Bacillus coagulans strain and application thereof

Abstract

The invention discloses a bacillus coagulans strain. The microbial preservation number of the bacillus coagulans strain is CCTCC (China Center for Type Culture Collection) NO: M 20252261. The strain can treat or slow down intestinal oxidative damage, intestinal inflammation damage, intestinal morphological damage, intestinal barrier function damage and intestinal flora disorder caused by lipopolysaccharide, and can promote the growth of subjects. The strain is a probiotic with a clinical application prospect.

Description

Technical Field

[0001] This invention belongs to the field of microbiology and relates to a strain of Bacillus coagulans and its application. Background Technology

[0002] The gut plays a vital role in the digestion and absorption of nutrients, immune regulation, and maintenance of homeostasis. The integrity of the intestinal barrier is crucial for protecting the body from harmful substances. The mechanical barrier, primarily composed of the intestinal epithelial cell layer and tight junctions, plays an indispensable role in resisting pathogen infection.

[0003] Antibiotics have been used to prevent or control clinical and subclinical diseases such as necrotizing enteritis caused by pathogens, but the extensive use of antibiotics has promoted the development and spread of drug-resistant bacteria. In livestock production, the use of antibiotics has had significant consequences, including increased productivity, lower morbidity of intestinal infectious diseases, and increased mortality. In recent years, research on probiotics has deepened, and they have been applied as adjunctive treatments for various intestinal diseases. Numerous clinical trials have demonstrated that various probiotics, including Lactobacillus and Bacillus subtilis, can shape the gut microbiota, regulate gut microbial homeostasis, thereby controlling various intestinal diseases and promoting overall health.

[0004] Bacillus coagulans, a facultative anaerobic, non-pathogenic Gram-positive bacterium, is widely distributed in the animal intestines. It belongs to the phylum Firmicutes, class Bacillus, order Bacillusales, family Bacillusaceae, and genus Bacillus. Bacillus coagulans is capable of producing L-lactic acid and spores. Compared to other probiotics such as Bacillus subtilis and Lactobacillus, it exhibits resistance to high temperatures, strong acids, and bile salts, enabling it to survive effectively in the animal gastrointestinal tract and demonstrate its beneficial effects.

[0005] There are few reports on the application of Bacillus coagulans in the treatment of intestinal oxidative damage, intestinal inflammatory damage, intestinal morphological damage, intestinal barrier dysfunction, and intestinal flora imbalance caused by lipopolysaccharide. Summary of the Invention

[0006] In response to the serious harm caused by intestinal diseases in animal husbandry, this invention isolates a strain of Bacillus coagulans from the intestines of cattle that can improve intestinal flora and intestinal barrier function.

[0007] This invention involves collecting fecal samples from dairy cows at a dairy farm in Harbin, Heilongjiang Province, and isolating Bacillus coagulans using MRS agar and broth media. After selective culture and 16S rRNA sequencing, the isolated Bacillus coagulans underwent in vitro antibacterial experiments, safety tests, and acid and bile salt tolerance tests, resulting in a strain of Bacillus coagulans A with good efficacy. This Bacillus coagulans can promote intestinal microbial diversity in mice, improve intestinal barrier function, and alleviate inflammation and oxidative damage, thus serving as an antibiotic-free treatment option for intestinal diseases in livestock and poultry.

[0008] More specifically, the first aspect of the present invention provides a Bacillus coagulans strain, wherein the Bacillus coagulans strain is selected from S1, S2, and S3:

[0009] S1: Bacillus coagulans strain with microbial accession number CCTCC NO: M 20252261;

[0010] S2: A passaged strain of Bacillus coagulans with the microbial accession number CCTCC NO: M 20252261;

[0011] During the passage of the *Bacillus coagulans* strain with accession number CCTCC NO: M 20252261, the transcriptional regulatory activity of all genes in the genome, the transcription initiation and termination of all genes in the genome, the amino acid sequences of proteins encoded by all genes in the genome, the clinical pathogenicity or probiotic properties of the strain, the immunogenicity of the strain, and the reproductive capacity of the strain remained unchanged compared to the *Bacillus coagulans* strain with accession number CCTCC NO: M 20252261.

[0012] S3: A Bacillus coagulans strain with the same genome sequence as the Bacillus coagulans strain described in S1 or S2.

[0013] The second aspect of the present invention provides a method for culturing a strain of Bacillus coagulans, wherein the method comprises culturing the strain of Bacillus coagulans described in the first aspect of the present invention in a culture medium to obtain a proliferated strain of Bacillus coagulans.

[0014] A third aspect of the present invention provides a probiotic composition, wherein the active ingredient in the probiotic composition is selected from the following A1, A2, A3, A4 and A5;

[0015] A1: The Bacillus coagulans strain described in the first aspect of the present invention;

[0016] A2: A pure culture of the Bacillus coagulans strain described in the first aspect of the present invention;

[0017] A3: A clone of the Bacillus coagulans strain described in the first aspect of the present invention;

[0018] A4: Metabolites or secretions of the Bacillus coagulans strain described in the first aspect of this invention;

[0019] A5: An inactivated strain of Bacillus coagulans as described in the first aspect of this invention.

[0020] In some embodiments, the probiotic composition may also contain therapeutically active substances, immunologically active substances, inert substances, excipients, or unavoidable impurities.

[0021] The fourth aspect of the present invention provides the use of the Bacillus coagulans strain described in the first aspect of the present invention in the preparation of formulations for use alone or in combination with other active substances to improve the health status of subjects;

[0022] The improvement in the health status of the subjects includes the following H1, H2, H3, H4, H5, and H6:

[0023] H1: Treatment, prevention, or mitigation of intestinal inflammatory damage caused by lipopolysaccharide or bacteria containing lipopolysaccharide;

[0024] H2: Treatment, prevention, or mitigation of intestinal morphological damage caused by lipopolysaccharide or bacteria containing lipopolysaccharide;

[0025] H3: Treats, prevents, or slows down the disruption of the intestinal barrier function caused by lipopolysaccharides or bacteria containing lipopolysaccharides;

[0026] H4: Treatment, prevention or mitigation of intestinal flora imbalance caused by lipopolysaccharides or bacteria containing lipopolysaccharides;

[0027] H5: Promotes the growth of test subjects;

[0028] H6: Reduces the expression levels of TNF-α and / or IL-6 in the serum of the subjects.

[0029] In some implementations, the following options are selected: B1, B2, B3, and B4.

[0030] B1: In H1, the intestinal inflammatory damage includes infiltration of inflammatory cells in the subject's intestine;

[0031] B2: In H2, the intestinal morphological damage includes villus atrophy, villus morphological damage, intestinal barrier impairment, shallowing of intestinal crypts, and reduction in the number of villus.

[0032] B3: In H3, intestinal barrier dysfunction includes decreased expression of the Claudin-1 gene and decreased expression of the Occludin gene in the gut;

[0033] B4: In H5, increase the feed conversion rate of subjects; increase the average daily weight gain of subjects.

[0034] In some embodiments, the subjects are selected from mice, rats, pigs, dogs, and humans.

[0035] In some embodiments, the intestine is selected from the jejunum and colon.

[0036] Compared with the prior art, the present invention has the following advantages:

[0037] The *Bacillus coagulans* ZNB-01 strain described in this invention was isolated from dairy cows. The isolated strain underwent in vitro experiments, including tests for antibiotic sensitivity, resistance, and acid and bile salt tolerance, demonstrating its strong gastrointestinal adaptability. Furthermore, in a LPS-induced intestinal injury model, supplementation with *Bacillus coagulans* A significantly restored intestinal barrier function, inhibited inflammatory responses, and improved intestinal microbial diversity and metabolism. These improvements were primarily manifested in increased intestinal villus morphology, intestinal barrier indicators, inflammatory factor expression, microbial diversity and abundance, and the abundance of beneficial bacteria. In addition, the abundance of beneficial metabolites, including short-chain fatty acids and amino acids, also significantly increased. This indicates that this strain can be used to enhance intestinal barrier function and improve intestinal health. Attached Figure Description

[0038] Figure 1 This is a photograph of the colony morphology of thermostable bacteria on NB medium.

[0039] Figure 2 The results are Gram staining results for Bacillus coagulans ZNB-01.

[0040] Figure 3 The effect of Bacillus coagulans ZNB-01 on the growth performance of mice in vitro.

[0041] Figure 4 The effect of Bacillus coagulans ZNB-01 on serum inflammatory markers in mice with acute intestinal injury.

[0042] Figure 5 To investigate the effects of Bacillus coagulans ZNB-01 on intestinal microbial diversity in mice with acute intestinal injury.

[0043] Figure 6 KEGG enrichment analysis of Bacillus coagulans ZNB-01 in the differential intestinal microbial community of mice with acute intestinal injury.

[0044] Figure 7 To investigate the effect of Bacillus coagulans A on intestinal barrier function in mice with acute intestinal injury.

[0045] Figure 8 The effects of Bacillus coagulans A on the histopathology of acute intestinal injury in mice. Detailed Implementation

[0046] To make the objectives, technical solutions, and advantages of the present invention clearer, the embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.

[0047] Materials and instruments not described in this invention are conventional materials and instruments in the art. Operational details not described in this invention are conventional operations in the art. Software used in this invention is operated according to the software provider's instructions using conventional methods. Reagents and consumables used in this invention, unless otherwise specified, are all from legitimate commercial sources.

[0048] "During the passage of the *Bacillus coagulans* strain with accession number CCTCC NO: M 20252261, the transcriptional regulatory activity of all genes in the genome, the transcription initiation and termination of all genes in the genome, the amino acid sequences of proteins encoded by all genes in the genome, the clinical pathogenicity or probiotic properties of the strain, the immunogenicity of the strain, and the reproductive capacity of the strain remained unchanged compared to the *Bacillus coagulans* strain with accession number CCTCC NO: M 20252261," including but not limited to the following:

[0049] The statement that "the bacterial reproductive capacity of strain ZBN-01 did not change during passage" primarily refers to the absence of any mutations in the genome sequence, maintaining the original reproductive capacity (no mutation-induced death, etc.), or minor changes in reproductive capacity within the error range of conventional detection techniques or changes undetectable by conventional techniques. According to common knowledge in the field, even two progeny bacterial samples isolated from a single colony of strain ZBN-01 will have systematic errors in their reproductive capacity measurements (different batches or different operators' measurements will also show some differences). Clearly, minor gene mutations inevitably occur during bacterial passage. Synonymous mutations in the coding sequence or minor mutations in non-coding regions of the genome that do not participate in bacterial genetic regulation do not affect bacterial reproductive capacity or biological activity (pathogenicity or probiotic properties). Therefore, this passaged strain falls within the substantive technical contribution scope of the preserved bacterial strain (strain ZBN-01), and is an unavoidable and reasonable variation within the direct technical contribution scope of this invention. This scope ensures that the content protected by the patent, the content actually used, and the content defined by the claims are as closely as possible to avoid significant separation. Similarly, no change in bacterial clinical pathogenicity, probiotic properties, and bacterial immunogenicity also means that the difference does not exceed the systematic error of the detection method, is not statistically significant, or the difference is slightly higher than, approximately equal to, or less than the standard deviation of the measurement method.

[0050] The statement that "the transcriptional regulatory activity of all genes in strain ZBN-01 remained unchanged during passaging" primarily refers to the fact that the expression regulation patterns of all transcriptional regulatory elements under the influence of bacterial endogenous or host-derived genes remained unchanged, the response patterns to external signals remained undetectable, and the host signal transduction pathways and metabolic regulatory patterns involved by the bacteria remained undetectable. Minor mutations that do not participate in regulation (e.g., minor changes in non-coding sequence bases that do not affect the expression regulation patterns of the corresponding genes) fall within the scope of unchanged transcriptional regulatory activity.

[0051] The statement that "the transcription initiation and termination of all genes did not change during the passage of ZBN-01 strain bacteria" mainly refers to the fact that the pattern of gene expression regulation did not change, and there were no detectable significant changes in gene transcription regulation.

[0052] The statement that "the amino acid sequence of all proteins of the ZBN-01 strain did not change during the passage of bacteria" mainly means that the amino acid sequence of all proteins of this strain did not change during the passage of bacteria. Synonymous mutations of genes do not affect gene function. Mutations during bacterial passage are inevitable. Therefore, progeny bacteria whose amino acid sequence of all proteins did not change are still within the scope of the technical contribution of the preserved strain.

[0053] "Bacillus coagulans strain with the same genome as the Bacillus coagulans strain described in S1 or S2" mainly refers to Bacillus coagulans strains that are not derived from the Bacillus coagulans strain with the microbial accession number CCTCC NO: M 20252261 or its passaged strains, but are independently discovered and isolated by anyone after the date of this patent application. Obviously, anyone who obtains such a strain by chance after the date of this patent application should also be considered to fall within the protection scope of this invention.

[0054] Example 1: Isolation, identification, screening and preservation of Bacillus coagulans strain ZNB-01

[0055] I. Isolation of Bacillus coagulans

[0056] Intestinal contents and fecal samples were collected from cattle at a cattle farm in Harbin, Heilongjiang Province, for the isolation of heat-resistant probiotics. The specific procedure involved placing the intestinal contents and feces in sterile PBS solution at 4°C (1g sample: 10ml PBS), vortexing to mix, and then heating in an 85°C water bath for 20 minutes to kill heat-sensitive bacteria. Then, 100μL of the mixture was evenly spread onto MRS agar plates. The plates containing the mixture were placed in a constant temperature incubator and incubated at 37°C for 24 hours. Single colonies were picked for purification culture; colony morphology on the culture medium is shown in [reference needed]. Figure 1 The resulting strain was named strain a and stored frozen.

[0057] The isolated strain a was subjected to conventional Gram staining and microscopic examination. The results are shown in Figure 2 , from Figure 2 it can be seen that strain a is a Gram-positive bacterium.

[0058] II. Classification and identification of strain a

[0059] In order to clarify the genus and species of this strain a, the genomic DNA of strain a was extracted using a bacterial genomic DNA extraction kit, and the quality of the extracted DNA was determined using an ND-1000 micro ultraviolet spectrophotometer. The genomic DNA was subjected to PCR amplification using 16S rDNA universal primers, and then the amplified product was sequenced by the Sanger method to obtain the gene sequence of 16S rDNA. Blast alignment in the NCBI database showed that the 16S rDNA sequence of strain a had a homology of up to 99.3% with Bacillus coagulans strain T5 (GenBank accession number AB240205.1). Thus, it can be seen that strain a belongs to Bacillus coagulans among Bacillus. Therefore, strain a was named Bacillus coagulans ZBN-01 strain, abbreviated as ZBN-01 strain.

[0060] III. Preservation of microbial materials

[0061] The isolated Bacillus coagulans ZBN-01 strain was submitted to a preservation institution recognized by the patent procedure for preservation. The preservation unit is the China Center for Type Culture Collection; the address is Wuhan University, Wuhan, China; the microbial preservation number is CCTCC NO: M20252261; the name of the culture is Bacillus coagulans ZBN-01; the Chinese taxonomic name is: Bacillus coagulans; the English taxonomic name is: Bacillus coagulans; the preservation date is October 20, 2025.

[0062] Example 2. Testing of acid and bile salt tolerance and antibiotic sensitivity of ZBN-01 strain

[0063] I. Determination of gastric acid tolerance

[0064] Weigh 300 mg of pepsin, dissolve it in 100 mL of 0.9% sterile physiological saline, add 1M HCL to adjust the pH to 3.0, and then filter and sterilize the solution through a 0.22 μm filter membrane to obtain simulated gastric juice. Dissolve 0.2 g of trypsin and 0.3 g of bile salt in 100 mL of 0.9% sterile physiological saline, adjust the pH to 8.0 with 1M NaOH, and filter and sterilize it with a 0.22 μm sterile filter membrane to obtain simulated intestinal juice.

[0065] After activation, ZNB-01 strain was inoculated at a rate of 2% into 10 mL of MRS broth and cultured for 12 h. The culture was then centrifuged at 8000×g for 10 min at 25°C, the supernatant was discarded, and the precipitated bacterial cells were resuspended in an equal volume of sterile physiological saline and washed twice with the same centrifugation parameters. The resulting precipitated bacterial cells were then resuspended in 10 mL of simulated gastric fluid (0 h). The mixture was then incubated in a 37°C shaking water bath for 2 h to simulate peristalsis (2 h). The cells were then collected by centrifugation for 10 min with the same parameters and resuspended in an equal volume of simulated intestinal fluid, and cultured under the same conditions for 4 h. The viable cell count at 2 h and 4 h was determined using the plate count method on MRS solid medium to calculate the survival rate. All experiments were repeated three times, and the average of the three results was calculated using the following formula:

[0066] Survival rate (%) = logN1 / logN0 × 100

[0067] In the formula: N0 represents the number of viable bacteria at 0h (CFU / mL), and N1 represents the number of viable bacteria in simulated gastrointestinal fluid during the test (CFU / mL).

[0068] The results showed that in a simulated intestinal fluid environment, the survival rate of ZNB-01 was 81.11% after 2 hours and 38.25% after 4 hours.

[0069] The simulated gastric fluid was adjusted to pH=2, and the other steps were the same as those for the simulated gastric fluid. After placing Bacillus coagulans ZNB-01 in the simulated gastric fluid at pH=2 for 3 hours (without adding simulated intestinal fluid), the survival rate was determined using the same method, and the survival rate was 32.81%.

[0070] The procedure was the same as the simulated gastric fluid described above. After placing *Bacillus coagulans* ZNB-01 in simulated gastric fluid at pH 3 for 3 hours (without adding simulated intestinal fluid), its viability was determined using the same method to be 63.65%. These results indicate that *Bacillus coagulans* ZNB-01 possesses excellent acid and bile salt resistance.

[0071] II. Drug sensitivity testing

[0072] The overnight cultured ZNB-01 bacterial suspension was diluted to 10 with sterile physiological saline. 8CFU / mL, 100 μL was spread onto MRS medium and air-dried. Then, 10 antibiotic susceptibility test discs (containing penicillin, ampicillin, ceftriaxone, gentamicin, tetracycline, chloramphenicol, ciprofloxacin, erythromycin, trimethoprim-sulfamethoxazole, and lincomycin, respectively) were evenly placed on the dried MRS medium surface using sterile forceps. After 5 min, the medium was inverted and incubated at 37°C for 48 h. The diameter of the inhibition zone (mm) was measured. Results: The diameter of the inhibition zone corresponding to the 10 antibiotics ranged from 2.29 to 3.30 mm, indicating that strain ZNB-01 was sensitive to penicillin, ampicillin, ceftriaxone, gentamicin, tetracycline, chloramphenicol, ciprofloxacin, erythromycin, trimethoprim-sulfamethoxazole, and lincomycin.

[0073] Example 3. Effects of Bacillus coagulans ZNB-01 on growth performance in mice

[0074] This invention selected 20 three-week-old male C57BL / 6 mice. The mice were housed under SPF conditions (25±2℃, 50±5% relative humidity, 12-hour light cycle). After 7 days of acclimatization, they were randomly divided into two groups (n=10): a control group and a BSC group. The control group received 100 μl of sterile saline via gavage daily, while the BSC group received 100 μl of ZNB-01 bacterial suspension (1x10⁻⁶ viable bacteria count) via gavage daily. 8 (CFU / mL). Gavage was administered once daily for 14 consecutive days, with each animal individually given 100g of feed daily. Feed consumption was recorded, and body weight was measured every three days to calculate average daily weight gain.

[0075] The results showed that after 14 days of gavage administration of ZNB-01, the body weight of mice in the ZNB-01 group was significantly higher than that of mice in the control group. The average daily weight gain also showed that the average daily weight gain of mice in the ZNB-01 group was significantly higher than that of the control group, but there was no significant difference in feed consumption. However, the feed conversion ratio of mice in the ZNB-01 group was significantly higher than that of the control group. This indicates that Bacillus coagulans ZNB-01 has growth-promoting properties in mice and improves feed conversion ratio. Figure 3 ). Figure 3 In the middle, the left chart represents daily weight data, and the right chart represents average daily weight gain.

[0076] Example 4. Effects of Bacillus coagulans ZNB-01 on intestinal flora, metabolism, and intestinal barrier function in mice.

[0077] Forty 8-week-old male C57BL / 6 mice were used in this experiment. The mice were housed under SPF conditions at a temperature of 25±2℃, relative humidity of 50±5%, and a 12-hour light cycle. After 7 days of acclimatization, they were randomly divided into four groups (n=10): a control group, a ZNB-01 group, an LPS group, and an LPS+ZNB-01 group.

[0078] Mice in the control and LPS groups were administered 200 μL of sterile saline by gavage once daily; mice in the ZNB-01 group and the LPS+ZNB-01 group were administered 200 μL of ZNB-01 bacterial suspension (ZNB-01 concentration was 1 x 10⁻⁶) by gavage once daily. 8 (CFU / mL), administered by gavage for 14 consecutive days.

[0079] Fourteen days after gavage, each mouse in the control group and ZNB-01 group was injected intraperitoneally with 200 μL of sterile saline. The LPS group and LPS+ZNB-01 group were injected intraperitoneally with LPS (lipopolysaccharide, purchased from Sigma, source: Escherichia coli O111:B4) solution at a dose of 5 mg / kg body weight. The mice were sacrificed 8 hours later, and their intestinal tissue, feces and blood were collected for subsequent testing.

[0080] I. Serum inflammatory factor detection

[0081] The collected blood was placed in an ice box at 4°C for 1 hour, and then centrifuged at 4500 rpm for 10 min in a high-speed low-temperature centrifuge for serum separation. Serum IL-6 and TNF-α levels were detected using an enzyme-linked biopsy kit for mice. Results showed that after gavage administration of Bacillus coagulans ZNB-01, compared with the LPS group, the expression of serum inflammatory markers TNF-α and IL-6 was significantly reduced, inhibiting the LPS-induced inflammatory response. Figure 4 ).

[0082] II. Effects of ZNB-01 treatment on the gut microbiota of mice

[0083] Genomic DNA was extracted from the cecal contents of mice in the control, ZLPS, and LPS+ZNB-01 groups using Omega's Mag-bind Soil DNA Kit. DNA purity and concentration were then assessed by 1% agarose gel electrophoresis. PCR amplification of the V3-V4 region of the 16S rDNA TLR gene was performed using barcode-specific primers. The purified PCR products were then analyzed using TruSeq. ®Library construction was performed using the DNA PCR-Free Sample Preparation Kit. After passing Qubit quantification and library detection, the constructed libraries were sequenced using an Illumina NovaSeq 6000 sequencer with PE250 reads. Data from each sample were differentiated based on barcode sequences. The extracted data were saved in FASTQ format and paired-end sequences were assembled using FLASH software (http: / / ccb.jhu.edu / software / FLASH / ). Operational taxonomic units (OTUs) were clustered from the quality-controlled assembled sequences at a 97% similarity threshold using UPARSE v7.1 software, and chimeras were removed. The community composition of each sample was then determined at different taxonomic levels. Based on sequencing reads and OTU levels, we analyzed the microbial diversity in mouse feces.

[0084] The results showed that the Chao1 and Simpson indices of gut microbiota α-diversity in mice supplemented with Bacillus coagulans ZNB-01 were significantly increased compared to the LPS group. PCoA analysis also revealed significant differences in bacterial expression patterns after ZNB-01 supplementation. At the phylum level, ZNB-01 decreased the abundance of p_Proteobacteria, p_Desulfobacterota, and p_Campilobacterota, while increasing the relative abundance of p_Firmicutes and p_Bacteroidota. At the genus level, ZNB-01 increased the abundance of beneficial bacteria such as g_Lactobacillus, g_Dubosiella, g_Allobaculum, and g_Ileibacterium, which is beneficial for protecting gut health. Figure 5 KEGG enrichment results showed that after gavage administration of Bacillus coagulans ZNB-01, significant changes were observed in pathways such as alanine, aspartate, and glutamate metabolism; glycolysis / gluconeogenesis; the citric acid cycle (TCA cycle); arginine biosynthesis; and phenylalanine, tyrosine, and tryptophan biosynthesis. This suggests that ZNB-01 may alleviate LPS-induced intestinal barrier damage by regulating amino acid and cellular energy supply. Figure 6 ).

[0085] III. Intestinal Barrier Indicator Detection

[0086] Mouse jejunum and colon tissues were weighed and placed in an ice box at 4°C. RNA and protein were extracted from the tissues according to the kit instructions from Acrel Biotech Ltd., and intestinal barrier markers ZO-1 and Occludin were detected by qPCR and Western blotting.

[0087] qPCR detection: Total RNA was extracted from the jejunum and colon tissues of mice in each group using the SteadyPure Quick RNA Extraction Kit AG21023 (purchased from ACCURATE BIOTECHNOLOGY (HUNAN) CO.,LTD). cDNA was obtained using a reverse transcription kit (purchased from ACCURATE BIOTECHNOLOGY (HUNAN) CO.,LTD). Using β-actin as an internal control, real-time quantitative PCR was performed on both genes. SYBR Green PCR premix was run in the Light Cycler 480 (Roche, Germany), and Ct values ​​were recorded to calculate relative expression levels. Forward and reverse primers are shown below, where F represents the forward primer and R represents the reverse primer. The names following F- and R- represent the gene names.

[0088] F-ZO-1 (SEQ ID NO.1):CGTAGTTCTGGCATTATTCGT

[0089] R-ZO-1 (SEQ ID NO.2): TGGGCACAGCCTCATTCT

[0090] F-Occludin (SEQ ID NO.3):TCCACCTCCTTACAGACCTGA

[0091] R-Occludin (SEQ ID NO.4): AAGAGTACGCTGGCTGAGAG

[0092] F-β-actin (SEQ ID NO.5): GATATCGCTGCGCTGGTCG

[0093] R-β-actin (SEQ ID NO.6): CATTCCCACCATCACACCCT

[0094] Western blot analysis: Total protein was extracted from jejunal and colonic tissues using RIPA lysis buffer (purchased from Meilun Biotechnology Co., Ltd.) and protease inhibitors. Protein content was analyzed using SDS-PAGE and NC membrane blotting, followed by blocking and sequential incubation with primary and secondary antibodies. Protein bands were visualized using ultrasensitive ECL reagents, images were captured using a gel imaging system, and quantification was performed using ImageJ software.

[0095] Specifically, for ZO-1, the primary antibody was a rabbit polyclonal antibody (purchased from Wuhan Sanying Biotechnology Co., Ltd., diluted 1:10000); for Occludin, the primary antibody was a rabbit polyclonal antibody (purchased from Wuhan Sanying Biotechnology Co., Ltd., diluted 1:5000); and for GADPH, the primary antibody was a rabbit polyclonal antibody (purchased from Wuhan Sanying Biotechnology Co., Ltd., diluted 1:5000). The secondary antibodies were all HPR-labeled goat-derived anti-rabbit IgG (purchased from Wuhan Sanying Biotechnology Co., Ltd.).

[0096] Furthermore, the expression levels of intestinal barrier function-related indicators ZO-1 and Occludin were significantly downregulated at both the transcriptional and protein levels, and their expression levels were significantly improved after gavage administration of Bacillus coagulans ZNB-01. Figure 7 ).

[0097] HE detection: Jejunal and colon samples were fixed in 4% paraformaldehyde solution for 24 hours, then embedded in paraffin, and the samples were cut into 4 μm thin sections for H&E staining at a magnification of 200x.

[0098] Immunofluorescence assay: Antigen retrieval was performed by adding antigen retrieval solution to paraffin sections containing jejunum samples. After blocking, the sections were incubated overnight with primary antibody against Occludin (rabbit polyclonal antibody, purchased from Wuhan Sanying Biotechnology Co., Ltd.) and secondary antibody against Cy3-labeled mouse anti-rabbit IgG (purchased from Wuhan Sanying Biotechnology Co., Ltd.). The samples were then treated with DAPI staining reagent. Immunofluorescence images of each sample were observed under a confocal hyperspectral microscope.

[0099] Transmission electron microscopy (TEM) examination: Fresh colon samples were cut into small pieces (1×1 mm) and fixed overnight at 4°C with 2.5% glutaraldehyde aqueous solution. Protected from light, the samples were washed with phosphate buffer and fixed with 1% osmium tetroxide aqueous solution for 2 hours. The samples were then washed with phosphate buffer to dehydrate them for ultrastructural observation. The samples were placed in Eppendorf tubes containing Spurr resin and heated at 70°C for 9 hours. Subsequently, the specimens were sectioned using a LEICA EM UC7 microtome (LEICA Microsystems, Wetzlar, Germany). The resulting sections were stained with uranyl acetate and basic lead citrate, respectively. The stained sections were analyzed using a Hitachi H-7650 transmission electron microscope (TEM).

[0100] Results showed that intraperitoneal injection of LPS significantly disrupted the normal morphology of the intestine in the jejunum and colon, resulting in extensive inflammatory cell infiltration, villus morphology damage, and shallowing of crypts. Oral administration of Bacillus coagulans ZNB-01 significantly reversed these histological damages. Immunofluorescence of the jejunum showed that LPS reduced ocludin expression, while oral administration of ZNB-01 alleviated LPS-induced jejunal damage by increasing ocludin expression. HE analysis of the colon indicated that LPS caused villus atrophy, intestinal barrier damage, and inflammatory cell infiltration in mouse colon tissue. ZNB-01 treatment improved LPS-induced villus damage and inflammatory cell infiltration. TEM results showed that compared to the control group, LPS intervention significantly reduced the number and length of villus, while oral administration of ZNB-01 significantly improved villus morphology and number. Figure 8 ).

[0101] exist Figure 8 In the image, the first row is a HE section of the jejunum; the second row is an Occludin immunofluorescence of the jejunal tissue; the third row is a HE section of the colon; and the fourth row is a TEM (transmission electron microscopy) image of the colon (2μm in the image represents the TEM level).

[0102] The above results indicate that ZNB-01 can alleviate intestinal damage caused by LPS by reducing the body's inflammation level, enhancing intestinal barrier function, regulating intestinal flora balance.

[0103] As is known from common technical knowledge, this invention can be implemented through other embodiments that do not depart from its spirit or essential characteristics. Therefore, the disclosed embodiments described above are merely illustrative in all respects and are not the only ones. All modifications within the scope of this invention or its equivalents are included in this invention.

Claims

1. A strain of Bacillus coagulans, wherein the Bacillus coagulans strain is selected from S1, S2, and S3: S1: Bacillus coagulans strain with microbial accession number CCTCC NO: M 20252261; S2: A passaged strain of Bacillus coagulans with the microbial accession number CCTCC NO: M 20252261; During the passage of the *Bacillus coagulans* strain with accession number CCTCC NO: M 20252261, the transcriptional regulatory activity of all genes in the genome, the transcription initiation and termination of all genes in the genome, the amino acid sequences of proteins encoded by all genes in the genome, the clinical pathogenicity or probiotic properties of the strain, the immunogenicity of the strain, and the reproductive capacity of the strain remained unchanged compared to the *Bacillus coagulans* strain with accession number CCTCC NO: M 20252261. S3: A Bacillus coagulans strain with the same genome sequence as the Bacillus coagulans strain described in S1 or S2.

2. A method for culturing a Bacillus coagulans strain, wherein the method comprises culturing the Bacillus coagulans strain of claim 1 in a culture medium to obtain a proliferated Bacillus coagulans strain.

3. A probiotic composition, wherein the active ingredient in the probiotic composition is selected from the following A1, A2, A3, A4 and A5; A1: The Bacillus coagulans strain according to claim 1; A2: A pure culture of the Bacillus coagulans strain according to claim 1; A3: A clone of the Bacillus coagulans strain according to claim 1; A4: Metabolites or secretions of the Bacillus coagulans strain according to claim 1; A5: An inactivator of the Bacillus coagulans strain as described in claim 1.

4. The probiotic composition according to claim 3, characterized in that, The probiotic composition also contains therapeutically active substances, immunologically active substances, inert substances, excipients, or unavoidable impurities.

5. The use of the Bacillus coagulans strain of claim 1 in the preparation of formulations for use alone or in combination with other active substances to improve the health of subjects; The improvement in the health status of the subjects includes the following H1, H2, H3, H4, H5, and H6: H1: Treatment, prevention, or mitigation of intestinal inflammatory damage caused by lipopolysaccharide or bacteria containing lipopolysaccharide; H2: Treatment, prevention, or mitigation of intestinal morphological damage caused by lipopolysaccharide or bacteria containing lipopolysaccharide; H3: Treats, prevents, or slows down the disruption of the intestinal barrier function caused by lipopolysaccharides or bacteria containing lipopolysaccharides; H4: Treatment, prevention or mitigation of intestinal flora imbalance caused by lipopolysaccharides or bacteria containing lipopolysaccharides; H5: Promotes the growth of test subjects; H6: Reduces the expression levels of TNF-α and / or IL-6 in the serum of the subjects.

6. The application as described in claim 5, characterized in that, Choose from any one of B1, B2, B3 and B4 below; B1: In H1, the intestinal inflammatory damage includes infiltration of inflammatory cells in the subject's intestine; B2: In H2, the intestinal morphological damage includes villus atrophy, villus morphological damage, intestinal barrier impairment, shallowing of intestinal crypts, and reduction in the number of villus. B3: In H3, intestinal barrier dysfunction includes decreased expression of the Claudin-1 gene and decreased expression of the Occludin gene in the gut; B4: In H5, increase the feed conversion rate of subjects; increase the average daily weight gain of subjects.

7. The application as described in any one of claims 5-6, characterized in that, The subjects were selected from mice, rats, pigs, dogs, and humans.

8. The application as described in any one of claims 5-6, characterized in that, The intestine is selected from the jejunum and colon.

Images