vazyme, China) reverse transcribes RNA into cDNA. qRT-PCR detection is then performed using a Bio-Rad real-time PCR instrument. VvActin (Accession No. XM_002282480) The gene was used as an internal control. Primers were designed by Sangon Biotech (Shanghai) Co., Ltd. Three biological replicates were set up for each treatment, and results were analyzed using 2... -∆∆Ct Methodological analysis.
[0025] 2.2.2 Mountain grape VabHLH016 Gene cloning and overexpression vector construction According to the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) VvbHLH016 Specific primers VabHLH016-F and VabHLH016-R (sequences: VabHLH016-F: AATCCTCGCCCAATCTCAGCC, as shown in SEQ ID NO.3; VabHLH016-R: TAGCCGTCACCCCATCCTAAC, as shown in SEQ ID NO.4) were designed based on the gene (accession number: XM_002280217.3) sequence. Using cDNA from the leaves of *Vitis vinifera* 'Zuoshan-1' as a template, 2× Hieff Canace primers were used. ® Gold PCR Master Mix high-fidelity enzyme premix (10149ES01, YEASEN) amplification VabHLH016 The CDS sequence was obtained. After the amplified products were detected by agarose gel electrophoresis (DYCP-32B, Beijing Liuyi, China), they were purified and recovered by gel cutting using the Tiangen Biotech Recovery Kit (DP209).
[0026] Construction of recombinant plasmid pCAMBIA2300-VabHLH016-GFP: The pCAMBIA2300-GFP vector was... BamH I and Sal After linearization by double enzyme digestion, NovoRec was used. ®The one-step PCR cloning kit was used to ligate the purified target fragment with a linearized vector. The ligation product was transformed into *E. coli* Top10 competent cells using a heat shock method, and positive clones were screened for sequencing verification. The sequencing results were compared with the expected sequence using DNAMAN software. Positive clones with completely correct sequences were selected and inoculated into LB broth containing kanamycin (50 mg / L) and cultured overnight at 37°C and 220 rpm with shaking. Finally, the clones containing the correct sequence were extracted. VabHLH016 Recombinant plasmids containing gene sequences.
[0027] 2.2.3 Bioinformatics analysis of the VabHLH016 gene Chromosomal localization of VabHLH016 and prediction of its intron and exon numbers were performed using NCBI (https: / / www.ncbi.nlm.nih.gov / gene). The amino acid sequence of the VabHLH016 transcription factor was input into the SMART online tool (http: / / smart.embl-heidelberg.de / ) to predict its conserved domains. The local software DNAMAN was then used to further analyze the data. VabHLH016 and European grapes VvbHLH016 Gene sequence alignment was performed. Further systematic analysis of the protein's physicochemical properties and structural characteristics was conducted using various bioinformatics tools: ExPASy ProtParam (https: / / web.expasy.org / protparam / ) was used to analyze its basic physicochemical parameters; phosphorylation sites were predicted using NetPhos 3.1 (DTU Health Tech); secondary structure prediction was performed using the online SOPMA tool (https: / / npsa-prabi.ibcp.fr); a tertiary structure model was obtained based on SWISS-MODEL (https: / / swissmodel.expasy.org / ) homology modeling, and codon usage bias analysis and signal peptide prediction were performed using CodonW, R language, and the SignalP tool on the NovoPro platform (https: / / www.novopro.cn / tools / signalp). Finally, amino acid and gene sequences homologous to VabHLH016 were downloaded from the Ensembl Plants online website (https: / / plants.ensembl.org / index.html), and a phylogenetic tree was constructed using MEGA 11 software.
[0028] 2.2.4 Subcellular localization The recombinant plasmid pCAMBIA2300-VabHLH016-GFP was introduced into Agrobacterium GV3101 competent cells using a freeze-thaw method. The transformed bacterial culture was plated on LB solid medium and incubated overnight at 30°C with the medium inverted. Single colonies were picked and inoculated into LB liquid medium for expansion. After PCR verification, the culture was preserved for future use. OD was prepared. 600 Agrobacterium suspension with a pH of 0.6 was injected via percolation into the abaxial surface of Tobacco Benzovia leaves using a needle-free 1 mL syringe. After inoculation, the tobacco plants were cultured in a plant culture room for 3 days. Subcellular localization of the GFP fusion protein VabHLH016 in tobacco leaves was observed and images were acquired using a confocal laser scanning microscope (Leica TCS SP8).
[0029] 2.2.5 Analysis of Transcription Activation Activity The pGBKT7-VabHLH016 plasmid was transformed into Y2HGold competent yeast cells using the LiAc transformation method and a yeast transformation kit to obtain a yeast strain containing the pGBKT7-VabHLH016 plasmid. The plasmid was diluted with water and spotted onto SD / -Trp and SD / -Trp / X-α-Gal / AbA plates. The cells were incubated upside down at 30°C for 3 days, and the growth and color development of the strain on the medium were observed.
[0030] 2.2.6 Genetic transformation in Arabidopsis thaliana and transient transformation of 'Chardonnay' callus tissue and molecular identification of transgenic lines Agrobacterium-mediated genetic transformation of Arabidopsis thaliana was performed using the inflorescence staining method. Transient transformation of 'Chardonnay' callus was carried out using existing methods. Arabidopsis thaliana... AtActin Accession No. AT3G18780) and grapes Vvactin Using Accession No. XM_002282480 as the reference gene, transgenic Arabidopsis and callus were screened and identified using qRT-PCR and RT-PCR methods.
[0031] 2.2.7 Low-temperature stress treatment of Arabidopsis thaliana and 'Chardonnay' callus Wild-type and selected transgenic Arabidopsis seeds were vernalized at 4°C for 3-4 days, then surface-sterilized in a clean bench (75% ethanol for 30 seconds, 10% sodium hypochlorite for 10 minutes), rinsed twice with sterile water, air-dried, and evenly sown on ½ MS solid medium. When the seeds reached the four-leaf stage, they were transplanted into nutrient pots (substrate ratio: nutrient soil: vermiculite: perlite = 3:1:1) and placed in an incubator for one month (22°C, light intensity 10000 Lux, 12 h light / 12 h dark light cycle). Wild-type and transgenic Arabidopsis thaliana were subjected to gradient cooling acclimatization in a cryogenic incubator (4℃ for 2 h, 2℃ for 2 h, 0℃ for 1 h, -2℃ for 1 h), followed by -4℃ low-temperature stress treatment for 14 h. Phenotypic differences between wild-type and transgenic lines were observed, and leaf samples were collected from wild-type and T3 generation transgenic lines at 0 h (control) and 14 h later. The collected samples were flash-frozen in liquid nitrogen and then stored in an ultra-low temperature freezer at -80°C.
[0032] Fifteen-day-old wild-type (WT) and transgenic callus tissues were transferred to a 4°C environment. Phenotypic changes were monitored after 10 days of exposure. Samples were collected at 0, 3, 6, 12, and 24 h during the treatment period for gene expression analysis. Physiological parameters of WT and transgenic callus tissues were measured before stress (0 h) and 3 h after 0°C exposure.
[0033] 2.2.8 Measurement of physiological and biochemical indicators The physiological changes in wild-type and transgenic Arabidopsis leaves before and after treatment with -4℃ for 14 h, and in wild-type and transgenic 'Chardonnay' callus tissue before and after treatment with 0℃ for 3 h, were determined. The main assays included the determination of malondialdehyde (MDA) content, superoxide dismutase (SOD) activity, peroxidase (POD) activity, and catalase (CAT) activity. Specific assay procedures were performed according to the Solarbio reagent kit instructions.
[0034] 2.2.9 Data Analysis The experimental data were organized using Excel, and significance analysis was performed using IBM SPSS Statistics 27. Graphs were generated using Origin 2024. Error values refer to the standard deviation (±SE) of the three biological replicates. An asterisk (*) indicates a significant difference in expression levels. P < 0.05;** P < 0.01; *** P < 0.001; **** P < 0.0001) 3 Results Analysis 3.1 Mountain grape 'Zuoshan-1' VabHLH016 Gene cloning and overexpression vector construction Using young leaves of wild grape 'Zuoshan-1' as experimental material, RNA was extracted and reverse transcribed into cDNA as a template, and then extracted from Ensembl Plants (… Vitis vinifera European grapes VvbHLH016 Using the gene sequence (1992 bp) as a reference sequence, specific primers were designed for PCR amplification, and the gene was successfully cloned. VabHLH016 The CDS sequence of the gene was obtained. After sequencing verification, the CDS fragment was constructed into the pCAMBIA2300-GFP vector via enzyme digestion and ligation, ultimately obtaining the pCAMBIA2300-VabHLH016-GFP recombinant expression vector. Furthermore, the sequenced data... VabHLH016 Gene CDS sequence and European grape VvbHLH016 The CDS sequence comparison of the gene revealed 7 base mutations, with a sequence similarity of 99.65%. Figure 8 ).
[0035] 3.2 VabHLH016 Bioinformatics analysis of genes 3.2.1 VabHLH016 Gene sequence analysis Analysis through genome websites revealed that VabHLH016 The gene is located in the region 8839126-8929240 on chromosome 2 of the grape genome, and structural analysis of the gene shows that it does not contain introns. Figure 1 A). To further investigate the conserved domain characteristics of this gene, MEGA-X and Gendoc software were used to... VabHLH016 The encoded amino acid sequence is similar to that of the closely related species *Vitis variegata* (Vitis aurea). Vitis piasezkii Riverside grapes ( Vitis riparia ) and the distantly related species Loropetalum chinense ( Loropetalum chinense var. Rubrum ), maple tree ( Liquidambar formosana ) and rubber trees ( Hevea brasiliensis Multiple alignments of homologous amino acid sequences in these species were performed. The results showed that the bHLH-MYC-N domain was conserved at amino acid residues 67-246, and a typical bHLH-AtAIB-like domain was present at amino acid residues 474-550. Figure 1 B). MYC2, as a member of the bHLH transcription factor family, is a core regulator in the jasmonic acid signaling pathway and plays an important role in plant resistance to biotic and abiotic stresses. Homology analysis revealed that... VabHLH016 With Florida dogwood ( Cornus florida ), Tilo flower ( Telopea speciosissima), Magnolia ( Magnolia sinica The MYC content in soybean ( ) shows a high similarity to that in soybean ( ) Glycine max ),cucumber( Cucumis sativus ) and tea trees ( Camellia sinensis The MYC similarity is low in ) Figure 1 C).
[0036] 3.2.2 VabHLH016 Gene codon usage preferences and protein structural characteristics For analysis VabHLH016 Based on the sequence and structural characteristics of this gene, this invention comprehensively utilizes CodonW, R language, and related online analysis platforms to predict and analyze the codon usage preference, protein structure, and physicochemical properties of this gene. The results show that... VabHLH016 The gene sequence showed a clear codon usage preference, with a significant tendency to use codons ending in C or G, suggesting that it has medium to high expression potential. Figure 9 A). The secondary structure of the VabHLH016 protein is mainly composed of α-helices (170), extended strands (51), and random coils (442), with random coils accounting for the highest proportion, reaching 66.7%. Figure 9 B). Further modeling and analysis of the protein's three-dimensional structure using the SWISS-MODEL online platform revealed that the tertiary structure of the VabHLH016 protein is still predominantly composed of random coils. Figure 9 C). Analysis of the physicochemical properties of the VabHLH016 protein using the Expasy online platform revealed 93 potential phosphorylation sites, exhibiting overall hydrophilic characteristics. Furthermore, both signal peptide and transmembrane domain predictions were negative, confirming that VabHLH016 is a non-secretory, non-transmembrane intracellular protein. Figure 10 ).
[0037] 3.3 VabHLH016 Gene expression pattern analysis For research VabHLH016 This invention investigated the tissue expression characteristics of a gene and its response patterns to low temperature and exogenous hormones (including MeJA, ETH, SA, and ABA). Using qRT-PCR technology, the expression of this gene in different tissues (roots, stems, old leaves, young leaves, and tendrils) of the wild grape 'Zuoshan-1' and the European grape 'Chardonnay' was detected. Furthermore, the expression of this gene in the leaves of 'Zuoshan-1' under 4℃ low temperature and exogenous application of MeJA, ETH, SA, and ABA was also examined. VabHLH016 Changes in transcriptional levels. The results showed ( Figure 2 A), VabHLH016Expression was observed in all tested tissues of both grape varieties, with the highest expression level in tendrils and the lowest in roots in 'Zuoshan-1'; while in 'Chardonnay', the highest expression level was observed in stems and the lowest in older leaves. Furthermore, in 'Zuoshan-1', expression levels were found in various tissues... VabHLH016 The expression levels of both were higher than those of 'Chardonnay'. These results indicate that... VabHLH016 It exhibits tissue-specific expression. Since 'Zuoshan-1' is far more cold-hardy than 'Chardonnay', and the tender leaves (stems) of grapevines are easily affected by frost in spring, this invention infers... VabHLH016 It contributed to the cold resistance of the stem of 'Zuoshan-1'.
[0038] The results of low temperature and exogenous hormone treatment showed that after 24 h of low temperature treatment, VabHLH016 The expression level was significantly higher than that of the control group ( Figure 2 B). Exogenous MeJA treatment for 0.5 h significantly increased the transcriptional level of this gene, peaking at 3 h, and then gradually decreasing. Figure 2 C). After processing by ETH and SA, VabHLH016 The expression of [the substance] was significantly induced within 0.5 h, and then showed a decreasing trend. Figure 2 DE). Exogenous ABA treatment for 1-6 hours, VabHLH016 The expression was significantly lower than that of the control group ( Figure 2 F). The above results indicate that VabHLH016 Its expression is induced by low temperature and exogenous hormones MeJA, ETH, and SA, while ABA inhibits it. VabHLH016 Therefore, this invention infers that... VabHLH016 It regulates plant cold resistance independently of the ABA pathway.
[0039] 3.4 The VabHLH016 transcription factor performs its function in the cell nucleus. According to subcellular localization predictions from the CELLO website, the VabHLH016 protein is located in the cell nucleus. To further validate the prediction results, an overexpression vector, VabHLH016-GFP, was constructed. Using Agrobacterium-mediated transient transformation, the overexpression vector VabHLH016-GFP and the control vector (35S-GFP empty vector and nuclear localization marker NLS-mCherry) were transformed into Agrobacterium GV3101 strain, and subsequently injected into the epidermal cells of Nicotiana benthamiana leaves. After 72 h of culture, the fluorescence distribution was observed under a laser confocal microscope. The results showed ( Figure 3A) The 35S-GFP empty vector control group exhibited a typical co-localization pattern of the nucleus and cytoplasm; the nuclear localization marker NLS-mCherry was specifically localized in the nucleus; the fluorescence signal of the VabHLH016-GFP fusion protein was highly consistent with the distribution pattern of NLS-mCherry, both specifically enriched in the nucleus. These results confirm the accuracy of the bioinformatics predictions from the CELLO website, indicating that VabHLH016 is a nuclear localization protein.
[0040] To verify whether the VabHLH016 protein possesses transcriptional autoactivation capabilities, this invention constructed the pGBKT7-VabHLH016 recombinant vector and transformed it into yeast Y2HGold competent cells. The transcriptional activation function of the VabHLH016 protein was analyzed on SD / -Trp solid medium supplemented with X-α-Gal and AbA (200 ng / mL). The results showed ( Figure 3 B), on SD / -Trp solid medium plates supplemented with X-α-Gal (40 ug / mL) and AbA (200 ng / mL), the growth of negative control yeast colonies was significantly inhibited, while BD-VabHLH016 and the positive control grew normally and showed a blue color. This result indicates that the VabHLH016 protein can specifically activate yeast α-galactosidase (B). MeL1 The expression of the gene induces the formation of blue plaques on selective media containing X-α-Gal. Combined with the nuclear localization characteristics of the VabHLH016 protein discovered in previous studies, this invention confirms that VabHLH016 possesses typical transcriptional autoactivation function, further supporting its molecular characteristics as a transcription factor.
[0041] 3.5 Overexpression VabHLH016 Enhance the cold resistance of Arabidopsis thaliana. 3.5.1 Obtaining Transgenic Arabidopsis In order to study VabHLH016 The function of [the substance] under low temperature stress was obtained by inflorescence dipping method to obtain overexpression. VabHLH016 Transgenic Arabidopsis thaliana plants were obtained. Homozygous T3 lines were screened in MS medium supplemented with kanamycin, and PCR verification was performed on 10 lines. The transcriptional levels of three lines (OE6, OE7, and OE8) were further detected by RT-PCR and qRT-PCR. The results showed that... VabHLH016 It was expressed in all resistant lines, but at low levels and was overexpressed in wild-type plants. VabHLH016 The expression level of the strain was significantly higher than that of the wild type. Figure 11 ).
[0042] 3.5.2 Under Low Temperature Stress VabHLH016 Morphological and physiological changes in transgenic Arabidopsis To study the effects of low temperature stress VabHLH016 The effect of overexpression on the phenotype of Arabidopsis thaliana was investigated by subjecting one-month-old Arabidopsis thaliana to a -4°C low-temperature treatment for 14 h. The results showed that before the low-temperature treatment, there were no significant phenotypic differences between wild-type (WT) and transgenic Arabidopsis thaliana lines (OE); after the low-temperature treatment, all lines exhibited leaf wilting, but the degree of wilting in WT was significantly higher than that in OE lines. Figure 4 A). Changes in the activities of antioxidant enzymes (SOD, POD, CAT) and malondialdehyde (MDA) content in WT and OE strains were measured before and after 14 h of low-temperature treatment. Figure 4 (BE) It was found that there was no significant difference in the activities of SOD, POD, and CAT enzymes between the WT and OE lines before low-temperature treatment. However, after low-temperature treatment, the activities of all three antioxidant enzymes increased in both the WT and OE lines, and the activities of SOD, POD, and CAT enzymes in the OE line were significantly higher than those in the WT line, while the MDA content in the WT line was significantly higher than that in the OE line. These results indicate that overexpression... VabHLH016 Genetically modified Arabidopsis thaliana has cold resistance.
[0043] 3.5.3 Overexpression VabHLH016 Upregulate the expression of cold-resistance-related genes in Arabidopsis thaliana For further evaluation VabHLH016 This invention utilizes qRT-PCR to investigate the potential molecular mechanisms regulating low-temperature stress and to study multiple cold-resistance-related genes. AtCBF1 , AtCBF2 , AtCBF3 , AtKIN1 , AtNCED3 , AtRD29A The relative expression levels of () were analyzed. The results showed that () Figure 5 In both WT and transgenic lines, six cold-resistance-related genes responded to low temperatures, and after low-temperature treatment... AtCBF1 , AtCBF2 , AtCBF3 , AtKIN1 , AtNCED3 and AtRD29A The expression levels in the transgenic lines were significantly higher than those in the WT lines, indicating overexpression. VabHLH016 It is possible that by upregulating the expression of the aforementioned cold-resistance-related genes, the cold resistance of transgenic plants can be enhanced.
[0044] 3.6 Overexpression VabHLH016 Enhance the cold resistance of Chardonnay callus tissue 3.6.1 Obtaining transgenic callus Transient genetic transformation was performed using 'Chardonnay' grape callus as material via Agrobacterium-mediated transformation. The transformed callus was then analyzed using RT-PCR and qRT-PCR techniques to verify the results. VabHLH016Whether the gene was successfully integrated and expressed. Results showed that in the overexpression line (OE- VabHLH016 The amplified band size in the tissue was as expected, and the expression level of the gene was significantly higher than that of wild-type (WT), thus identifying it as positive transformed callus. Figure 12 ).
[0045] 3.6.2 Under Low Temperature Stress VabHLH016 Phenotypic, fresh weight, and physiological and biochemical changes in transgenic callus OE- VabHLH016 After treatment at 4°C for 10 days, WT callus showed significant browning, indicating that its cells may have suffered severe damage; in contrast, OE- VabHLH016 The callus tissue showed only slight yellowing, and the phenotypic changes were relatively mild. Figure 6 A). Furthermore, regarding fresh weight, OE- after low-temperature treatment... VabHLH016 The fresh weight of callus tissue was significantly higher than that of WT (wt). Figure 6 B). By measuring WT and OE- before and after 3 hours of low-temperature treatment. VabHLH016 Changes in the activity of antioxidant enzymes (SOD, POD, CAT) and the content of malondialdehyde (MDA) in callus tissue. Figure 6 CF), found that OE- before low-temperature treatment VabHLH016 There was no significant difference in SOD, POD, and CAT enzyme activities between WT and OE callus tissues, but after low-temperature treatment, the activities of WT and OE callus tissues increased. VabHLH016 The activities of all three antioxidant enzymes in callus tissue were increased, and OE- VabHLH016 The SOD, POD, and CAT enzyme activities of callus tissue were significantly higher than those of WT callus tissue, while the MDA content of WT callus tissue was significantly higher than that of OE- VabHLH016 Callus tissue. In summary, based on the above results, VabHLH016 Overexpression of this gene can effectively alleviate physiological damage caused by low temperature, confirming that this gene has a potential function in improving the cold resistance of grapes.
[0046] 3.6.4 Overexpression VabHLH016 Upregulate the expression of cold-resistance-related genes in 'Chardonnay' callus. To reveal in depth VabHLH016 The molecular mechanism of overexpression regulating low-temperature stress was investigated in this invention using qRT-PCR technology to target six cold-resistance-related genes. VvCBF1, VvCBF2, VvCBF3, VvKIN2, VvNCED1, VvRD29B The expression dynamics of ) under 4℃ low-temperature stress treatment for 0–24 h were analyzed. The results showed that ( Figure 7 Under low-temperature stress, each gene exhibited different expression patterns in wild-type (WT) and transgenic callus tissues. Specifically, VvCBF1 and VvCBF3 Expression levels peaked at 3 hours, while VvCBF2and VvRD29B It reaches its peak at 6 hours; VvNCED1 and VvKIN2 The expression of these genes continued to rise, peaking at 12 h and 24 h, respectively. Notably, at almost all detection time points, the expression of these genes in transgenic callus was significantly higher than that in WT. These results fully demonstrate that overexpression of VabHLH016 can significantly enhance the transcriptional levels of multiple cold resistance-related genes under low temperature stress, thereby systematically improving the cold resistance of transgenic callus tissue.
[0047] As demonstrated by the above embodiments, this invention provides a cold-resistance-related gene, VabHLH016, derived from wild grapes, and its application. Experiments have confirmed that expression of this gene in plants significantly enhances their tolerance to low-temperature stress. In both the model plant Arabidopsis thaliana and grape callus tissue, the introduction and expression of the VabHLH016 gene significantly improved their low-temperature survival, accompanied by a series of beneficial physiological and biochemical responses. This invention provides an effective gene resource and feasible technical solution for cultivating cold-resistant plant varieties, especially new grape varieties, using genetic engineering techniques.
[0048] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Use of a gene encoding a VabHLH016 protein as shown in SEQ ID NO: 2 in improving cold resistance of a plant.
2. Use of a VabHLH016 protein as shown in SEQ ID NO: 2 in improving cold resistance of a plant.
3. Use of a recombinant expression vector for increasing cold tolerance in plants, characterized in that, The recombinant expression vector comprises the gene according to claim 1.
4. Use according to claim 3, characterized in that, The recombinant expression vector is pCAMBIA2300-VabHLH016-GFP.
5. Use of a host cell for increasing cold tolerance in a plant, characterized in that, The host cell comprises the recombinant expression vector according to claim 3 or 4.
6. A method for making a transgenic plant with improved cold tolerance, comprising, The method comprises the step of introducing and expressing the gene according to claim 1 into a plant.
7. The method of claim 6, wherein, The plant is grape or Arabidopsis.
8. The method of claim 6, wherein, The step of introducing is achieved by Agrobacterium-mediated genetic transformation or inflorescence dipping.
9. A transgenic plant with improved cold tolerance, characterized in that, The product is prepared by the method according to any one of claims 6 to 8.
10. A kit for improving cold tolerance of a plant, characterized by, The product comprises the gene according to claim 1, or the recombinant expression vector according to claim 3 or 4, or the host cell according to claim 5.