SNP (Single Nucleotide Polymorphism) molecular marker for identifying resistance of watermelon zucchini yellow mosaic virus and application thereof
By developing the molecular marker ZYMVR based on BSA pool mapping and using KASP technology to identify resistance to yellow mosaic virus disease in watermelon zucchini, the problem of low resistance identification and breeding efficiency in watermelon breeding was solved, achieving efficient screening and breeding, and obtaining new watermelon varieties with multiple disease-resistant genes.
Patent Information
- Application Number
- CN202512055405.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-03-17
AI Technical Summary
Existing technologies for watermelon resistance identification and breeding methods against zucchini yellow mosaic virus disease suffer from low efficiency and poor stability, and have failed to effectively screen out new watermelon varieties with multiple resistances.
We developed the molecular marker ZYMVR based on BSA pool mapping and used KASP competitive allele-specific polymerase chain reaction to identify single nucleotide polymorphisms linked to resistance to zucchini yellow mosaic virus in watermelon. This information can be used to assist in selection breeding and improve the screening efficiency and stability of disease resistance genes.
This study enabled efficient screening and breeding of watermelons resistant to zucchini yellow mosaic virus, significantly improving disease resistance. It also enabled the targeted acquisition of new watermelon varieties with multiple disease-resistant genes in the laboratory, thus improving breeding efficiency and effectiveness.
Smart Images

Figure CN121674609A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker development for vegetable disease resistance and molecular marker-assisted breeding technology, specifically involving the development and application of a molecular marker for watermelon resistance to zucchini yellow mosaic virus. Background Technology
[0002] Small zucchini yellow mosaic virus ( Zucchini yellow mosaic virus ZYMV is a positive single-stranded RNA virus, a non-enveloped, curved linear virus belonging to the family Potatovirus Y (Potatovirus Y family). Potyviridae Potato virus Y genus ( Potyvirus (DESBIEZ et al., 1997). This virus was first detected in zucchini (Cucurbita pepo) in Italy in 1973 (LISA et al., 1981). ZYMV has a wide host range, infecting cucurbitaceous plants such as squash, zucchini, cucumber, watermelon, and melon (Yue Jianying et al., 2021), as well as plants from 11 families including legumes, chenopodiaceae, ranunculaceae, and apricotaceae (Lai Chunwang et al., 2021). Infected plants exhibit severe mosaic symptoms, with wrinkled and deformed leaves, cracked fruit flesh, and stunted growth, eventually leading to wilting and death (COUTTS et al., 2011). Under natural conditions, the main transmission routes of ZYMV include non-persistent transmission via aphids, seed-borne transmission, and mechanical contact (SIMMON Set al., 2013). Because aphids carry the virus for a limited time, it does not cause widespread intercontinental transmission. With the development of trade globalization, seeds, fruits, and plants carrying viruses have become the main source of virus transmission. Currently, the main methods for the prevention and control of ZYMV include strengthening inspection and quarantine, seed disinfection treatment, seedling grafting, molecular breeding, and biochemical control (Zhang Shasha et al., 2018).
[0003] Research on the identification, genetic analysis, candidate gene localization, and development of related molecular markers for ZYMV-resistant cucurbits has greatly promoted the innovation of ZYMV-resistant germplasm and the breeding of new varieties in cucurbit crops. Provvidenti et al. (1987) obtained the material TMG-1 through selection of TMG single plants and found that the resistance of TMG to ZYMV was controlled by a recessive single gene zym. Subsequently, Abul-Hayja and Al-Shahwan (1991) also studied the genetic law of ZYMV resistance using the disease-resistant cucumber variety Dina and obtained the same results. The mechanism by which cucumber resistance to ZYMV is controlled by a pair of recessive genes may be related to the mutation of the candidate gene VPS4. The protein encoded by this gene may achieve resistance by mediating viral replication and intercellular movement (Amano et al., 2013). The resistance of melon and zucchini is controlled by a pair of dominant genes, but these resistant varieties have the problem of single resistance and poor persistence (Novakova et al., 2015).
[0004] No resistant varieties have been identified in cultivated watermelons. The main source of resistance is found in wild watermelons. Among them, PI595203 shows the highest resistance to ZYMV. In addition, PI595203 was found to be resistant to three major watermelon viruses (ZYMV-CH, PRSV-W, and WMV). It was later confirmed that the resistance of PI595203 to ZYMV-CH is controlled by the recessive single gene zym-CH (Xu et al., 2004). Ma Shaoqin et al. (2006) used RAPD marker technology to study the linkage markers of watermelon resistance to ZYMV, found a RAPD marker with a genetic distance of 8 cM from the ZYMV resistance gene, and successfully converted it into a SCAR marker. Using the ZYMV-FL resistant line PI482261 (PP261-1) and the susceptible watermelon cultivar New Hampshire Midget as test materials, the results showed that the resistance of PP261-1 is controlled by the recessive single gene zym-FL (Provvidenti et al., 1991). To date, research on the localization of ZYMV resistance genes in watermelon and other cucurbitaceous crops has progressed slowly, and no key functional genes have yet been cloned. Due to the limited research both domestically and internationally on germplasm identification, resistance inheritance patterns, and linkage molecular markers for resistance genes in zucchini yellow mosaic virus, high-throughput screening and identification of watermelon resistance to zucchini yellow mosaic virus disease is hindered.
[0005] The references mentioned above are as follows: Lai Chunwang, Wang Jinhao, Cheng Ziyue, et al. Molecular identification and sequence analysis of pathogens of horned melon virus disease in Fujian [J]. Journal of Fruit Science, 2021, 38(11):1868-1876; Ma Shaoqin, Xu Yong, Zhang Haiying, Gong Guoyi, Shen Huolin, 2006, Study on linkage molecular markers of watermelon anti-Zucchini yellow mosaic virus gene, Acta Phytopathologica Sinica, 36(01):68-73; Yue Jianying, Wei Xuefeng, Zheng Hongli, et al. Identification of viral diseases in seed zucchini in Inner Mongolia [J]. Journal of Northwest A&F University (Natural Science Edition), 2021, 49(02):61-67; Zhang Shasha. Development and breeding application of tightly linked molecular markers of ZYMV disease resistance gene in zucchini [D]. Hebei University of Engineering, 2020. DOI:10.27104 / d.cnki.ghbjy.2020.000035; Abul-Havia Z., A-Shahwan lM, 1991, Inheritance of resistance to Zucchini vellow mosaic virus in cucumber, Plant Disease, 98(3):.301-304; Amano M, Mochizuki A, Kawagoe Y, lwahori K, Niwa K, Svoboda,, Maeda TlmuraY.2013. High-resoluton mapping of zym, a recessive gene for zucchini yellowmosaic virus resistance in cucumber. Theoletical and Applied Genetics, 126(12):2983-2993; COUTTS BA, KEHOE MA, WEBSTER CG, et al. Zucchini yellow mosaicvirus:biological properties, detection procedures and comparison of coatprotein gene sequences[J]. Archives of virology, 2011, 156(12):2119-2131; DESBIEZ C, LECOQ H. Zucchini yellow mosaic virus[J]. Plant pathology, 1997, 46(6):809-829; LISA V, BOCCARDO G, D'AGOSTINO G, et al. Characterization of apotyvirus that causes Zucchini yellow mosaic[J]. Phytopathology, 1981, 71(7):667-6; Novakova S,Flores-Ramirez G,Glasa M,Danchenko M,Fiala R,SkultetyL.2015.Partially resistant Cucurbita pepo showed late onset of the Zucchiniyellow mosaic virus infection due to rapid activationof defense mechanisms ascompared to susceptible cultivar.Frontiers in Plant Science,6:263; Provvidenti R.,1987,INHERITANCE OF RESISTANCE TO A STRAIN OF ZUCCHINIYELLOW MOSAIC-VIRUS IN CUCUMBER[J].HORTSCIENCE,22:102-103; Provvidenti R.,1991,INHERITANCE OF RESISTANCE TO THE FLORIDA STRAINOF ZUCCHINI YELLOW MOSAIC-VIRUS IN WATERMELON[J].HORTSCIENCE,26 (4) , pp.407-408; SIMMONS HE, DUNHAM JP, ZINN FOOT, et al. Zucchini yellow mosaicvirus (ZYMV,Potyvirus):vertical transmission, seed infection and crypticinfections[J]. Virus Research, 2013,176(1-2):259-264; Xu Y,.Kang D,Shi Z,Shen H,Wehner T.2004.nheritance of resistance tozucchini yellow mosaic virus and watermelon mosaic virus in watermelon.Journal of Heredity,95(6):498-502. Summary of the Invention
[0006] The technical problem to be solved by this invention is to provide a SNP molecular marker for identifying resistance to watermelon and zucchini yellow mosaic virus disease and its application.
[0007] To address the aforementioned technical problems, this invention provides a molecular marker for identifying resistance to Yellow Mosaic Virus (YMVV) in watermelon and zucchini, developed based on BSA mixed-pool localization of disease resistance genes. Watermelon is used as the species in this invention. The primer pair for the molecular marker is as follows, with the nucleotide sequence being 5'-3': ZYMVR: Allele Primer 1: GAAGGTGACCAAGTTCATGCTTCCGCCTGCAAGGTCCATT Allele 2: GAAGGTCGGAGTCAACGGATTTCCGCCTGCAAGGTCCATG Universal primers: CAAATCCACCGTATTCATGACC illustrate: ZYMVR targets the G / T site at the 3' end of alleles 1 and 2, as shown in Table 1 below.
[0008] Table 1
[0009] The present invention also provides the use of the above-mentioned molecular markers for the identification of watermelon zucchini yellow mosaic virus resistant germplasm or its progeny in auxiliary selection breeding.
[0010] Specifically: When screening the hybrid offspring of wild watermelon germplasm 'PI595203' and cultivated variety 'M1511-3', select individual plants from the offspring whose genotype is consistent with the disease-resistant watermelon genotype 'PI595203' or who simultaneously possess both 'PI595203' and 'M1511-3' genotypes for breeding. When screening for resistant zucchini yellow mosaic virus germplasm from several (e.g., hundreds) watermelon germplasm samples, select those with the same genotype as the resistant watermelon 'PI595203' or those with both 'PI595203' and 'M1511-3' genotypes for breeding.
[0011] This invention provides a method for identifying single nucleotide polymorphisms linked to resistance to the yellow mosaic virus in watermelon zucchini, comprising the following steps: 1) Hybridize watermelon 'PI595203' resistant to zucchini yellow mosaic virus and watermelon 'M1511-3' susceptible to zucchini yellow mosaic virus as parents, and then carry out multiple generations of self-pollination to obtain single plants that are resistant / susceptible as F7 and F8 generations. 2) Extract genomic DNA from watermelon parent seedlings and F1, F7, and F8 generation seedlings using a rapid plant genomic DNA extraction method; 3) Use the BSA method to locate regions or genes associated with resistance to zucchini yellow mosaic virus disease; 4) A single nucleotide polymorphism sequence linked to watermelon resistance to zucchini yellow mosaic virus was identified.
[0012] This invention also provides a method for developing the above-mentioned molecular markers, comprising the following steps: 1) The wild watermelon germplasm resistant to zucchini yellow mosaic virus 'PI595203' was crossed with the cultivated watermelon cultivar 'M1511-3' susceptible to zucchini yellow mosaic virus, and then multiple generations of self-pollination were carried out to obtain the F7F8 generation population. The genetic segregation of single nucleotide polymorphism sequences linked to watermelon resistance to zucchini yellow mosaic virus was verified. 2) The wild watermelon germplasm 'PI595203' resistant to zucchini yellow mosaic virus was crossed with the cultivated watermelon 'M1511-3' susceptible to zucchini yellow mosaic virus to obtain disease-resistant watermelon individual plants as offspring; 3) Extract genomic DNA from watermelon parent seedlings and hybrid offspring seedlings using a rapid plant genomic DNA extraction method; 4) The KASP (Kompetitive Allele Specific Polymerase Chain Reaction) method was used to develop markers for resistance to zucchini yellow mosaic virus in watermelon. 5) Develop a molecular marker for watermelon resistance to zucchini yellow mosaic virus disease based on single nucleotide polymorphism.
[0013] The molecular marker ZYMVR, associated with watermelon resistance to zucchini yellow mosaic virus disease, was obtained using the following method: 1) By comparing the genomic sequences of the wild watermelon germplasm resistant to zucchini yellow mosaic virus 'PI595203' and the cultivated watermelon cultivar 'M1511-3' susceptible to zucchini yellow mosaic virus with the resistance-linked regions, SNP variations were identified in the genomic sequences of the wild watermelon germplasm resistant to zucchini yellow mosaic virus 'PI595203' and the cultivated watermelon cultivar 'M1511-3' susceptible to zucchini yellow mosaic virus with the resistance-linked regions. That is, by sequencing, differences were found in the molecular marker-defined fragments within the resistance-linked genomic sequences of the two parents. 2) Design primers based on SNP variations in the resistance-linked genomic regions of watermelon infected with resistant / susceptible zucchini yellow mosaic virus; 3) Extract genomic DNA from watermelon parent seedlings and hybrid offspring seedlings using a rapid plant genomic DNA extraction method. 4) The KASP method was used to screen markers for watermelon resistance to zucchini yellow mosaic virus disease; 5) The KASP marker ZYMVR was developed. Correlation testing showed that it is linked to resistance to watermelon zucchini yellow mosaic virus. This marker can be used to identify resistant germplasm of watermelon zucchini yellow mosaic virus.
[0014] The specific method for screening resistance to yellow mosaic virus in watermelon and zucchini using the above molecular markers is as follows: (1) Polymorphism analysis of molecular markers in 'PI595203' and 'M1511-3' against / susceptibility to zucchini yellow mosaic virus: Molecular markers were designed and developed, each consisting of allele primer 1, allele primer 2, and a universal primer; these markers were used to detect the polymorphisms of resistance / susceptibility to zucchini yellow mosaic virus in PI595203' and 'M1511-3'. Note: Primers (molecular markers) can be synthesized by Sangon Biotech (Shanghai) Co., Ltd., and amplified using an ABI Step One Plus PCR instrument.
[0015] The PCR reaction system consisted of: 5.0 μl of 20-50 ng / μl watermelon genomic DNA, 5.0 μl of KASP Master mix, and 0.14 μl of KASP Assay Mix (primer concentrations were all 10 μmol / L, and the volume ratio of the three primers was 2:2:5), for a total volume of 10.14 μl.
[0016] Reaction procedure: 30℃, 1 minute (read fluorescence signal); Pre-denaturation at 94℃ for 15 minutes; 94℃, 20 seconds (denaturation) --- 61℃~55℃, 1 minute (annealing & extension; amplify for 10 cycles using the touch-down procedure, decreasing the temperature by 0.6℃ per cycle); 94℃, 20 seconds (denaturation), 55℃, 60 seconds; continue amplification for 31 cycles.
[0017] 30℃, 1 minute (read fluorescence signal); After amplification, fluorescence signals are detected and genotyping results are checked.
[0018] (2) SNP differences between the molecular marker ZYMVR and 'PI595203' and M1511-3 with different resistances: Based on the obtained molecular marker ZYMVR, SNPs between 'PI595203' and M1511-3 with different resistance to yellow mosaic virus in zucchini were detected, and the genotype of the SNPs was determined based on the difference in fluorescence signals.
[0019] (3) Using ZYMVR molecular markers to conduct watermelon resistant to zucchini yellow mosaic virus disease assisted selection breeding: ZYMV-resistant germplasm 'PI595203' was crossed with susceptible material 'M1511-3' and then self-crossed to construct a segregating population. In subsequent generations (F7–F8), individuals with the same genotype as the resistant parent 'PI595203' were screened using ZYMVR markers, resulting in a batch of breeding materials stably carrying the 'PI595203' resistance gene. Artificial inoculation with ZYMV showed that these materials exhibited significantly higher resistance than the parent 'M1511-3'. Among 36 watermelon germplasm resources, 23 materials with the same genotype as 'PI595203' were screened. Inoculation with zucchini yellow mosaic virus revealed that these materials were either resistant or susceptible to the zucchini yellow mosaic virus phenotype.
[0020] Resistance to zucchini yellow mosaic virus (TMV) is a crucial prerequisite for increasing watermelon yield. This invention employs molecular genetics methods, using 'PI595203' containing the resistance gene, to develop molecular markers and methods for TMV resistance in watermelons. These markers are then used for assisted selection breeding of watermelons resistant to TMV. Because the resistance gene in the material used in this study can enhance watermelon resistance to TMV, its application in molecular design breeding of watermelons resistant to TMV in my country is universal.
[0021] This invention creates the KASP marker ZYMVR linked to the zucchini yellow mosaic virus (MMV) resistance gene in watermelon. This method overcomes the drawbacks of conventional breeding methods, such as long breeding cycles and poor stability in disease resistance identification. It allows for the targeted selection of the 'PI595203' resistance gene in the laboratory and the purposeful aggregation of multiple resistance genes, thereby cultivating new watermelon varieties resistant to multiple diseases. In this invention, when the genotype of the resistant parent 'PI595203' is detected in offspring plants, they are identified as watermelons resistant to MMV. When the genotype of the susceptible parent 'M1511-3' is detected in offspring plants, or when both 'PI595203' and 'M1511-3' genotypes are present, they are identified as susceptible watermelons.
[0022] This invention is applicable to the selection of markers for resistance to zucchini yellow mosaic virus in most watermelons.
[0023] Therefore, the results of this invention are of great significance in the breeding practice of watermelon resistant to zucchini yellow mosaic virus; its advantages are summarized as follows: (1) The present invention can realize the molecular marker for watermelon resistance to zucchini yellow mosaic virus disease. It is obtained by the genetic segregation population of 'PI595203' watermelon containing the resistance gene and 'M1511-3' watermelon susceptible to the disease. It is applied in the screening of hybridization and self-pollination. It can significantly improve the resistance of zucchini yellow mosaic virus disease and is stably inherited. It can be used for auxiliary selection breeding of watermelon resistance to zucchini yellow mosaic virus disease.
[0024] (2) The present invention is based on the KASP marker developed from the nucleotide sequence that is closely linked to the watermelon resistance gene against zucchini yellow mosaic virus, which greatly improves the efficiency and effectiveness of assisted selection.
[0025] This invention provides a novel molecular marker and auxiliary selection method for high-throughput screening and identification of watermelon and zucchini yellow mosaic virus disease.
[0026] The molecular marker obtained in this invention is a resistance marker for watermelon zucchini yellow mosaic virus disease and can be used for assisted selection breeding of watermelon zucchini resistance to yellow mosaic virus disease.
[0027] In summary, compared with the prior art, the technical problem to be solved by the present invention is to find a single nucleotide polymorphism marker linked to resistance to watermelon zucchini yellow mosaic virus, and to provide a molecular marker for the identification of resistance to watermelon zucchini yellow mosaic virus disease developed based on BSA pooling localization of the anti-watermelon zucchini yellow mosaic virus gene, as well as its development method and application. Attached Figure Description
[0028] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0029] Figure 1 These are symptoms of infection with the yellow mosaic virus in resistant watermelon 'PI595203', susceptible watermelon 'M1511-3', and the F1 hybrid of 'PI595203' and 'M1511-3'.
[0030] Figure 2 It is based on the location of the disease resistance gene of BSA on the chromosome.
[0031] Figure 3 This is a genotype diagram of the KASP marker ZYMVR in 'PI595203', 'M1511-3', and F1, where the disease-resistant genotype of 'PI595203' is TT, the disease-susceptible genotype of 'M1511-3' is GG, and the F1 genotype is GT.
[0032] Figure 4 The KASP marker ZYMVR segregated in 'PI595203', 'M1511-3', and F7F8, indicating that this marker can be used for screening resistant plants in offspring. M1511-3 (GG), PI595203 (TT), and their F1 (GT) genotypes were included in the figure as controls.
[0033] Figure 5 The resistance was verified by ELISA and RT-PCR experiments on individual F7F8 plants. Figure 5 In section a, those with serial numbers K1-K23 are disease-resistant materials with genotype T / T, and those with serial numbers G1-G10 are disease-susceptible materials with genotype G / G. Figure 5 b and Figure 5 c respectively correspond to Figure 5 RT-PCR detection of 10 susceptible and 23 resistant strains in sample a.
[0034] Figure 6 To determine the resistance and susceptibility phenotypes of watermelon varieties with genotypes GG and TT after infection with the small zucchini yellow mosaic virus. Detailed Implementation
[0035] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto: Example 1: Identification of resistance to yellow mosaic virus in wild watermelon germplasm 'PI595203' and cultivated variety 'M1511-3' zucchini: Watermelon materials—'PI595203', 'M1511-3', and 'PI595203' and 'M1511-3' hybrid F1 progeny—were selected from the laboratory germplasm resource bank and inoculated with zucchini yellow mosaic virus. Plant phenotypic symptoms were used to determine resistance. Figure 1 .
[0036] Specifically as follows: I. Inoculation with zucchini yellow mosaic virus: Inoculation was carried out at the one-leaf-one-heart-leaf stage of watermelon seedlings. 2g of fresh diseased leaves infected with zucchini yellow mosaic virus were weighed and placed in a sterilized mortar. 0.02mol / L PBS buffer (pH 7.2) was added at a ratio of 1:10 (w / v, i.e., 1mg:10ml) and ground into a paste. This paste was used as the virus extract for manual inoculation via friction. During inoculation, a small amount of carborundum was evenly sprinkled on the upper surface of the cotyledons of the watermelon seedlings to be inoculated. Approximately 20µl of the virus extract was then dripped onto the two cotyledons of each seedling. The leaf surface was then repeatedly rubbed 2-4 times with a clean, gloved index finger to inoculate the virus (only small, shallow wounds on the cotyledons are needed; excessive rubbing may cause plant death). A control (mock infection) was performed using PBS buffer instead of the virus extract for friction inoculation. Fifteen minutes after inoculation with the virus, rinse the leaves with clean water to remove any remaining virus sap and carborundum. Then, place the leaves in the dark for 24-36 hours and transfer them to a greenhouse with light for further growth. Depending on the situation, new leaves can be re-infected after one week to ensure that the plants are infected with the virus. After two weeks of normal culture, virus resistance can be identified.
[0037] II. Observation of Plant Disease Symptoms Two weeks after inoculation, the disease resistance level of watermelon plants was investigated and statistically analyzed according to the watermelon resistance to zucchini yellow mosaic virus disease classification standard.
[0038] The disease situation of the plants is as follows: Grade 1: No obvious symptoms of disease.
[0039] Grade 2: A few leaves are yellowed, mosaic, or have blister-like or nodular protrusions, but the leaf shape is normal.
[0040] Level 3: The leaves of the system are yellow, mosaic, or have blister-like or nodular protrusions, and the leaves are wrinkled.
[0041] Level 4: The leaves of the system are yellowed, mosaic is severe, or there are a large number of blister-like or nodular protrusions, and the leaves are deformed.
[0042] Level 5: Yellowing of leaves, severe mosaic patterns, and significant stunting or complete necrosis of the plant.
[0043] Disease grades 1 and 2 are resistant, while grades 3-5 are susceptible.
[0044] according to Figure 1 Two weeks after inoculation with the zucchini yellow mosaic virus, 'PI595203' showed almost no disease or only a few scattered lesions on its leaves, demonstrating strong resistance to the zucchini yellow mosaic virus. 'M1511-3' plants showed yellowing, mosaic, blistering, and even death of their leaves, demonstrating high sensitivity to the zucchini yellow mosaic virus. Meanwhile, in the F1 generation of the 'PI595203' and 'M1511-3' hybrids, the F1 plants exhibited severe yellowing, mosaic, and leaf deformities, demonstrating high sensitivity to the zucchini yellow mosaic virus. This watermelon's resistance to the zucchini yellow mosaic virus appears to be recessive.
[0045] Example 2: Genetic analysis and gene mapping of resistance to yellow mosaic virus in zucchini: Watermelon materials—parents 'PI595203' and 'M1511-3' and their F1 hybrid offspring, and the F7F8 recombinant inbred line (RIL) segregating population (labeled F7F8, hereinafter the same) obtained by multiple generations of self-pollination of their F1 offspring—were selected from the laboratory germplasm resource bank. These were then inoculated with zucchini yellow mosaic virus. Plant phenotypic symptoms were used to determine resistance, and genetic analysis of disease resistance was performed. Then, disease resistance genes were mapped using the BSA method, such as... Figure 2 .
[0046] Resistance gene location: I. DNA Extraction 1) DNA extraction The DNA extraction kit selected is the Plant DNAzol Total DNA Extraction Kit manufactured by Hangzhou Laifeng Biotechnology Co., Ltd.
[0047] ① Weigh 0.1 g of the watermelon leaves mentioned above and grind them into powder with liquid nitrogen. Then, extract total DNA according to the operating steps provided by the DNA extraction kit.
[0048] ② The concentration of the DNA samples obtained above was detected using a Nanodrop2000 micro-volume spectrophotometer, and the integrity of the DNA was detected by 0.7% agarose gel electrophoresis.
[0049] II. Location of Resistance Genes A pool of susceptible and resistant offspring was constructed using samples from two susceptible and resistant parents, one F1 and two F7F8 offspring. Genome resequencing was performed, and association analysis was conducted using the SNP-index method. The 99% threshold was selected as the screening threshold, and an associated region was located on chromosome 6, in the 6.8-7.47 Mb range.
[0050] Example 3: Development and Verification of ZYMVR Using KASP A total of 151 watermelon germplasm accessions were selected from the laboratory germplasm resource bank. These accessions included the F1 offspring of the crosses between 'PI595203', 'M1511-3', 'PI595203' and 'M1511-3', and the F7F8 population obtained by multiple generations of self-pollination of the F1. First, the SNPs were converted into KASP markers, and the genotypes and genetic segregation patterns were identified by amplification using the KASP marker ZYMVR primer.
[0051] Specifically as follows: 1. Development of KASP-tagged ZYMVR: I. SNP Information Extraction: Based on the gene localization results in Example 2, SNP information closely linked to the disease resistance gene was extracted.
[0052] II. DNA Extraction Genomic DNA was extracted from the F1 offspring of 'PI595203', 'M1511-3', 'PI595203' and 'M1511-3' hybrids, using the same method as in Example 2.
[0053] III. PCR Amplification 1) Reaction system The primer sequences are as follows: Allele 1: GAAGGTGACCAAGTTCATGCTTCCGCCTGCAAGGTCCATT Allele 2: GAAGGTCGGAGTCAACGGATTTCCGCCTGCAAGGTCCATG Universal primers: CAAATCCACCGTATTCATGACC; The PCR reaction system consisted of: 5.0 μl of 20-50 ng / μl watermelon genomic DNA, 5.0 μl of KASP Master mix, and 0.14 μl of KASP Assay Mix (primer concentrations were all 10 μmol / L, and the volume ratio of the three primers was 2:2:5), for a total volume of 10.14 μl.
[0054] 2) Reaction Procedure Pre-denaturation at 94℃ for 15 minutes; 94℃, 20 seconds (denaturation) --- 61℃~55℃, 1 minute (annealing & extension; amplify for 10 cycles using the touch-down procedure, decreasing the temperature by 0.6℃ per cycle); 94℃, 20 seconds (denaturation), 55℃, 60 seconds; continue amplification for 31 cycles.
[0055] After amplification, fluorescence signals are detected and genotyping results are checked.
[0056] PCR reactions are performed directly on the ABI Step One Plus PCR instrument, which is connected to ABI Step One software, so that analysis results can be obtained directly. The software automatically classifies the test samples into homozygous resistant, homozygous susceptible, and heterozygous resistant types according to different genotypes.
[0057] Each of the two allele primers has its own fluorescent adapter (in different colors, e.g., red for GG type, blue for TT type, and green for GT type). If the material being tested is homozygous, only one of the corresponding primers will be selected for amplification (e.g., 'PI595203' can only react with allele primer 1). Based on the difference in fluorescence, it can be distinguished whether the material being tested is homozygous resistant or homozygous susceptible. If the material being tested is heterozygous, both primers will be used during amplification, and the fluorescence produced will be different from that of homozygous material, thus distinguishing heterozygous material.
[0058] according to Figure 3 It can be seen that using ZYMVR primer pairs, genotypes TT and GG (GG type is red, TT type is blue) were detected in the genomes of 'PI595203' and 'M1511-3', respectively. In the F1 offspring of the cross between 'PI595203' and 'M1511-3', the genotype GT (GT type is green) was detected. This indicates that the KASP molecular marker ZYMVR can be used for genotyping between 'PI595203' and 'M1511-3' and their offspring.
[0059] 2. Verification of the KASP tag ZYMVR: I. DNA Extraction Genomic DNA of watermelon germplasm was extracted from 36 parental lines 'PI595203', 'M1511-3' and their F1 hybrid offspring, as well as from the F7F8 recombinant inbred line (RIL) segregating population obtained by multiple generations of self-pollination of their F1 offspring, using the same method as in Example 2.
[0060] II. PCR Amplification Same as above.
[0061] according to Figure 4 It can be seen that: using ZYMVR primers to detect 36 highly inbred watermelon germplasm lines in the laboratory, two genotypes, TT and GG, were detected. Among them, 23 materials were of the TT genotype and 13 materials were of the GG genotype (GG type is red, TT type is blue, and GT type is green). Figure 5 It can be seen that: 23 materials with the same genotype as 'PI595203' and 10 materials randomly selected from the GG genotype were inoculated and verified to be infected with zucchini yellow mosaic virus. Figure 5The ELISA results showed that the OD450 of 23 individual plants with genotype TT (numbers K1-K23) was less than the critical value, indicating ZYMV negativity, while the OD450 of 10 individual plants with genotype GG (numbers G1-G10) was greater than the critical value, indicating ZYMV positivity. Figure 5 b and Figure 5 RT-PCR results showed that all 10 GG genotype plants exhibited a distinct specific amplification band of approximately 280 bp, indicating they carried the viral gene and were positive. The band was not clearly visible in the 23 TT genotype plants, indicating they were negative. This verifies that the KASP molecular marker ZYMVR is closely linked to resistance to zucchini yellow mosaic virus disease. Figure 6 Phenotypic images of watermelon germplasm from nine recombinant inbred lines (RILs) segregating populations are shown in the image. The table shows the genotype and phenotype correspondences for these nine materials.
[0062] Therefore, the correctness of the molecular marker ZYMVR can be proven.
[0063] Additionally, referring to the above, 'M1511-3' and 'PI595203' were crossed, and then F1 was self-pollinated. The resulting F2 generation single plants were kept for seed, and multiple generations of self-pollination were carried out to obtain F7F8 recombinant inbred lines (RIL) segregating populations. KASP marker ZYMVR was used for marker-assisted selection. In the offspring of the RIL population, single plants with genotypes identical to the disease-resistant parent 'PI595203' or with both 'M1511-3' and 'PI595203' genotypes were selected for further breeding improvement.
[0064] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All modifications that can be directly derived or conceived by those skilled in the art from the disclosure of this invention should be considered within the scope of protection of this invention.
Claims
1. A molecular marker developed based on single nucleotide polymorphism (SNP) linked to resistance to Zucchini yellow mosaic virus disease, characterized in that: A molecular marker primer for identifying resistance to Zucchini yellow mosaic virus disease in watermelon, the molecular marker primer using the following primer pair, wherein the nucleotide sequence is 5'-3', ZYMVR: Allelic primer 1: GAAGGTGACCAAGTTCATGCTTCCGCCTGCAAGGTCCATT Allelic primer 2: GAAGGTCGGAGTCAACGGATTTCCGCCTGCAAGGTCCATG Universal primer: CAAATCCACCGTATTCATGACC 2. Use of a molecular marker according to claim 1, characterized in that: A marker-assisted selection breeding for identifying watermelon germplasm and its hybrid progeny resistant to Zucchini yellow mosaic virus disease.
3. Use of the molecular marker according to claim 1, characterized in that: When screening watermelon germplasm resistant to Zucchini yellow mosaic virus disease, the germplasm with genotype consistent with that of the resistant watermelon is selected for breeding; When screening the hybrid progeny of resistant and susceptible watermelon germplasm, the single plant with genotype consistent with that of the resistant germplasm is selected for breeding.