Engineered yeast bacterium for synthesizing polyunsaturated fatty acid combined phospholipid as well as construction method and application of engineered yeast bacterium

Abstract

The invention relates to a yeast engineering bacterium for synthesizing polyunsaturated fatty acid conjugated phospholipid as well as a construction method and application thereof, and belongs to the technical field of microbial engineering.The engineering bacterium takes yarrowia lipolytica as a chassis cell, and Mhy1, Iro1, IDH1 and CEX1 genes participating in hypha generation, triglyceride synthesis, citric acid metabolism and citric acid excretion are knocked out from a genome of the yarrowia lipolytica; the construction method comprises the following steps: sequentially connecting CDS1, OPI3, Mce2, LplA, 9Elo, 8Des, 5Des, 17Des, 5Elo, 15Des and LPCAT3 genes of acyltransferase, so as to form an expression module which is integrated at a URA site of a genome. The construction method comprises the following steps of: synthesizing phospholipids, synthesizing pyruvic acid, synthesizing polyunsaturated fatty acid, and sequentially connecting CDS1, OPI3, Mce2, LplA, 9Elo, 8Des, 5Des, 17Des, 5Elo, 15Des and LPCAT3 genes of acyltransferase. The polyunsaturated fatty acid combined phospholipid is efficiently obtained in one step through the yeast engineering bacteria, the phospholipid yield is 151.19 mg / g, and the EPA content in combined fatty acid is 13.2%.

Description

Technical Field

[0001] This invention belongs to the field of microbial engineering technology, specifically relating to a yeast engineered strain that synthesizes polyunsaturated fatty acid-bound phospholipids, its construction method, and its application. Background Technology

[0002] Polyunsaturated fatty acid-bound phospholipids (PUFAs-PL) are phospholipids whose molecules contain at least one polyunsaturated fatty acid (PUFA) group. They play a crucial role in cell membrane fluidity and permeability, and the PUFAs they carry can act as precursors of signaling molecules to participate in cellular life activities. Ingesting PUFAs is beneficial for cardiovascular health and neural development. However, PUFAs cannot be synthesized or can only be synthesized in small amounts in the human body and must be obtained through diet.

[0003] PUFAs-PL has significant advantages over common PUFAs in triglyceride form (such as fish oil): PUFAs-PL has higher bioavailability. Phospholipids naturally possess both emulsifying and hydrophilic / lipophilic properties, which significantly improve the absorption efficiency of PUFAs in the intestine. Studies have shown that the absorption rate of PUFAs-PL is much higher than that of PUFAs in triglyceride form, meaning that the same dose of PUFAs-PL provides more effective health benefits; PUFAs-PL also has stronger antioxidant stability. PUFA molecules contain multiple double bonds, making them highly susceptible to oxidative degradation and loss of activity. The phospholipid structure in PUFAs-PL, especially its hydrophilic head, can protect PUFAs from oxidation to a certain extent, thereby improving product stability and shelf life; PUFAs-PL has multiple physiological functions. PUFAs-PL not only possesses the unique physiological functions of PUFAs (such as anti-inflammation, neuroprotection, and lipid regulation), but also has the emulsifying, cell membrane building, and signal transduction functions of phospholipids themselves.

[0004] Naturally derived PUFAs-PL are primarily found in seafood such as krill and squid. Krill oil is known for its high PUFAs-PL content, with docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) existing mainly in phospholipid form, making its absorption rate higher than that of ordinary fish oil. However, extracting PUFAs-PL from these natural resources faces challenges, including high costs, yields affected by seasons and catch volumes, unstable product purity, and potential heavy metal contamination.

[0005] To overcome the limitations of natural sources, researchers have developed various synthetic methods to prepare PUFAs-PL. These methods aim to achieve large-scale, controlled, and high-purity production. Chemical synthesis: This method utilizes chemical reactions to esterify PUFAs with a phospholipid backbone. While chemical synthesis can achieve PUFAs-PL with specific structures, its reaction conditions are typically harsh (high temperature, strong acid / base), easily leading to the destruction of double bonds in the PUFA molecule. Furthermore, the product purity is low, and there are numerous side reactions, making it unsuitable for large-scale industrial production. Enzymatic synthesis: This method utilizes biological enzymes such as lipases or phospholipids to catalyze the transesterification reaction of PUFAs with lysophospholipids (Lyso-PL) or triglycerides. This method has advantages such as high specificity and fewer side reactions, but its bottleneck lies in the high cost of high-purity substrates, and the reaction efficiency and product separation still face challenges. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of existing technologies by constructing a complete PUFAs and phospholipid synthesis metabolic pathway within yeast cells using genetic engineering techniques. The resulting engineered strain PL15 exhibits a 7-fold increase in phospholipid production compared to the initial strain, and achieves PUFAs-PL synthesis. This method utilizes microorganisms as "cell factories," enabling one-stop PUFAs-PL synthesis.

[0007] This invention is achieved through the following technical solution: A yeast engineered strain PL15 that synthesizes polyunsaturated fatty acid-bound phospholipids, wherein the engineered strain uses Yersinia lipolytica as the chassis cell and knocks out the My1, Iro1, IDH1, and CEX1 genes in its genome that are involved in hyphal generation, triglyceride synthesis, citric acid metabolism, and citric acid efflux. The genes CDS1, OPI3, Mce2, LplA, Δ9Elo, Δ8Des, Δ5Des, Δ17Des, Δ5Elo, Δ15Des, and LPCAT3, which are involved in phospholipid synthesis, pyruvate synthesis, polyunsaturated fatty acid synthesis, and acyltransferases, are linked together in sequence and integrated into the URA site of the genome as an expression module.

[0008] Preferably, the base sequence of gene My1 is as shown in SEQ ID NO:1 or its degenerate sequence or a base sequence with 80% identity with it and the corresponding amino acid sequence; the base sequence of gene Iro1 is as shown in SEQ ID NO:2 or its degenerate sequence or a base sequence with 80% identity with it and the corresponding amino acid sequence; the base sequence of gene IDH1 is as shown in SEQ ID NO:3 or its degenerate sequence or a base sequence with 80% identity with it and the corresponding amino acid sequence; the base sequence of gene CEX1 is as shown in SEQ ID NO:4 or its degenerate sequence or a base sequence with 80% identity with it and the corresponding amino acid sequence; the base sequence of gene CDS1 is as shown in SEQ ID NO:5 or its degenerate sequence or a base sequence with 80% identity with it and the corresponding amino acid sequence; the base sequence of gene OPI3 is as shown in SEQ ID NO:6 or its degenerate sequence or a base sequence with 80% identity with it and the corresponding amino acid sequence; and the base sequence of gene Mce2 is as shown in SEQ ID NO:1. The base sequence of gene LplA is shown in SEQ ID NO:7 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene △9Elo is shown in SEQ ID NO:9 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene △8Des is shown in SEQ ID NO:10 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene △5Des is shown in SEQ ID NO:11 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene △17Des is shown in SEQ ID NO:12 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene △5Elo is shown in SEQ ID NO:7 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene Δ15Des is shown in SEQ ID NO:13 or its degenerate sequence or a base sequence and corresponding amino acid sequence with 80% identity with it. The base sequence of gene LPCAT3 is shown in SEQ ID NO:15 or its degenerate sequence or a base sequence and corresponding amino acid sequence with 80% identity with it.

[0009] The present invention also provides a method for constructing the above-mentioned engineered bacteria. The method is as follows: using Yersinia lipolytica as the chassis cell, the My1, Iro1, IDH1 and CEX1 genes in its genome that are involved in hyphal generation, triglyceride synthesis, citric acid metabolism and citric acid efflux are knocked out to obtain gene knockout strains. Then, promoters and terminators were added to the CDS1, OPI3, Mce2, LplA, Δ9Elo, Δ8Des, Δ5Des, Δ17Des, Δ5Elo, Δ15Des, and LPCAT3 genes for phospholipid synthesis, pyruvate synthesis, polyunsaturated fatty acid synthesis, and acyltransferases, and then they were sequentially linked together to obtain an expression module. The expression module was then integrated into the URA site of the gene knockout strain genome.

[0010] Furthermore, the gene knockout process involves using the CRISPR / Cas9 system to cut the gene at the corresponding position in the Yersinia lipolytica genome.

[0011] Furthermore, gene integration is achieved through homologous recombination of the expression modules of CDS1, OPI3, Mce2, LPIA, △9Elo, △8Des, △5Des, △17Des, △5Elo, △15Des, and LPCAT3.

[0012] The present invention also provides the application of the yeast engineered strain, which is used to obtain polyunsaturated fatty acid-bound phospholipids through fermentation.

[0013] The beneficial effects of this invention compared with the prior art are as follows: This invention obtains polyunsaturated fatty acid-bound phospholipids in one step and with high efficiency through artificial genetically engineered bacteria, with a phospholipid yield of 151.19 mg / g and an EPA content of 13.2% in the bound fatty acids. Attached Figure Description

[0014] Figure 1 The graph shows the phospholipid content in the fermentation broth; where WT is Yersinia lipolytica and PL15 is the engineered yeast strain. Figure 2 This is a graph showing the percentage of fatty acids in EPA in phospholipids at different fermentation times. Detailed Implementation

[0015] The technical solution of the present invention will be further explained below through embodiments, but the scope of protection of the present invention is not limited in any way by the embodiments.

[0016] Example 1 A yeast engineered strain that efficiently synthesizes polyunsaturated fatty acid-bound phospholipids, wherein the engineered strain uses Yersinia lipolytica (purchased from Shanghai Preservation Microbial Co., Ltd., SMHCC D25204) as the chassis cell, and the My1, Iro1, IDH1, and CEX1 genes involved in hyphal generation, triglyceride synthesis, citric acid metabolism, and citric acid efflux are knocked out in its genome. Furthermore, the CDS1, OPI3, Mce2, LplA, Δ9Elo, Δ8Des, Δ5Des, Δ17Des, Δ5Elo, Δ15Des, and LPCAT3 genes for phospholipid synthesis, pyruvate synthesis, polyunsaturated fatty acid synthesis, and acyltransferases are sequentially linked together and integrated into the URA site as an expression module.

[0017] Preferably, the base sequence of gene My1 is as shown in SEQ ID NO:1 or its degenerate sequence; the base sequence of gene Iro1 is as shown in SEQ ID NO:2 or its degenerate sequence; the base sequence of gene IDH1 is as shown in SEQ ID NO:3 or its degenerate sequence; the base sequence of gene CEX1 is as shown in SEQ ID NO:4 or its degenerate sequence; the base sequence of gene CDS1 is as shown in SEQ ID NO:5 or its degenerate sequence; the base sequence of gene OPI3 is as shown in SEQ ID NO:6 or its degenerate sequence; the base sequence of gene Mce2 is as shown in SEQ ID NO:7 or its degenerate sequence; the base sequence of gene LplA is as shown in SEQ ID NO:8 or its degenerate sequence; the base sequence of gene Δ9Elo is as shown in SEQ ID NO:9 or its degenerate sequence; the base sequence of gene Δ8Des is as shown in SEQ ID NO:10 or its degenerate sequence; the base sequence of gene Δ5Des is as shown in SEQ ID NO:11 or its degenerate sequence; and the base sequence of gene Δ17Des is as shown in SEQ ID NO:10 or its degenerate sequence. The base sequence of gene △5Elo is shown in SEQ ID NO:12 or its degenerate sequence, the base sequence of gene △15Des is shown in SEQ ID NO:14 or its degenerate sequence, and the base sequence of gene LPCAT3 is shown in SEQ ID NO:15 or its degenerate sequence.

[0018] When the protein according to this embodiment comprises a base sequence and a corresponding amino acid sequence having more than 80% sequence identity with respect to the base sequences shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, and SEQ ID NO. 15, as long as the protein has the above-mentioned activity, in addition to having an amino acid sequence for improving translation efficiency, it may also have an amino acid sequence for protein purification and an amino acid sequence for improving the expression efficiency of molecular chaperones, etc. Examples of amino acid sequences for protein purification include, for example, histidine tags, SUMO tags, and glutathione S-transferases. The amino acid sequence for improving translation efficiency, the amino acid sequence for improving purification, and the amino acid sequence for improving expression efficiency are added to at least one side of the N-terminus and C-terminus.

[0019] Next, the method for preparing the protein according to this embodiment will be described. Proteins can be chemically synthesized using known methods such as solid-phase and liquid-phase methods based on their amino acid sequences. As shown below, the protein is preferably prepared using methods from genetic engineering and molecular biology.

[0020] First, the base sequence of the polynucleotide encoding the protein is determined. The base sequence is determined by codons corresponding to amino acids. Based on the correspondence between amino acids and codons, a number of base sequences encoding that amino acid sequence are determined from a single amino acid sequence. Considering factors such as the frequency of codon usage in the chassis cell used to express the gene encoding that amino acid sequence, a suitable base sequence encoding the protein can be determined. The polynucleotide can be synthesized based on the base sequence using known methods.

[0021] In this implementation, the gene knockout process involves using the CRISPR / Cas9 system to cut the gene at the corresponding position in the Yersinia lipolytica genome.

[0022] Gene integration is achieved by using homologous recombination to express the CDS1, OPI3, Mce2, LPIA, Δ9Elo, Δ8Des, Δ5Des, Δ17Des, Δ5Elo, Δ15Des, and LPCAT3 gene expression modules.

[0023] The target sequences for the CRISPR / Cas9 system mentioned above are shown in Table 1. Table 1. Sequences targeted by the CRISPR / Cas9 system .

[0024] A knock-in vector comprising a polynucleotide encoding a protein is constructed. There are no particular restrictions on the expression vector as long as it can knock the polynucleotide into the host genome. Preferably, the knock-in vector includes an RNA polymerase-binding promoter sequence for expressing the added polynucleotide, a ribosome binding site (RBS), a nutrient selection tag, etc. In the knock-in vector, the aforementioned polynucleotide can be configured under the control of the promoter sequence. Known promoter sequences such as TEF1, TEF1in, hp4d, GPD1, GPDin, FBA, FBAin, YAT, and EXP promoters are used as promoter sequences. If necessary, restriction enzyme sites for cloning can be added to the 5' and 3' ends of the polynucleotide encoding the protein, or base sequences encoding histidine tags, SUMO tags, etc., can be added to the 5' end of the polynucleotide encoding the protein. When using restriction enzymes, the base sequences of the restriction enzyme sites contained in the polynucleotide encoding the protein can be synonymously substituted. Known terminator sequences such as CYC1, XPR2, Mig1, Lip1, and Lip2 terminators are used as terminator sequences.

[0025] The above-described protein can be expressed in chassis cells by introducing the expression vector into a host capable of expressing an RNA polymerase that binds to the promoter sequence described above. The preferred host is *Yarrowia lipolytica*.

[0026] Next, transformants are prepared by introducing the expression vector prepared above into chassis cells. There are no particular limitations on the method for introducing the knock-in vector into chassis cells, including using competent cells prepared by lithium acetate method, electroporation method, and protoplast method.

[0027] Regarding the culture methods for chassis cells, well-known culture methods suitable for chassis cells can be used. When using *Yarrowia lipolyticis* as chassis cells, they can be cultured, for example, in YPD agar medium or YPD liquid medium.

[0028] Processed products of bacterial cells include, for example, freeze-dried bacterial cells, bacterial cells dried with acetone, extracts obtained by solvent extraction of bacterial cells, and fragments obtained by pulverizing or drying bacterial cells using ultrasonic methods, bacterial cells obtained through some treatment, and compositions derived from or including a portion of bacterial cells. As solvents for solvent extraction, water, organic solvents, and mixtures thereof can be used. Examples of organic solvents include diethyl ether, chloroform, benzene, hexane, methanol, ethanol, isopropanol, and mixed solutions thereof. Extracts obtained using extraction solvents can be used as is, or concentrated or diluted, and used in liquid, gel, or paste form. Furthermore, dried products can also be used. Drying can be carried out using known methods such as spray drying, freeze drying, vacuum drying, and fluidized bed drying.

[0029] Example 2: Construction of Yeast Engineered Bacteria for Efficient Synthesis of Polyunsaturated Fatty Acid-Bound Phospholipids (1) Knockout of the hyphal synthesis gene My1 Using Yersinia lipophila as the starting strain, and employing the CRISPR / Cas9 system, this study will illustrate the use of the My1 gene as an example.

[0030] First, the target gene plasmid pCRISPRyl-Mhy1-gRNA was constructed. Using the pCRISPRyl empty vector plasmid as the basic vector, the My1 gene sequence on the genome of Yeastia lipolytica published by NCBI was obtained. The sgRNA sequence targeting the My1 gene was designed, and a tool plasmid that can express Cas9 protein and target My1 gene sgRNA was constructed. Using My1sgRNAF / Mhy1-sgRNAR as primers, each primer has a homologous sequence of the other. The pCRISPRyl plasmid was used as a template for amplification to obtain the circular plasmid pCRISPRyl-Mhy1-gRNA. Table 2 Primer sequences for constructing Mhy1, Lro1, IDH1, and CEX1 gene knockout vectors ; .

[0031] Gently mix 10 μl of the ligation product with 100 μl of DH5α competent cells in a pre-chilled 1.5 ml centrifuge tube and incubate on ice for 30 min. Then, transfer the centrifuge tube to a 42°C water bath for heat shock for 45 s, and immediately cool on ice for 2 min. Add 500 μl of LB liquid medium to the tube and incubate at 37°C, 220 rpm for 1 h. Finally, plate the mixture onto LB agar plates containing ampicillin and incubate overnight at 37°C.

[0032] The vector plasmid pCRISPRyl-Mhy1-gRNA was transformed into *Yarrowia lipolytica* strain using the lithium acetate conversion method. The specific experimental steps are as follows: 1. In 20 ml of YPD liquid medium, a single colony of Yersinia lipolyticis was cultured and placed in a shaker incubator at 30°C for overnight incubation; 2. Transfer 200 μl of bacterial culture to another 20 ml of YPD liquid medium and incubate at 30°C in a shaker for 4-5 h until OD (dose retardation) occurs. 600 Approximately 0.6~0.8; 3. Collect the bacterial cells using a 1.5 ml centrifuge tube, add 1 ml of 100 mM LiAc to suspend the bacterial cells, centrifuge at 8000 rpm for 15 s, and aspirate the supernatant. 4. Add the following reagents to the tube in the following order and volume: 240 μl 50% PEG3350, 36 μl 1 M LiAC, 25 μl ssDNA, 10 μl circular plasmid pCRISPRyl-Mhy1-gRNA, and ddH2O to make up to 360 μl. Vortex to mix well and incubate at 30°C for 30 min. 5. Place the sample in a 42℃ water bath for 30 min of heat shock treatment, then centrifuge at 8000 rpm for 30 s and discard the supernatant. Resuspend the bacterial cells in 1 ml of YPD medium and incubate in a 28℃ constant temperature shaker for 2 h. After recovery, centrifuge the bacterial solution at 8000 rpm for 1 min. 6. Use a pipette to take 200 μl of ddH2O suspension of bacterial cells, spread it on leucine-deficient medium, and incubate upside down for 2 to 3 days; Single clones were selected from plates from which strains grew after screening on leucine-deficient media and cultured in 300 μl of YPD liquid medium; The Iro1, IDH1, and CEX1 genes were knocked out using the same procedure.

[0033] (2) Knock-in gene Using a gene-deficient strain of Yersinia lipophila as the starting strain, the modified pINA1312 was used as the knock-in plasmid.

[0034] Using the pINA1312 empty plasmid backbone as the basic vector, the plasmid was linearized using primers p13hzetab-F, p13hzetab-R, p13hzetah-F, and p13hzetah-R (primer sequences are shown in Table 3). The linearized amplified product was successfully obtained by PCR. The PCR reaction program was: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min.

[0035] Based on the URA region sequence of *Yarrowia lipolyticis*, homologous recombination primers, YliURAHRp13b-F, YliURAHRp13b-R, YliURAHRp13h-F, and YliURAHRp13h-R, were designed (primer sequences are shown in Table 3), and PCR amplification was performed. The amplified product of the insert fragment was successfully obtained by PCR. The PCR reaction program was: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min. The target fragment with upstream and downstream homologous arms was obtained.

[0036] The ligation reaction was performed using the purchased ClonExpress® Ultra One Step Cloning Kit V2. The ligation system was prepared according to the kit instructions. The PCR-linearized plasmid and product were mixed thoroughly, and the mixture was placed in the PCR instrument. The temperature was set to 50°C and the reaction time was 20 min.

[0037] Gently mix 10 μl of the ligation product with 100 μl of DH5α competent cells in a pre-chilled 1.5 ml centrifuge tube and incubate on ice for 30 minutes. Then, transfer the centrifuge tube to a 42°C water bath for heat shock for 45 seconds, and immediately cool on ice for 2 minutes. Add 500 μl of LB liquid medium to the tube and incubate at 37°C and 220 rpm for 1 hour. Finally, plate the mixture onto LB agar plates containing kanamycin and incubate overnight at 37°C.

[0038] Using the purchased plasmid extraction kit, the successfully constructed plasmid was extracted following the instructions in the kit's manual. The plasmid pINA1312-u was obtained. Table 3. Modified primers for pINA1312 .

[0039] The plasmid pINA1312-u was digested with BamH Ⅰ endonuclease. The digestion system consisted of 1 μg of pINA1312-u plasmid, 5 μl of 10×NE Buffer, 2 μl of BamH Ⅰ, and ddH2O. The mixture was then suspended and incubated overnight in a water bath at 37°C.

[0040] Based on the CDS sequence of CDS1, homologous recombination primers were designed for PCR amplification. The amplified product of the insert fragment was successfully obtained by PCR. The PCR reaction program was: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min. The target fragment with upstream and downstream homologous arms was obtained.

[0041] The ligation reaction was performed using the purchased ClonExpress® Ultra One Step Cloning Kit V2. Following the ligation system in the kit instructions, the linearized plasmid digested with BamH I restriction enzyme was mixed with the product. The mixture was placed in a PCR instrument, and the temperature was set to 50℃ for 20 min.

[0042] Gently mix 10 μl of the ligation product with 100 μl of DH5α competent cells in a pre-chilled 1.5 ml centrifuge tube and incubate on ice for 30 minutes. Then, transfer the centrifuge tube to a 42°C water bath for heat shock for 45 seconds, and immediately cool on ice for 2 minutes. Add 500 μl of LB liquid medium to the tube and incubate at 37°C and 220 rpm for 1 hour. Finally, plate the mixture onto LB agar plates containing kanamycin and incubate overnight at 37°C.

[0043] Using the purchased plasmid extraction kit, extract the successfully constructed plasmid by following the steps in the kit's instructions.

[0044] Gene knock-in plasmids for OPI3, Mce2, LplA, △9Elo, △8Des, △5Des, △17Des, △5Elo, △15Des, and LPCAT3 were constructed using the same steps.

[0045] Using pINA1312-u-CDS1 plasmid as the basic vector, the plasmid pINA1312-u-CDS1 was digested with EcoRI restriction enzyme. The digestion system consisted of 1 μg pINA1312-u-CDS1 plasmid, 5 μl 10×NE Buffer, 2 μl EcoRI, and ddH2O. The mixture was then suspended and incubated overnight in a water bath at 37°C.

[0046] Based on the promoter-terminator region sequence of pINA1312-u-OPI3, homologous recombination primers were designed for PCR amplification. The amplified product of the insert fragment was successfully obtained by PCR. The PCR reaction program was: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min. The target fragment with upstream and downstream homologous arms was obtained.

[0047] The ligation reaction was performed using the purchased ClonExpress® Ultra One Step Cloning Kit V2. Following the ligation system in the kit instructions, the linearized plasmid digested with EcoRI endonuclease was mixed with the product. The mixture was placed in a PCR instrument, and the temperature was set to 50℃ for 20 min.

[0048] Gently mix 10 μl of the ligation product with 100 μl of DH5α competent cells in a pre-chilled 1.5 ml centrifuge tube and incubate on ice for 30 minutes. Then, transfer the centrifuge tube to a 42°C water bath for heat shock for 45 seconds, and immediately cool on ice for 2 minutes. Add 500 μl of LB liquid medium to the tube and incubate at 37°C and 220 rpm for 1 hour. Finally, plate the mixture onto LB agar plates containing kanamycin and incubate overnight at 37°C.

[0049] Using the purchased plasmid extraction kit, extract the successfully constructed plasmid by following the steps in the kit's instructions.

[0050] Following the same steps, the promoter to terminator sequences from the corresponding pINA1312-u plasmids of the Mce2, LplA, 9Elo, 8Des, 5Des, 17Des, 5Elo, 15Des, and LPCAT3 genes were sequentially inserted into the previously constructed plasmid. This yielded pINA1312-u-CDS1-OPI3-Mce2-LplA-9Elo-8Des-5Des-17Des-5Elo-15Des-LPCAT3.

[0051] The plasmid pINA1312-u-CDS1-OPI3-Mce2-LplA-9Elo-8Des-5Des-17Des-5Elo-15Des-LPCAT3 was digested with Not I restriction enzyme. The digestion system consisted of 1 μg of pINA1312-u-CDS1-OPI3-Mce2-LplA-9Elo-8Des-5Des-17Des-5Elo-15Des-LPCAT3 plasmid, 5 μl of 10×NE Buffer, 2 μl of Not I, and ddH2O. The mixture was then suspended and incubated overnight in a water bath at 37°C.

[0052] The specific experimental steps for transforming the linearized plasmid pINA1312-u-CDS1-OPI3-Mce2-LplA-9Elo-8Des-5Des-17Des-5Elo-15Des-LPCAT3 into the *Yarrowia lipolytica* strain using the lithium acetate conversion method are as follows: 1. In 20 ml of YPD liquid medium, a single colony of Yersinia lipolyticis was cultured and placed in a shaker incubator at 30°C for overnight incubation; 2. Transfer 200 μl of bacterial culture to another 20 ml of YPD liquid medium and incubate at 30°C in a shaker for 4-5 hours until OD (dose retardation) occurs. 600 Approximately 0.6~0.8; 3. Collect the bacterial cells using a 1.5 ml centrifuge tube, add 1 ml of 100 mM LiAc to suspend the bacterial cells, centrifuge at 8000 rpm for 15 s, and aspirate the supernatant. 4. Add the following reagents to the tube in the following order and volume: 240 μl 50% PEG3350, 36 μl 1M LiAC, 25 μl ssDNA, 10 μl linearized plasmid, and ddH2O to make up to 360 μl. Vortex to mix and incubate at 30°C for 30 min. 5. Place the sample in a 30℃ water bath for 30 min of heat shock treatment, then centrifuge at 8000 rpm for 30 s and discard the supernatant. Resuspend the bacterial cells in 1 ml of YPD medium and incubate in a 28℃ constant temperature shaker for 2 h. After recovery, centrifuge the bacterial solution at 8000 rpm for 1 min. 6. Use a pipette to take 200 μl of ddH2O suspension of bacterial cells, spread it on uracil-deficient medium, and incubate upside down for 2 to 3 days.

[0053] Single clones were selected from plates from strains grown after screening on uracil-deficient media and cultured in 300 μL of YPD liquid medium to obtain engineered yeast PL15.

[0054] Example 3 Fermentation of strains The engineered yeast PL15 obtained in Example 2 was inoculated into 5 mL of YPD liquid medium and cultured at 30℃ and 250 rpm / min for 19 h to prepare a primary seed culture; at the same time, a chassis cell Yersinia lipolyticis was set up as a fermentation control group.

[0055] In a preferred embodiment, the prepared primary seed culture is inoculated into 50 ml of YPD liquid culture medium at an inoculation ratio of 1%, and cultured at 30°C and 250 rpm / min for 18 h to prepare the secondary seed culture. In a preferred embodiment, the prepared secondary seed culture is inoculated into a container of 3 l YPD liquid culture medium, and the initial OD of the fermentation suspension is controlled. 600 =0.1, and then cultured at 30℃ and 250 rpm / min for 120 h to obtain fermentation broth.

[0056] Example 4: Detection of polyunsaturated fatty acid-bound phospholipids Take 10 ml of the fermentation broth prepared in Example 3 at different fermentation times, freeze-dry it, and measure the total weight of the thawed cells. Add 400 μL MTBE, 80 μL MeOH, and 200 μL H2O to the cell precipitate (maintaining MTBE:MeOH:H2O = 10:2:5, v / v); vortex for 30 s and sonicate for 10 min; centrifuge at 3,000 rpm for 15 min to separate the aqueous and organic phases (a white precipitate appears at the interface); transfer the supernatant to a new EP tube and dry it (transfer a fixed volume, such as 200 μL) and rotary evaporate to dryness; reconstitute the dried extract with 100 μL DCM:MeOH (1:1, v / v), and reconstitute the sample in an isotope standard mixture.

[0057] Using an Exion UPLC-QTRAP 6500 Plus (Sciex) liquid chromatography-mass spectrometry system, All analyses were performed in electrospray ionization (ESI) mode under the following conditions: Curtain air = 20 Spray voltage = 5500 V Temperature = 400℃ Ion source gas 1=35 Ion source gas 2=35 The HPLC conditions are as follows: Chromatographic column: Phenomenex Luna silica 3 μm (inner diameter 150 × 2.0 mm) Mobile phase A (chloroform:methanol:ammonia water 89.5:10:0.5) Mobile phase B (chloroform:methanol:ammonia:water 55:39:0.5:5.5) 0 minutes; Mobile phase A 95%; Mobile phase B 5%; 5 minutes; Mobile phase A 60%; Mobile phase B 40%; 9 minutes; Mobile phase A 30%; Mobile phase B 70%; 24 minutes; Mobile phase A 95%; Mobile phase B 5%; 29 minutes; Mobile phase A 95%; Mobile phase B 5%; Multiple reaction monitoring (MRM) was established for the identification and quantification of various lipids. Lipid quantification was performed using internal standards, including: d31-16:0, d8-20:4, d3-16:0-carnitine, PC-d31 (16:0 / 18:1), DMPC, DMPE, di-C8-PI, DMPG, BMP-(14:0 / 14:0), LPC-17:0, LPE-17:1, LPS-17:1, LPA-17:0, LPI-17:1, SM d18:1 / 12:0, PS-d31 (16:0 / 18:1), SL-d18:1 / 17:0, PA (17:0 / 17:0), and Cer. d18:1-d7 / 15:0, GluCer-d18:1 / 8:0, d3-LacCer-d18:1 / 16:0, d3-GM3-d18:1 / 18:0, S1P-d18:1 / 17:0, CL 22:1(3)-14:1, GalCer-d18:1 / 8:0, Gb3 d18:1 / 17:0, Sph-d18:1 / 17:0.

[0058] The results are as follows Figure 1 and Figure 2 As shown, after 120 h of fermentation, the engineered bacteria produced 151.19 mg / g of phospholipids, and the proportion of EPA in the bound fatty acids was 13.2%.

[0059] SEQ ID NO:1 Mhy1: atggacctcgaattggaaattcccgtcttgcattccatggactcgcaccaccaggtggtggactcccacagactggcacagcaacagttccagtaccagcagatccacatgctgcagcagacgctgtcacagcagtacccccacaccccatccaccacaccccccatttacatgctgtcgcctgcggactacgagaaggacgccgtttccatctcaccggtaatgctgtggcccccctcggcccactcccaggcctcttaccattacgagatgccctccgttatctcgccatctccttctcccactagatccttctgtaatccgagagagctggaggttcaggacgagctcgagcagcttgaacagcagcccgccgctctctccgtcgaacatctgtttgacattgagaactcatcgatcgagtatgcacacgacgagctgcatgacacctcttcgtgctccgactcgcagtcgagcttttcccctcagcagtcccctgcctccccggcctccacttactcgcctctcgaggacgagtttctcaacttggctggatccgagttgaagagcgagcccagcgcggacgacgagaaggatgatgtggacacggagcttccccagcagcccgagatcatcatccctgtgtcgtgccgaggccgaaagccgtccatcgacgactccaaaaagacttttgtctgcacccactgccagcgtcggttccggcgccaggagcatctcaagcgacatttccgatccctacacactcgagagaagcctttcaactgcgacacgtgcggcaagaagttttctcggtcggacaatctcgcccagcatatgcgtacgcatcctcgggactag; SEQ ID NO:2 Lro1: SEQ ID NO:3 IDH1: SEQ ID NO:4 CEX1: SEQ ID NO:5 CDS1: SEQ ID NO:6 OPI3: atgtcctttcctgacaagattgttgccgacttcaacgtggattacgaccagaagagcctctggatcgtcctgggctccatcgccttcaaccccatcttttggaacattgttgctcgagccgagtacaacacccactttctgactaagctggctggaggagctaagaccggatgctatctgctggccatcaccattttctcgctcggtatcttccgagactacctttaccaccaggctcttgagcagcagcccacctccattctgctgtcggtcacctacgttgacattgtcaagcctctggccattgtgctgtttgctgttggcaacgtgctggtccttacctccatgtacgccctgggcgtcaccggaacctacctcggcgactactttggcattctcatgaacgagcgagtcaccggcttccccttcaatgtgtccaacaaccccatgtaccacggctccactctgtgtttcctggcttccgctctgtggtacgccaagcccgcaggcctgctcatcaccgcctttgtgtcgctcatgtactccattgctctcaagttcgaggaacccttcaccggtgagatctacgctaagcgagaccgggagctcgctgccaagcagaagtaa; SEQ ID NO:7 Mce2: SEQ ID NO:8 LplA: SEQ ID NO:9 △9Elo: atggaggtcgtgaacgaaatcgtctccattggccaggaggttcttcccaaggtcgactatgctcagctctggtctgatgcctcgcactgcgaggtgctgtacctctccatcgccttcgtcatcctgaagttcacccttggtcctctcggacccaagggtcagtctcgaatgaagtttgtgttcaccaactacaacctgctcatgtccatctactcgctgggctccttcctctctatggcctacgccatgtacaccattggtgtcatgtccgacaactgcgagaaggctttcgacaacaatgtcttccgaatcaccactcagctgttctacctcagcaagttcctcgagtacattgactccttctatctgcccctcatgggcaagcctctgacctggttgcagttctttcaccatctcggagctcctatggacatgtggctgttctacaactaccgaaacgaagccgtttggatctttgtgctgctcaacggcttcattcactggatcatgtacggctactattggacccgactgatcaagctcaagttccctatgcccaagtccctgattacttctatgcagatcattcagttcaacgttggcttctacatcgtctggaagtaccggaacattccctgctaccgacaagatggaatgagaatgtttggctggtttttcaactacttctacgttggtactgtcctgtgtctgttcctcaacttctacgtgcagacctacatcgtccgaaagcacaagggagccaaaaagattca gtga; SEQ ID NO:10 △8Des: SEQ ID NO:11 △5Des: SEQ ID NO:12 △17Des: SEQ ID NO:13 △5Elo: atggctgctcgagtagagaagcagcaggcaccggccaaggctgcgaaaaaggtgggcagtcgtgtggatcggtcagatggattcttccgaacattcaacctgtgcgccctctacggctcggccttcgcttatgcatacaacaacggccccgtggacaacgacggaaagggcctctacttctctaaatctcctttttatgcgtttctggtttctgacgccatgacctttggtgctccccttatgtatgtcatcgccgtcatggcgctatcgcgatacatggctgacaagcagcccctcaccggcttcatcaagtcctacatacaacctgtctacaatattgtccagattgttgtatgctcatggatggcttggggcctgctgccccaggttgatattttcaatttgaaccccttcggattaaataagcaaagagatgccaacattgagttctttgtgatggtccatctgctaaccaagttccttgactggaccgacactttcatcatgatcttcaagaagaactacgcccaggtgtcttttttgcaggtgtttcaccacgcaaccattggaatggtgtggtcttttttgctccaacgcggctggggtagcggaaccgccgcttacggtgcctttatcaactccgttactcatgtgattatgtacacgcactactttgtgacttcgcttaacattaacaatcctttcaaacggtacattacgggtttccagctgagccagttcgccagttgtatcgtccatgctttgctagttctggcctttgaagaggtgtaccctctcgagtacgcgtacctgcagatctcctaccacatcatcatgctctatctgtttggaagacgaatgaactggtccccactctggtgtacaggggaagttgacggtctggacgtcaacgtcgagacttccaagaaggcccagtga; SEQ ID NO:14 △15Des: SEQ ID NO:15 LPCAT: atgaacagttggatatatgtcgctgtgattgcagttgctgccgttctcattgcccgaatgtccgttgcatccaagctcgtcttctacgtccgcgccgccatcgccgtggtcatctttgccgcctgtgccacctacggcgtgctggcgtccaccattctcaccgccatcggcaagcagggcctggcccaatggaccgttgccagagccttctactactcggtgcgcatcttcctgggtatcagcatcaagctgcgtagccggcaggtgaccggaaccgccggtctggatgcctccaagatccaggtcgccaacaccaccaagcccattgacgacatcaccaaacacctgccccgaccatgcattctgatttccaaccaccagaacgaaatggacattctggtgctcggtcgcatcttcccccagtactgctccgtcaccgccaaaaaggccctcaagtggtaccctctgctgggccagttcatggcgctgtccggcaccatcttcctggaccgaaaggaccgaaccaagtccgtgcagaccctcggcggcgccgtcaagaccatccagagcggcaacggaggcaagggccagagcgtcttcatgttccccgagggaacccgatcctactccaaggacgtcggcatcatgcccttcaagaagggctgtttccacctggcggtccagtcgggcgctcccattgtccccgtggtggtccagaacacctcccgaatgttttctttcggccgaggcaagctggacgccggagagatccttgtcgacgtcctgagccccattgagaccaagggtctggacgccagcaacgtcgacgctctcatggccaccacttataaggccatgtgcgagactgccgaccagattggctacgctggccagaagactcagtag。

Claims

1. A yeast strain for synthesizing polyunsaturated fatty acid-bound phospholipids, characterized in that, The engineered bacteria used Yersinia lipolyticis as the chassis cell, and the My1, Iro1, IDH1, and CEX1 genes involved in hyphal generation, triglyceride synthesis, citric acid metabolism, and citric acid efflux were knocked out from its genome. The genes CDS1, OPI3, Mce2, LplA, Δ9Elo, Δ8Des, Δ5Des, Δ17Des, Δ5Elo, Δ15Des, and LPCAT3, which are involved in phospholipid synthesis, pyruvate synthesis, polyunsaturated fatty acid synthesis, and acyltransferases, are linked together in sequence and integrated into the URA site of the genome as an expression module.

2. The engineered yeast strain according to claim 1, characterized in that, The base sequences of the genes My1, Iro1, IDH1, CEX1, CDS1, OPI3, and Mce2 are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, CDS1, OPI3, CDS1, and Mce2 are shown in SEQ ID NO:5, SEQ ID NO:6, and Mce2 are shown in SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:1, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:2, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:1 ... The base sequence of gene LplA is shown in SEQ ID NO:7 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene △9Elo is shown in SEQ ID NO:9 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene △8Des is shown in SEQ ID NO:10 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene △5Des is shown in SEQ ID NO:11 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene △17Des is shown in SEQ ID NO:12 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene △5Elo is shown in SEQ ID NO:7 or its degenerate sequence or a base sequence with 80% identity with it, and the corresponding amino acid sequence. The base sequence of gene Δ15Des is shown in SEQ ID NO:13 or its degenerate sequence or a base sequence and corresponding amino acid sequence with 80% identity with it. The base sequence of gene LPCAT3 is shown in SEQ ID NO:15 or its degenerate sequence or a base sequence and corresponding amino acid sequence with 80% identity with it.

3. The method for constructing the engineered yeast strain according to claim 1 or 2, characterized in that, The method is as follows: using Yersinia lipolytica as the chassis cell, the My1, Iro1, IDH1, and CEX1 genes in its genome that are involved in hyphal generation, triglyceride synthesis, citric acid metabolism, and citric acid efflux are knocked out to obtain gene knockout strains. Then, promoters and terminators were added to the CDS1, OPI3, Mce2, LplA, Δ9Elo, Δ8Des, Δ5Des, Δ17Des, Δ5Elo, Δ15Des, and LPCAT3 genes for phospholipid synthesis, pyruvate synthesis, polyunsaturated fatty acid synthesis, and acyltransferases, and then they were sequentially linked together to obtain an expression module. The expression module was then integrated into the URA site of the gene knockout strain genome.

4. The method according to claim 3, characterized in that, Gene knockout is performed by using the CRISPR / Cas9 system to cut genes at the corresponding positions in the Yersinia lipolyticis genome.

5. The method according to claim 3, characterized in that, Gene integration is achieved by using homologous recombination to express the CDS1, OPI3, Mce2, LPIA, Δ9Elo, Δ8Des, Δ5Des, Δ17Des, Δ5Elo, Δ15Des, and LPCAT3 gene expression modules.

6. The application of the engineered yeast strain according to claim 1 or 2, characterized in that, Polyunsaturated fatty acid-bound phospholipids were obtained by fermentation using the engineered yeast strains.

Images