Application of molecular marker related to weaning weight character of sheep
By identifying molecular markers associated with weaning weight in Suffolk sheep through genome-wide association analysis, and utilizing genotype screening and breeding techniques, the problems of limited purebred Suffolk sheep population size and declining genetic diversity have been solved. This has enabled early assessment of weaning weight traits and improved weaning weight in offspring, thus promoting germplasm innovation and industrial development in Suffolk sheep.
Patent Information
- Application Number
- CN202610169790.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-06
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2046-02-06
AI Technical Summary
The limited size of purebred Suffolk sheep populations, high inbreeding rates, and declining genetic diversity affect the accurate identification and screening of weaning weight traits, thus restricting the sustainable utilization of germplasm resources and breeding efficiency.
Genome-wide association analysis identified molecular markers associated with weaning weight traits in sheep, particularly the T→C mutation at position 52615201 on chromosome 7 of the Suffolk sheep genome. These markers were used for genotype screening and breeding, with individuals of the CC genotype selected as parents to improve the weaning weight of offspring.
Early assessment of sheep weaning weight traits can significantly shorten the breeding cycle, increase the weaning weight of offspring, and enhance the growth potential and production efficiency of Suffolk sheep.
Smart Images

Figure CN121674585A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic breeding technology, specifically to the application of a molecular marker related to the weaning weight trait in sheep. Background Technology
[0002] Suffolk sheep are a well-known large meat sheep breed. Developed in 1859 through crossbreeding of the Southhill sheep with the robust, lean-meat-proportioned old-type black-headed horned Norfolk sheep, this breed is characterized by rapid growth, well-developed muscles, and excellent carcass quality. It is primarily used for purebred breeding and as a high-quality terminal sire to improve the growth performance of local sheep. Its superior weight gain and feed conversion efficiency significantly shorten the breeding cycle, reduce production costs, and improve the economic benefits of sheep farming.
[0003] With the continued growth in consumer demand for high-quality lamb, the market prospects for Suffolk sheep are becoming increasingly promising. However, the current purebred population is relatively limited, and some populations suffer from high inbreeding rates and declining genetic diversity, which restricts the sustainable utilization of germplasm resources. Weaning weight, as a key trait for measuring the early growth rate and rearing efficiency of Suffolk lambs, not only directly affects the slaughter cycle and livestock output, but is also an important indicator for assessing the reproductive performance of ewes and the vitality of lambs.
[0004] Therefore, in order to effectively improve the early growth potential and overall production efficiency of Suffolk sheep, it is urgent to develop a new technology that can accurately identify and screen the genetic potential related to weaning weight traits at an early stage. This technology has important theoretical and practical significance for promoting Suffolk sheep germplasm innovation and high-quality industrial development. Summary of the Invention
[0005] To address the above problems, this invention presents an application of molecular markers related to sheep weaning weight traits, which can be used to identify sheep weaning weight traits and to breed sheep with high weaning weights.
[0006] This invention is achieved through the following technical solution: Application of a molecular marker associated with the weaning weight trait in sheep, wherein the molecular marker is the nucleotide sequence shown in SEQ ID NO.1, and the nucleotide at the 101 bp site is T or C.
[0007] The application refers to any one of the following (1) and (2): (1) Determine the weaning weight of sheep.
[0008] (2) Increase the weaning weight of sheep offspring.
[0009] Preferably, the method for identifying the weaning weight trait in sheep is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced.
[0010] Determine the genotype of the sheep at SEQ ID NO.1.
[0011] If the genotype is CC, then the sheep is a high weaning weight sheep; high weaning weight refers to a weaning weight greater than 42 kg.
[0012] Preferably, the method for increasing the weaning weight of sheep offspring is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced.
[0013] Determine the genotype of the sheep at SEQ ID NO.1.
[0014] By selecting sheep carrying the CC genotype as parents for breeding, it is possible to increase the weaning weight of sheep offspring.
[0015] Preferably, the genomic DNA is derived from sheep blood.
[0016] Preferably, the genomic DNA is extracted using the phenol-chloroform method.
[0017] Preferably, the sheep is a Suffolk sheep.
[0018] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an application of molecular markers related to the weaning weight trait in sheep. The molecular marker is the nucleotide sequence shown in SEQ ID NO.1, where the nucleotide at the 101 bp site is T or C. The application refers to either (1) or (2) of the following: (1) identifying the weaning weight of sheep; (2) increasing the weaning weight of sheep offspring. This invention screens out molecular markers affecting the weaning weight trait in sheep through methods such as genome sequencing, identification of variant sites, and genome-wide association analysis. By detecting the genotype of the molecular markers, this invention can assess the weaning weight trait in sheep at an early stage of growth and development, significantly shortening the breeding cycle. Furthermore, based on the SNP sites and their dominant genotype CC of this invention, selecting individuals carrying these dominant genotypes as parents can effectively increase the weaning weight of offspring. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1This is a distribution diagram of the SNPs after quality control in a 1Mb window of the chromosome. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.
[0021] Figure 2 This is a visualization of the IBS genetic distance matrix of this invention.
[0022] Figure 3 The principal component analysis plot of this invention uses the first three explained variance percentages PC1, PC2, and PC3 as the X, Y, and Z axes.
[0023] Figure 4 The Manhattan Plots and QQ-plots of this invention show the GWAS results of the weaning weight trait in Suffolk sheep. Genome-wide significant SNPs are shown in red; A is the Manhattan plot of the weaning weight trait in Suffolk sheep; B is the QQ plot of the weaning weight trait in Suffolk sheep. Detailed Implementation
[0024] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0025] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0026] The technical solution of the present invention will be further described below with reference to specific embodiments.
[0027] LD: Linkage Disequilibrium.
[0028] Manhattan Plot.
[0029] QQ chart: Quantile-Quantile Plot.
[0030] SNP: Single nucleotide polymorphism.
[0031] GWAS: Genome-wide association analysis.
[0032] IBS: Identity-by-State.
[0033] Example 1 Test animals and phenotypic sources: The sheep used in this invention were all from Inner Mongolia Sainuo Sheep Breeding Technology Co., Ltd. Phenotypic records of weaning weight traits in Suffolk sheep from 2020 to 2024 are shown in Table 1. Blood samples were collected from 300 individual Suffolk sheep. All samples were immediately stored at -80℃ after collection and transported to the laboratory on dry ice for long-term storage at -80℃.
[0034] Table 1. Description of weaning weight traits in Suffolk sheep
[0035] I. Genomic DNA Extraction and Quality Inspection DNA was extracted from blood samples using the phenol-chloroform method. The concentration of DNA, the ratio of the absorption wavelengths of the highest absorption peaks of nucleic acids, proteins, and phenolic substances (260 nm / 280 nm), and the ratio of the absorption wavelengths of the highest absorption peaks of carbohydrates (260 nm / 230 nm) were measured using a NanoDrop2000 spectrophotometer. DNA quality was assessed by 1% w / v agarose gel electrophoresis.
[0036] II. Library Construction and Sequencing After processing qualified genomic DNA samples, the genomic DNA was randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly A addition, sequencing adapter addition, purification, and PCR amplification to complete the entire library preparation process. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality checks, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.
[0037] III. Identification, screening, and annotation of variant sites The raw sequencing data was quality controlled and preprocessed using FastP software version V0.20.0 to obtain Clean reads. A genome index was built on the reference genome. The quality-controlled Clean reads were aligned with the sheep reference genome Oar_v4.0, GCF_000298735.2 using Burrows-Wheeler Aligner software version V0.7.17. The aligned SAM files were converted into BAM files and sorted using SAMtools software version V1.8-20. The MarkDuplicates program in Genome Analysis Toolkit software version V3.8 was used to remove duplicate data from the sorted BAM files to obtain the final BAM files. An index was built on the final BAM files, and SNP variant detection was performed using the HaplotypeCaller module in GATK software. After obtaining the VCF files, the VariantFiltration module was used for filtering. The ANNOVAR software package is used to perform functional annotation on detected gene variations. Based on the location of the variant site on the reference genome and the gene location information on the reference genome, the region in which the variant site occurs in the genome, such as intergenic regions, intronic regions, or CDS regions, can be determined, as well as the impact of the variant, such as synonymous and non-synonymous mutations.
[0038] IV. Data quality control and population stratification correction The detection rate is called the call rate; the minimum allele frequency is called the MAF; and the Hardy-Weinberg equilibrium is called the HWE.
[0039] Whole-genome resequencing was performed on 300 Suffolk sheep individuals to establish a genotype database, generating a total of 17243.32 Gb of raw reads and identifying 47,506,993 SNPs. The genotyping data were quality controlled using Plink software version 1.90, removing individuals with a genotype detection rate of less than 98%, SNPs with a detection rate of less than 98%, SNPs with a minimum allele frequency of less than 5%, and SNPs with a Hardy-Weinberg equilibrium p-value of less than 10. -6 In the Suffolk population, a total of 20,182,599 high-quality SNPs were identified. These loci were evenly distributed across the 26 pairs of autosomes in sheep. Figure 1 As shown.
[0040] The population was analyzed using Plinkv1.90 based on the IBS genetic distance matrix, and the results are as follows: Figure 2 As shown, Figure 3Each small square in the diagram represents the pairwise genetic distance between the first and last samples. A larger value, closer to blue, indicates a more distant kinship between the two individuals, and vice versa, indicating a more distant kinship between Suffolk sheep individuals. The first three principal components were calculated using the "--pca3" parameter in Plink software version 1.90. The PCA plot was then drawn using R version 3.6.0, and the results are shown below. Figure 3 As shown, the experimental sample exhibits population stratification and a high degree of genetic correlation among individuals. Therefore, the first three principal components need to be used as covariates to correct for the population stratification phenomenon in Suffolk sheep.
[0041] V. Genome-wide association analysis Association analysis between SNPs and weaning weight traits was performed using the fastGWA-mlm model in GCTA software version V1.94.0beta.
[0042] y=X snp β snp +X c β c +g+e.
[0043] Where y is the phenotypic vector; X snp It is a genotype vector, and its effect is β. snp ;X c This is the correlation matrix of the first three PCA variables with fixed covariates, and its corresponding coefficient is β. c ;g is the vector of total genetic effects captured by the genetic relationship matrix derived from SNPs, g~N(0, ); π is a genetic relation matrix vector derived from SNP, where all off-diagonal elements are set to 0; e is the residual vector, e ~ N(0, ).
[0044] Using the Bonferroni correction method of 0.05 / number of SNPs to determine the significance threshold of GWAS is too stringent. Instead, a linkage disequilibrium screening process is used to remove redundancy, resulting in independent SNPs, which are then used to calculate the threshold.
[0045] The parameters are: 200: Window size, i.e., the number of SNPs.
[0046] 50: Step length, i.e., the number of SNPs.
[0047] 0.2: r 2 Delete one of the SNP pairs where LD is greater than 0.2.
[0048] This invention adjusts the threshold for genome-wide significant association to P=1 / 620054, where 620054 is the number of independent SNPs screened by LD. The genome expansion factor, λ, is calculated using the slope of a linear regression between the observed quantiles and the theoretical quantiles in R version V3.6.0. The calculated λ value for the weaning weight trait is 0.994, indicating no genome expansion.
[0049] Based on resequencing data from 300 Suffolk sheep, seven significant SNP loci associated with weaning weight were detected. These loci are located on chromosomes 1, 2, 3, 4, 6, 10, 13, 20, 22, and 23, as shown in Table 2. Figure 4 As shown.
[0050] Table 2 Significant SNP loci associated with weaning weight traits
[0051] VI. SNPs affecting weaning weight trait in Suffolk sheep Further investigation of SNPs that reached genome-wide significance revealed that the T→C mutation at position 52615201 on chromosome 7 of the Suffolk sheep genome can significantly affect the weaning weight trait in Suffolk sheep.
[0052] Association analysis was performed on the SNP locus at position 52615201 on chromosome 7 of the Suffolk sheep genome with the weaning weight trait. The results are shown in Table 3.
[0053] Table 3. Polymorphism at position 52615201 on chromosome 7 of the Suffolk sheep genome.
[0054] Note: Different lowercase letters indicate significant differences. P <0.05, where the same letter indicates no significant difference. P >0.05.
[0055] As shown in Table 3, individuals with the CC genotype have the largest weaning weight, while individuals with the TT genotype have the smallest weaning weight.
[0056] In the genome-wide association analysis, the SNP molecular marker at position 52615201 on chromosome 7 of the Suffolk sheep genome reached a genome-wide significance level, indicating that this molecular marker is significantly associated with the weaning weight trait of Suffolk sheep. Furthermore, when the base of this molecular marker is C, it is beneficial for Suffolk sheep to have a larger weaning weight, which is greater than 42 kg.
[0057] The frequency of the SNP gene and genotype at position 52615201 on chromosome 7 of the Suffolk sheep genome were then analyzed, as shown in Table 4.
[0058] Table 4. Frequency of SNP gene and genotype at position 52615201 on chromosome 7 of the Suffolk sheep genome.
[0059] The nucleotide sequence of the molecular marker containing the T→C mutation site at position 52615201 on chromosome 7 is shown in SEQ ID NO.1 and SEQ ID NO.2.
[0060] SEQ ID NO.1: ATTCTCCAGGCAAGAATACTGGAGTGGGTTGCCATTTCCTTCTCCAGGGTAATTTTCCCAACCCAGGGATCGAACCCAAGTCTCCTGCATTGCGGGCAGATGCTTTAACCACTGAGCCACCAGAGAAGCCTATTATACCTTGAGTCAAATCCCAAAACCCAGCCCTTTGCTAGGATGCTTCTGATAACCTCTGCTTCATCA.
[0061] SEQ ID NO.2: ATTCTCCAGGCAAGAATACTGGAGTGGGTTGCCATTTCCTTCTCCAGGGTAATTTTCCCAACCCAGGGATCGAACCCAAGTCTCCTGCATTGCGGGCAGACGCTTTAACCACTGAGCCACCAGAGAAGCCTATTATACCTTGAGTCAAATCCCAAAACCCAGCCCTTTGCTAGGATGCTTCTGATAACCTCTGCTTCATCA.
[0062] Therefore, it is evident that the Suffolk sheep breed can be bred by selecting individuals with the CC genotype as the paternal or maternal parent when the molecular marker base at chromosome 52615201 on chromosome 7 of the Suffolk sheep genome is C. This can increase the weaning weight of Suffolk sheep offspring.
[0063] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0064] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0065] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention should be determined by the appended claims.
Claims
1. Use of a molecular marker associated with a weaning weight trait in sheep, characterized in that, The molecular marker is a nucleotide sequence shown in SEQ ID NO. 1, and the nucleotide at the 101bp site is T or C; The application refers to any one of the following (1) and (2): (1) identifying the weaning weight of sheep; (2) improving the weaning weight of sheep offspring.
2. Use according to claim 1, wherein The method for identifying the weaning weight of sheep is as follows: Extracting the genomic DNA of the sheep to be tested for sequencing; Determining the genotype of the sheep at SEQ ID NO. 1; If the genotype is CC, the sheep is a large weaning weight sheep; the large weaning weight refers to a weaning weight greater than 42kg.
3. The use according to claim 1, wherein The method for improving the weaning weight of sheep offspring is as follows: Extracting the genomic DNA of the sheep to be tested for sequencing; Determining the genotype of the sheep at SEQ ID NO. 1; Selecting a sheep individual carrying the genotype CC as the parent for breeding, so as to improve the weaning weight of sheep offspring.
4. Use according to claim 2 or claim 3, wherein the compound is of formula (I) ###00001### (I) or a pharmaceutically acceptable salt thereof. The genomic DNA is derived from the blood of sheep.
5. The use as claimed in claim 2 or claim 3, wherein, The extraction method of the genomic DNA is the phenol chloroform method.
6. The use according to claim 1, wherein The sheep is Suffolk sheep.
Citation Information
Patent Citations
Weight trait-related SNPs molecular marker and application thereof in Hu sheep assistant breeding
CN111705140A
SNP (Single Nucleotide Polymorphism) marker for identifying weaning weight of alpine merino and application of SNP marker
CN114657265A
SNP (Single Nucleotide Polymorphism) molecular marker influencing weaning weight of sheep and application thereof
CN116083604A
Haploid molecular marker influencing sheep lumbar muscle thickness character and application
CN120464757A
Molecular marker influencing sheep weight traits and application thereof
CN120464759A
Cited By
Application of molecular marker influencing sheep body length character
CN122060874A