Recombinant shewanella producing 5-amino levulinic acid and its use

Abstract

The present application relates to the field of metabolic engineering and microbial fermentation, and in particular to a recombinant shewanella producing 5-amino levulinic acid and its application. The present application discloses a new 5-amino levulinic acid producing strain, which is obtained by modularly modifying shewanella by synergistically expressing 5-amino levulinic acid production module genes (hemA, hemL and gltX) derived from shewanella, antioxidant module genes (katE, sodB) derived from escherichia coli, and introducing inhibition modules (the inhibition genes are hemB2 and sucA), so that the shewanella can efficiently produce 5-amino levulinic acid, and the yield of 5-amino levulinic acid can be increased by 134.0 times compared with the original strain.

Description

Technical Field

[0001] This invention relates to the fields of metabolic engineering and microbial fermentation, specifically to recombinant Shewanella bacteria that produce 5-aminolevulinic acid and their applications. Background Technology

[0002] 5-Aminolevulinic acid (5-ALA) is a functional non-protein amino acid widely found in the cells of bacteria, animals, and plants. It is an essential precursor for the synthesis of tetrapyrrole compounds such as heme and microbial B12. Due to its important roles in cancer diagnosis and treatment, promoting crop growth, and enhancing livestock immunity, it is widely used in medicine, agriculture, aquaculture, and chemical industries, resulting in a huge market demand that is increasing rapidly year by year.

[0003] Currently, 5-ALA is mainly produced through chemical synthesis. However, the complex steps, numerous byproducts, difficulties in separation and purification, high cost and high toxicity of raw materials limit the scale of industrial production using chemical synthesis, hindering the widespread application of 5-ALA in various fields. Biological methods are favored due to their simple, environmentally friendly production processes and low production costs. Currently, there are two main biosynthetic pathways for 5-ALA: the C4 pathway and the C5 pathway. These use succinyl-CoA, glycine, and glutamate as substrates, respectively, and synthesize 5-ALA through a one-step enzymatic reaction (5-ALA synthase, ALAS) or a three-step enzymatic reaction (glutamyl-tRNA synthetase GluRS, glutamyl-tRNA reductase GluTR, and glutamine aminotransferase GSA-AM). Although the C4 pathway is shorter, it relies on the exogenous addition of glycine, resulting in higher production costs. The C5 pathway, on the other hand, has a more significant substrate advantage. Utilizing the C5 pathway for 5-ALA biosynthesis holds promise for establishing a low-cost raw material route, thereby reducing production costs.

[0004] Efficient 5-ALA production depends on the selection of chassis microorganisms, key enzymes, and the regulation of microbial metabolic flux. However, the selection of chassis microorganisms and key enzyme genes for 5-ALA biosynthesis using the C5 pathway is currently limited. Existing studies have primarily used *Escherichia coli* (CN114381416A, CN104004701A) as chassis microorganisms, while the key enzyme gene GluTR mainly originates from *E. coli* and *Salmonella typhi*. Furthermore, the regulatory mechanisms are mainly based on enhancing the expression of genes in the 5-ALA synthesis pathway or enhancing 5-ALA efflux capacity, lacking multi-modal modification.

[0005] Therefore, there is a need in the field to develop new high-yield strains of 5-aminolevulinic acid and key enzyme genes, thereby broadening the selection range of chassis microorganisms and key enzymes, and to carry out multi-dimensional modular modification of the metabolic flow of the chassis microorganisms, so as to better achieve efficient production of 5-aminolevulinic acid. Summary of the Invention

[0006] In view of this, the technical problem to be solved by the present invention is to provide a recombinant Shewanella bacterium that produces 5-aminolevulinic acid and its application.

[0007] The present invention provides a nucleic acid that interferes with the expression of the 5-ALA dehydratase gene and / or the α-ketoglutarate dehydrogenase gene, having a nucleotide sequence as shown in SEQ ID NO:9.

[0008] The nucleic acid encoding the recombinant antigen described in this invention can be DNA, RNA, cDNA, or PNA. In embodiments of this invention, the nucleic acid is in the form of DNA. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (e.g., promoters or transcription terminators). The nucleic acid can be topologically linear or circular. The nucleic acid can be, for example, a part of a vector (e.g., an expression or cloning vector), or a fragment. The nucleic acid can be obtained directly from a natural source or can be prepared with the assistance of recombinant, enzymatic, or chemical techniques. The RNA form is mRNA obtained by gene transcription, etc.

[0009] Furthermore, the present invention provides a recombinant vector comprising a vector backbone and the nucleic acid described in the present invention.

[0010] The vector backbone of this invention can be derived from, but is not limited to, prokaryotic vectors, including p15a, pET28a, pUC18, or pUC19. In some specific embodiments of this invention, p15a and pYYDT are used as the vector backbone to recombine with the nucleic acids described herein, thereby constituting the recombinant vector of this invention.

[0011] Furthermore, the recombinant vector described in this invention refers to a recombinant nucleic acid vector, a recombinant DNA molecule containing the desired coding sequence and suitable nucleic acid sequences or elements essential for the expression of the operatively linked coding gene in a specific host organism. Nucleic acid sequences or elements essential for expression in model organisms or mammalian cells include promoters, ribosome binding sites, and possibly other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and terminators. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. In this specification, "plasmid" and "vector" are sometimes used interchangeably because plasmids are currently the most commonly used form of vector.

[0012] The present invention provides the application of the nucleic acid or the recombinant vector described herein in reducing the expression of the 5-ALA dehydratase gene and the α-ketoglutarate dehydrogenase gene in strains.

[0013] The present invention provides a strain that produces 5-aminolevulinic acid, wherein the 5-ALA dehydratase gene and the α-ketoglutarate dehydrogenase gene are expressed at low levels, and the low expression is caused by the recombinant vector described in the present invention.

[0014] In this invention, the strain overexpresses genes related to the co-production module, which include: a gene encoding glutamyl-tRNA synthetase, a gene encoding glutamyl-tRNA reductase GluTR, and a gene encoding glutalamidol aminotransferase GSAM.

[0015] Furthermore, the strain described in this invention also overexpresses antioxidant module-related genes, including: a catalase-encoding gene and a superoxide dismutase-encoding gene.

[0016] In the strains described in this invention,

[0017] The glutamyl-tRNA synthase encoding gene is derived from Shewanella, and its nucleotide sequence is shown in SEQ ID NO:4;

[0018] The glutamyl-tRNA reductase GluTR encoding gene is derived from Shewanella, and its nucleotide sequence is shown in SEQ ID NO:1;

[0019] The glutamyl aminotransferase GSAM encoding gene is derived from Shewanella, and its nucleotide sequence is shown in SEQ ID NO:3.

[0020] The catalase encoding gene is derived from Escherichia coli, and its nucleotide sequence is shown in SEQ ID NO:5;

[0021] The superoxide dismutase encoding gene is derived from Escherichia coli, and its nucleotide sequence is shown in SEQ ID NO:6.

[0022] This invention utilizes the CRISPRi system to inhibit the expression of the 5-ALA dehydratase gene hemB2 and the α-ketoglutarate dehydrogenase gene sucA to varying degrees, with the degree of inhibition determined by interfering sequences. Experimental results show that different sequences inhibit the genes to varying degrees, and the 5-aminolevulinic acid (5-ALA) production of the strain that inhibits hemB2 alone is significantly lower than that of the strain that inhibits both hemB2 and sucA simultaneously. Compared with the original strain, the 5-ALA production increased by 134.0-fold when hemB2 and sucA were simultaneously inhibited and synergistically expressed using the sequence shown in SEQ ID NO:9, which is part of both the production and antioxidant systems.

[0023] In this invention, the gene combination is the optimal combination obtained after screening. In some embodiments of this invention, the yield of 5-aminolevulinic acid in strains using gene combinations from other sources of synergistic growth modules is significantly lower than that in gene combinations from the production modules described in this invention. In some specific embodiments of this invention, the yield of strains using the glutamyl-tRNA reductase encoding gene hemAsa from Salmonella Arizona combined with the glutamyl-tRNA synthase encoding gene and the glutamine aminotransferase GSAM encoding gene from Shewanella is significantly lower than that of strains where all three genes are derived from Shewanella.

[0024] Furthermore, in this invention, the chassis strain of the strain is Shewanella MR-1.

[0025] In this invention, the hemA gene encoding glutamyl-tRNA reductase in the co-expression production module is the first key enzyme in 5-ALA biosynthesis. Therefore, the activity and stability of this enzyme play a crucial role in 5-ALA biosynthesis. However, current patents or literature primarily use enzymes derived from *Salmonella Arizonae* or *Salmonella Typhimurium*, limiting the range of choices for enzyme optimization. Therefore, this invention provides new key enzyme genes for selection. Furthermore, this invention employs co-growth module-related genes from *Shewanella*: the glutamyl-tRNA synthetase encoding gene and the glutamate aminotransferase (GSAM) encoding gene, and antioxidant module-related genes from *Escherichia coli*: the catalase encoding gene and the superoxide dismutase encoding gene. These sources differ from traditional sources, further expanding the range of gene selection. The substrate bacteria used in this invention are also different. The recombinant strain described in this invention is used for 5-ALA synthesis. Compared to the original strain, integrating only the production module increased 5-ALA production by 66.8 times; integrating only the co-production module and the antioxidant module increased 5-ALA production by 87.4 times; and integrating the co-expression production system, the antioxidant system, and the inhibition system (inhibiting the expression of the 5-ALA dehydratase gene and the α-ketoglutarate dehydrogenase gene) simultaneously increased 5-ALA production by 134.0 times, which is 99.0% and 52.6% higher than the single expression production system and the co-expression production and antioxidant system, respectively.

[0026] This invention provides a method for preparing 5-aminolevulinic acid, which involves fermenting the strain described in this invention to obtain a culture containing 5-aminolevulinic acid.

[0027] Furthermore, the fermentation conditions include: adding seed culture at an inoculum of 0.6 vol% to a fermentation liquid culture medium containing kanamycin and chloramphenicol and culturing for 2 hours, followed by induction with 0.5 mM isopropyl thiogalactoside.

[0028] This invention discloses a novel 5-aminolevulinic acid (5-ALA)-producing strain. This strain modifies Shewanella by synergistically expressing 5-ALA production module genes (hemA, hemL, and gltX) derived from Shewanella and antioxidant module genes (katE and sodB) derived from Escherichia coli, and by introducing repression modules (hemB2 and sucA) to enable efficient 5-ALA production. The yield of 5-ALA can be increased by up to 134.0 times compared to the original strain. Attached Figure Description

[0029] Figure 1 Schematic diagram of the 5-ALA production route;

[0030] Figure 2This document describes the construction process of expression plasmids pYYDT-LAG and pYYDT-LAGKS.

[0031] Figure 3 This document describes the construction process of the expression plasmid p15a-ddcpf1(hemB2);

[0032] Figure 4 This document describes the construction process of the expression plasmid p15a-ddcpf1(hemB2-sucA);

[0033] Figure 5 The results show the yield of 5-ALA. Detailed Implementation

[0034] This invention provides recombinant Shewanella bacteria producing 5-aminolevulinic acid and their applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0035]

[0036]

[0037]

[0038]

[0039]

[0040] The nucleotide sequence of sodB is: atgtcattcgaattacctgcactaccatatgctaaagatgctctggcaccgcacatttctgcggaaaccatcgagtatcactacggcaagcaccatcagacttatgtcactaacctgaacaacctgattaaaggtaccgcgtttgaaggtaaatcactggaagagattattcgcagctctgaaggtggcgtattcaacaacgcagctcaggtctggaaccatactttctactggaactgcctggcaccgaacgccggtggcgaaccgactggaaaagtcgctgaagctatcgccgcatcttttggcagctttgccgatttcaaagcgcagtttactgatgcagcgatcaaaaactttggttctggctggacctggctggtgaaaaacagcgatggcaaactggctatcgtttcaacctctaacgcgggtactccgctgaccaccgatgcgactccgctgctgaccgttgatgtctgggaacacgcttattacatcgactatcgcaatgcacgtcctggctatctggagcacttctgggcgctggtgaactgggaattcgtagcgaaaaatctcgctgcataa (as shown in SEQ ID NO: 6).

[0041] The nucleotide sequence for synthesizing the targeting sequence hemB2(4)-sucA(1) is: acttcgctcaattagaacgtatacgtcctataagaaggggcgtatacaggtgctttttcaccccaatttctactcttgtagatgcagagtaggcc atgatttgagtaatttctactcttgtagatgccatttgggaagcgcaatttgggagccaggcatcaaataaaacgaaaggctcagtcgaaaga ctgggcctttcgttttatctgttgtttgtcg (as shown in SEQ ID NO: 7).

[0042] The nucleotide sequence of the synthetic target sequence hemB2(4)-sucA(2) is: acttcgctcaattagaacgtatacgtcctataagaaggggcgtatacaggtgctttttcaccccaatttctactcttgtagatgcagagtaggcc atgatttgagtaatttctactcttgtagataacccgtctcaccttgaaatcgtgagccaggcatcaaataaaacgaaaggctcagtcgaaagac tgggcctttcgttttatctgttgtttgtcg (as shown in SEQ ID NO:8).

[0043] The nucleotide sequence of the target sequence hemB2(4)-sucA(3) is: acttcgctcaattagaacgtatacgtcctataagaaggggcgtatacaggtgctttttcaccccaatttctactcttgtagatgcagagtaggcc atgatttgagtaatttctactcttgtagatctgcgatcagtttgtcagcgtaagagccaggcatcaaataaaacgaaaggctcagtcgaaagac tgggcctttcgttttatctgttgtttgtcg (as shown in SEQ ID NO:9).

[0044] The test materials used in this invention are all common commercial products and can be purchased on the market.

[0045] The present invention will be further illustrated below with reference to the embodiments:

[0046] Example 1: Construction of recombinant plasmids expressing production, antioxidant, and inhibitory modules.

[0047] I. Construction of recombinant plasmids pYYDT-LAsaG and pYYDT-LAG expressing production modules

[0048] 1. Extraction of genomic DNA from Shewanella oneidensis and PCR amplification of the hemL, hemA, and gltX genes; the hemL gene encodes glutamate-1-hemialdehyde aminotransferase GSAM from Shewanella; the hemA gene encodes glutamyl-tRNA reductase GluTR from Shewanella; and the gltX gene encodes glutamyl-tRNA synthetase GluTS from Shewanella.

[0049] Genomic DNA was extracted from Shewanella MR-1 using a bacterial genome extraction kit. Using the extracted genome as a template, and with hemL-F and hemL-R, hemA-F and hemA-R, and gltX-F and gltX-R as primers, high-fidelity Primestar HS DNase PCR was used to amplify the gene fragments hemL, hemA, and gltX (the gene sequences are shown in SEQ ID NO:3, SEQ ID NO:1, and SEQ ID NO:4). The fragments were then recovered by agarose gel electrophoresis and a gel recovery kit.

[0050] 2. Construct recombinant plasmids containing the hemL, hemA, and gltX genes.

[0051] Using the empty pYYDT plasmid as a template, the vector fragment pYYDT was amplified by PCR using pYYDT-F and pYYDT-R primers and high-fidelity Primestar HS DNase. The plasmid backbone was recovered by agarose gel electrophoresis. The hemL, hemA, and gltX genes were ligated to the pYYDT vector fragment using a seamless cloning method. The fragment was then transformed into *E. coli* Turbo competent cells using heat shock transformation. After incubation at 37°C and 220 rpm for 1.5 h, 200 μL of bacterial suspension was evenly spread on LB agar plates containing kanaciline and incubated overnight at 37°C. Once clear single colonies appeared on the plates, they were validated and sequenced, yielding a positive plasmid named pYYDT-LAG. Figure 2 ).

[0052] 3. Construct recombinant plasmids containing the hemL, hemAsa, and gltX genes.

[0053] The glutamyl-tRNA reductase gene hemAsa from Salmonella Arizona (the gene sequence is shown in SEQ ID NO: 2) was amplified using hemAsa-F and hemAsa-R primers and high-fidelity Primestar HS DNase PCR. This gene was then ligated with the hemL and gltX genes from Shewanella obtained during the previous steps, as well as the pYYDT vector fragment, using a seamless cloning method. The resulting fragment was transformed into *E. coli* Turbo competent cells using heat shock transformation. After incubation at 37°C and 220 rpm for 1.5 h, 200 μL of the bacterial suspension was evenly spread onto LB agar plates containing kanamycin and incubated overnight at 37°C. Once clear single colonies appeared on the plates, they were validated and sequenced, yielding a positive plasmid named pYYDT-LAsaG. Figure 2 ).

[0054] II. Construction of recombinant plasmid pYYDT-LAGKS for co-expression of production and antioxidant modules

[0055] 1. Extraction of genomic DNA from *Escherichia coli* and PCR amplification of the catalase-encoding gene *katE* and the superoxide dismutase-encoding gene *sodB*.

[0056] Genomic DNA was extracted from *Escherichia coli* MG1655 using a bacterial genome extraction kit. Using the extracted genome as a template, and with katE-F and katE-R, and sodB-F and sodB-R as primers, high-fidelity Primestar HS DNase PCR was used to amplify the gene fragments katE and sodB (the gene sequences are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively). Agarose gel electrophoresis was performed, and the target fragments were recovered using a gel recovery kit.

[0057] 2. Construct recombinant plasmids containing the genes hemL, hemA, gltX, katE, and sodB.

[0058] Using pYYDT-LAG plasmid as a template, the vector fragment pYYDT-LAG was amplified by PCR using pYYDT-LAG-F and pYYDT-LAG-R primers and high-fidelity Primestar HS DNase. The plasmid backbone was recovered by agarose gel electrophoresis. The katE and sodB genes were ligated to the pYYDT-LAG vector fragment using a seamless cloning method. The fragment was then transformed into *E. coli* Turbo competent cells using heat shock transformation. After culturing at 37°C and 220 rpm for 1.5 h, 200 μL of bacterial suspension was evenly spread on LB agar plates containing kanamycin and incubated overnight at 37°C. Once clear single colonies grew on the plates, they were validated and sequenced, yielding a positive plasmid named pYYDT-LAGKS. Figure 3 ).

[0059] III. Construction of the recombinant plasmid p15a-ddcpf1-hemB2 for expression repression module

[0060] Using p15a-ddcpf1 plasmid as a template, the gene fragment p15a-ddcpf1-hemB2(N)-F and ddcpf1-hemB2(N)-R (where N represents different gRNA sequence numbers, targeting different positions of the hemB2 gene and exhibiting different degrees of inhibition) was amplified by high-fidelity Primestar HS DNase PCR. The fragment was then recovered by agarose gel electrophoresis. The fragment was ligated using a seamless cloning method. It was then transformed into *E. coli* Turbo competent cells using heat shock transformation. After culturing at 37°C and 220 rpm for 1.5 h, 200 μL of bacterial suspension was evenly spread on LB agar plates containing chloramphenicol and incubated overnight at 37°C. Once clear single colonies grew on the plates, they were validated and sequenced to obtain positive plasmids containing different target sequences, which were named p15a-ddcpf1-hemB2(N). Figure 3 ).

[0061] IV. Construction of the recombinant plasmid p15a-ddcpf1-hemB2(4)-sucA(N) for the expression repression module

[0062] The target sequence hemB2(4)-sucA(N) was designed and synthesized (the gene sequences are shown in SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, where N represents different gRNA sequence numbers, each targeting the sucA gene at a different location and with different degrees of inhibition). The corresponding target sequence fragment hemB2(4)-sucA(N) was amplified using hemB2(4)-sucA(N)-F and hemB2(4)-sucA(N)-R and high-fidelity Primestar HS DNase PCR, followed by agarose gel electrophoresis to recover the gene fragment. Subsequently, using the p15a-ddcpf1 plasmid as a template, the gene fragment p15a-ddcpf1 was amplified using primers (p15a-ddcpf1-F and p15a-ddcpf1-R) and high-fidelity Primestar HS DNase PCR, followed by agarose gel electrophoresis to recover the gene fragment. The above fragments were then ligated using a seamless cloning method. The bacteria were transformed into *E. coli* Turbo competent cells using a heat shock transformation method. After culturing at 37°C and 220 rpm for 1.5 h, 200 μL of bacterial suspension was evenly spread on LB agar plates containing chloramphenicol and incubated overnight at 37°C. Once clear single colonies grew on the plates, they were validated and sequenced to obtain positive plasmids containing different target sequences, which were named p15a-ddcpf1-hemB2(4)-sucA(N)( Figure 4 ).

[0063] Table 1: Primers used for plasmid construction

[0064] Primer Name Primer Sequence Sequence Number hemL-F atgacccgttccgaagcgctattt SEQ ID NO:10 hemL-R ttagtttgccgctttcatgcgagc SEQ ID NO:11 hemA-F atgagccttgtagcaatcggtatt SEQ ID NO:12 hemA-R ttagtttttatctaatccgagcgc SEQ ID NO:13 hemAsa-F atgaccaagaagcttttagcgctc SEQ ID NO:14 hemAsa-R ctactccagcccgaggctgtcgcg SEQ ID NO:15 gltX-F atgacaactaagacgcgttttgcc SEQ ID NO:16 gltX-R ttaggaatttattctatctgctac SEQ ID NO:17 pYYDT-F gaggccaggcatcaaataaaacgaa SEQ ID NO:18 pYYDT-R ctagtatttctcctcttttatgctatggtccttgt SEQ ID NO:19 katE-F atgtcgcaacataacgaaaagaac SEQ ID NO:20 katE-R tcaggcaggaattttgtcaatctt SEQ ID NO:21 sodB-F atgtcattcgaattacctgcacta SEQ ID NO:22 sodB-R ttatgcagcgagatttttcgctac SEQ ID NO:23 <![CDATA[ddcpf1-hemB2(1)-F]]> ccatcaccatatctgcgccctctgagccaggcatcaaataaaacgaaagg SEQ ID NO:24 <![CDATA[ddcpf1-hemB2(1)-R]]> agagggcgcagatatggtgatggatctacaagagtagaaattggggtgaaaaagca SEQ ID NO:25 <![CDATA[ddcpf1-hemB2(2)-F]]> acgacccatggtcaagacggcatgagccaggcatcaaataaaacgaaagg SEQ ID NO:26 <![CDATA[ddcpf1-hemB2(2)-R]]> atgccgtcttgaccatgggtcgtatctacaagagtagaaattggggtgaaaaagca SEQ ID NO:27 <![CDATA[ddcpf1-hemB2(3)-F]]> ggattgcagccatgtgcatggcagagccaggcatcaaataaaacgaaagg SEQ ID NO:28 <![CDATA[ddcpf1-hemB2(3)-R]]> tgccatgcacatggctgcaatccatctacaagagtagaaattggggtgaaaaagca SEQ ID NO:29 <![CDATA[ddcpf1-hemB2(4)-F]]> gcagagtaggccatgatttgagtgagccaggcatcaaataaaacgaaagg SEQ ID NO:30 <![CDATA[ddcpf1-hemB2(4)-R]]> actcaaatcatggcctactctgcatctacaagagtagaaattggggtgaaaaagca SEQ ID NO:31 p15a-ddcpf1-F ggcctttcgttttatctgttgtttgtcg SEQ ID NO:32 p15a-ddcpf1-R ggacgtatacgttctaattgagcgaagt SEQ ID NO:33 <![CDATA[hemB2(4)-sucA(N)-F]]> acttcgctcaattagaacgtatacgtcc SEQ ID NO:34 <![CDATA[hemB2(4)-sucA(N)-R]]> cgacaaacaacagataaaacgaaaggcc SEQ ID NO:35

[0065] Example 2: Construction of fermentation strains for expression production system, antioxidant system, and inhibition system.

[0066] I. Construction of strain SO-LAG

[0067] The correctly sequenced plasmid pYYDT-LAG was introduced into Shewanella to obtain the Shewanella strain SO-LAG expressing the production module. The operation steps are as follows:

[0068] (1) Preparation of electrocompetent cells: Shewanella MR-1 single clones were picked from LB plates and placed in a test tube containing 5 mL of LB liquid medium. The cells were cultured overnight at 30 °C and 220 rpm for 16–18 h. 3 mL of the above bacterial culture was placed in a 1.5 mL sterile centrifuge tube and centrifuged at 5000 rpm for 3–5 min. The supernatant was discarded under sterile conditions. 1 mL of 300 mM sterile sucrose solution was added and mixed by pipetting. The cells were centrifuged at 5000 rpm for 3–5 min. After repeating the previous step, 100 μL of 300 mM sterile sucrose solution was added to resuspend the bacterial cells to obtain electrocompetent cells.

[0069] (2) Electroporation of the target plasmid: Add 1000 ng of pYYDT-LAG plasmid to the prepared electroporation competent cells, mix well by pipetting, and then add all of it to the electroporation cuvette. The electroporation cuvette needs to be pre-cooled on ice beforehand. Wipe the walls of the electrode cuvette dry, place it in the electroporator, adjust the voltage of the electroporator to 2.47 kV, and then click the start button. After the electroporation is completed, add 1000 μL of LB liquid culture medium to the electroporation cuvette, mix by inverting, and then transfer the liquid to a sterile EP tube. Incubate in a shaker at 30℃ and 220 rpm for 1-2 h. After the culture is completed, transfer 100 μL to an LB solid medium plate containing kanamycin and spread it evenly. Incubate the plate in a 30℃ incubator overnight.

[0070] Validation of engineered strains: After the bacteria have grown, they are validated using colony PCR to obtain engineered strains with correctly introduced plasmids, which are named SO-LAG.

[0071] II. Construction of strain SO-LAsaG

[0072] The correctly sequenced plasmid pYYDT-LAsaG was introduced into Shewanella to obtain the Shewanella strain SO-LAsaG expressing the production module. The operation steps are as follows:

[0073] Using the same method as steps (1) and (2) above, the introduced plasmid was replaced with pYYDT-LAsaG. After the bacterial culture was completed, 100 μL of the culture was transferred to an LB agar plate containing kanamycin, spread evenly, and incubated overnight at 30°C. After the bacteria grew, colony PCR was used to verify the growth, thus obtaining the engineered strain with correctly introduced plasmid, which was named SO-LAsaG.

[0074] III. Construction of strain SO-LAGKS

[0075] The correctly sequenced plasmid pYYDT-LAGKS was introduced into Shewanella to obtain the engineered Shewanella strain SO-LAGKS, which expresses and produces the systemic production module and the antioxidant module. The procedure is as follows:

[0076] Using the same method as steps (1) and (2) above, the introduced plasmid was replaced with pYYDT-LAGKS. After the bacterial culture was completed, 100 μL of the culture was transferred to an LB agar plate containing kanamycin, spread evenly, and incubated overnight at 30°C. Once the bacteria had grown, colony PCR was used to verify the growth, thus obtaining the engineered strain with correctly introduced plasmid, which was named SO-LAGKS.

[0077] IV. Construction of strain M1-ddcpf1-hemB2

[0078] The correctly sequenced plasmid p15a-ddcpf1-hemB2(N) was introduced into the engineered strain SO-LAGKS to obtain the Shewanella engineered strain M1-ddcpf1-hemB2(N) that systematically expresses the production module, antioxidant module, and inhibition module. The operation procedure is as follows:

[0079] Using the same method as steps (1) and (2) above, the recipient bacteria were replaced with SO-LAGKS, and the introduced plasmid was replaced with p15a-ddcpf1-hemB2(N). After the culture was completed, 100 μL of the bacterial culture was transferred to an LB agar plate containing chloramphenicol and kanamycin, spread evenly, and incubated overnight at 30°C. After the bacteria grew, colony PCR was used to verify the growth, thus obtaining the engineered strain with correctly introduced plasmid, which was named M1-ddcpf1-hemB2(N).

[0080] V. Construction of strain M1-ddcpf1-hemB2(4)-sucA(N)

[0081] The correctly sequenced plasmid p15a-ddcpf1-hemB2(4)-sucA(N) was introduced into the engineered strain SO-LAGKS to obtain the Shewanella engineered strain M1-ddcpf1-hemB2(4)-sucA(N) that systematically expresses the production module, antioxidant module, and inhibition module. The operation procedure is as follows:

[0082] Using the same method as steps (1) and (2) above, the recipient bacteria were replaced with SO-LAGKS, and the introduced plasmid was replaced with p15a-ddcpf1-hemB2(4)-sucA(N). After the culture was completed, 100 μL of the bacterial culture was transferred to an LB solid medium plate containing chloramphenicol and kanamycin, spread evenly, and incubated overnight at 30°C. After the bacteria grew, colony PCR was used to verify the growth, thus obtaining the engineered strain with the correct plasmid introduction, which was named M1-ddcpf1-hemB2(4)-sucA(N).

[0083] Example 3: Production of 5-ALA using recombinant Shewanella engineered strains

[0084] 1. Induction of 5-ALA producing strains

[0085] Positive monoclonal bacterial cultures stored at -80℃ were streaked onto LB agar plates containing the corresponding antibiotics and incubated overnight at 30℃. Fresh monoclonal strains were picked from the antibiotic-containing plates and added to 4 mL of 2×YT liquid medium containing the corresponding antibiotics, and incubated at 30℃ (220 rpm) on a shaker for 12–16 h. Seed culture was added at an inoculum rate of 0.6% to 100 mL of fermentation liquid medium containing antibiotics, and cultured at 30℃ (220 rpm) with shaking for 2 h. Then, 0.5 mM isopropyl thiogalactoside (IPTG) was added, and fermentation was carried out at 30℃ (220 rpm). The fermentation broth was collected periodically to determine the concentration of 5-aminolevulinic acid.

[0086] 2. Determination of 5-aminolevulinic acid concentration

[0087] (1) Reagent preparation: Acetate buffer: Weigh 8.2g of anhydrous sodium acetate into 50mL of deionized water, add 5.7mL of glacial acetic acid, stir well, and then make up to 100mL with deionized water.

[0088] p-Dimethylaminobenzaldehyde (DMAB) colorimetric reagent: Weigh 1.0 g of p-dimethylaminobenzaldehyde into 20 mL of glacial acetic acid, then add 8.0 mL of 70% perchloric acid. After complete dissolution, bring the volume to 50 mL with glacial acetic acid, mix well, and store in a brown bottle at 4°C.

[0089] (2) Colorimetric reaction: After centrifuging the fermentation broth at 12000g for 5 min, the supernatant was diluted to an appropriate concentration. Then, 150 μL of the diluted sample was added to 200 μL of sodium acetate buffer, mixed thoroughly by pipetting, and 25 μL of acetylacetone solution was added. The mixture was then incubated at 100℃ for 15 min. After cooling to room temperature, 230 μL of DMAB colorimetric reagent was added, and the reaction was continued for 30 min. The absorbance of the reaction solution was measured at 554 nm using a microplate reader. The concentration of 5-ALA in the sample was calculated based on the 5-ALA standard curve. The experiment was repeated three times, and the average value was taken.

[0090] Results of 5-ALA production are as follows Figure 5 As shown. The results indicate that:

[0091] (1) Compared with the original strain, the 5-ALA production of the engineered strain SO-LAsaG (derived from the glutamate-1-half-aldehyde aminotransferase gene hemL, the glutamyl-tRNA synthetase gene gltX from Shewanella, and the glutamyl-tRNA reductase gene hemAsa from Salmonella Arizona) expressed alone did not increase significantly. When the hemAsa gene was replaced with the glutamyl-tRNA reductase gene hemA from Shewanella, the 5-ALA production was significantly increased, increasing by 66.8 times compared with the original strain.

[0092] (2) The engineered strain (SO-LAGKS) that co-expresses antioxidant system genes on the basis of the production system increased 5-ALA production by 30.4% compared with the production system (SO-LAG) that only expressed the production system.

[0093] (3) Based on the co-expression production system and the antioxidant system, the expression of the 5-ALA dehydratase gene hemB2 was inhibited to varying degrees by the CRISPRi system, which effectively increased the yield of 5-ALA. Compared with the engineered strain SO-LAGKS, the yield was increased by up to 13.2%.

[0094] (4) Based on the co-expression production system and the antioxidant system, the expression of the 5-ALA dehydratase gene hemB2 and the α-ketoglutarate dehydrogenase gene sucA were simultaneously inhibited to different degrees using the CRISPRi system, which effectively increased the yield of 5-ALA by 99.0% and 52.6% compared with the single expression production system and the co-expression production and antioxidant system, respectively. Compared with the original strain, the yield of 5-ALA increased by 134.0 times.

[0095] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A strain producing 5-amino levulinic acid, characterized in that, The low expression of 5-ALA dehydratase gene and alpha-ketoglutarate dehydrogenase gene, overexpression of synergistic production module related genes and antioxidant module related genes; The synergistic production module related genes include: glutamyl-tRNA synthetase encoding gene, glutamyl-tRNA reductase encoding gene and glutamic aldehyde amino transferase encoding gene; The antioxidant module related genes include: catalase encoding gene and superoxide dismutase encoding gene; The low expression of 5-ALA dehydratase gene and alpha-ketoglutarate dehydrogenase gene is achieved by gRNA knockout using the nucleotide sequence as shown in SEQ ID NO: 9; The nucleotide sequence of the glutamyl-tRNA synthetase encoding gene is as shown in SEQ ID NO: 4; The nucleotide sequence of the glutamyl-tRNA reductase encoding gene is as shown in SEQ ID NO: 1; The nucleotide sequence of the glutamic aldehyde amino transferase GSAM encoding gene is as shown in SEQ ID NO: 3; The nucleotide sequence of the catalase encoding gene is as shown in SEQ ID NO: 5; The nucleotide sequence of the superoxide dismutase encoding gene is as shown in SEQ ID NO: 6; The chassis strain of the strain is Shewanella MR-1.

2. A process for the preparation of 2.5-amino levulinic acid, characterized in that, Fermenting the strain as claimed in claim 1 to obtain a culture containing 5-aminoacetyl propionic acid.

3. The preparation method according to claim 2, characterized in that, The fermentation conditions include: inoculating seed liquid into fermentation liquid medium containing kanamycin and chloramphenicol at an inoculation amount of 0.6 vol%, culturing for 2h, and then adding 0.5 mM isopropyl thiogalactoside for induction.

Images