Ratio-type pH sensor of double-CRISPR system based on tetrahedral framework nucleic acid as well as preparation method and application of ratio-type pH sensor

Abstract

The invention discloses a targeted gating ratio type pH sensor of a double-CRISPR system based on tetrahedral framework nucleic acid, and belongs to the technical field of biomedicine and nucleic acid nanotechnology. According to the sensor, tetrahedral framework nucleic acid is used as a rigid support, Cas12a, Cas13a and corresponding fluorescent reporter molecules are accurately assembled according to the stoichiometric ratio of 1: 1, and orthogonal pH responses of the Cas12a and the Cas13a form a ratio type sensing basis; target recognition-pH sensing logic gating is realized through target specific crRNA (Complementary Ribonucleic Acid) design; after being modified by cholesterol, the compound can be stably anchored on the surface of a lipid membrane. The invention also discloses a preparation method of the sensor, a membrane anchoring method, a pH monitoring method and a target gating function realization method. The sensor has the advantages of high-precision ratio measurement, accurate spatial arrangement, high specificity, stable membrane anchoring, wide pH response range and the like, and can be used for accurately monitoring pH dynamics in a biological membrane interface microenvironment and extracellular vesicle fusion process.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomedical and nucleic acid nanotechnology, and particularly relates to a ratio type fluorescence sensor for precise measurement of biological membrane interface microenvironment pH constructed by DNA nanotechnology combined with CRISPR / Cas system as well as a preparation method and application thereof. BACKGROUND

[0002] Extracellular vesicle (EV)-mediated intercellular communication is strictly regulated by local pH, which affects vesicle biogenesis, cargo release and membrane fusion. Acidic microenvironments (such as tumor microenvironments) usually promote EV fusion and delivery of pro-cancer cargos. Therefore, precise monitoring of vesicle pH dynamics is crucial for understanding disease pathophysiology. Among the fluorescent pH probes under physiological conditions, small molecule indicators and genetically encoded fluorescent proteins are the most popular.

[0003] Existing pH sensors mainly include small molecule indicators and genetically encoded fluorescent proteins. However, single fluorophore probes are susceptible to probe concentration, photobleaching and instrument fluctuations, and have poor quantitative accuracy. Plasmid transfection of cells to produce pH-responsive proteins can achieve real-time imaging of EV markers, but this method has problems such as uneven transfection, long protein expression time and cytotoxicity that may affect exocytosis. Although small molecule ratio sensors can improve accuracy through self-calibration, most lack molecular programmability and spatial control ability, and cannot respond to specific biomolecular signals (such as specific nucleic acid biomarkers), making it difficult to achieve pH monitoring of specific targets in complex biological environments (such as distinguishing specific types of vesicles).

[0004] Therefore, it is of great practical significance and application value to develop a sensor that has both targeting specificity, high quantitative accuracy and is suitable for pH monitoring in complex biological interfaces. SUMMARY

[0005] In view of the deficiencies in the prior art, the present application aims to provide a ratio type pH sensor based on a tetrahedral framework nucleic acid (TDF) double CRISPR system with target gating function to solve the problems of lack of targeting specificity and insufficient quantitative accuracy of the pH sensor in the prior art.

[0006] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows: A ratio type pH sensor based on a tetrahedral framework nucleic acid double CRISPR system, comprising a tetrahedral framework nucleic acid and a CRISPR / Cas12a system, a CRISPR / Cas13a system, a first fluorescent reporter molecule and a second fluorescent reporter molecule connected to four vertices of the tetrahedral framework nucleic acid, respectively. The tetrahedral framework nucleic acid is formed by four single strands self-assembly, the CRISPR / Cas12a system is connected to one vertex of the tetrahedral framework nucleic acid through 12a-linkA sgRNA, the CRISPR / Cas13a system is connected to another vertex of the tetrahedral framework nucleic acid through 13a-linkB sgRNA, the first fluorescent reporter molecule is a specific substrate of Cas12a, and the second fluorescent reporter molecule is a specific substrate of Cas13a.

[0007] In some embodiments, one vertex of the tetrahedral framework nucleic acid is modified by a hydrophobic group.

[0008] In some embodiments, the first fluorescent reporter molecule is a ssDNA probe labeled with Cy3-BHQ2, and the second fluorescent reporter molecule is a ssRNA probe labeled with Cy5-BHQ3.

[0009] In some embodiments, the four single strands are A26-linkA, B26-linkB, C26-Rep1 and D26-Rep2 respectively, and the sequences of the four single strands are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 respectively.

[0010] In some embodiments, the sequence of the 12a-linkA sgRNA is shown in SEQ ID NO:5, and the sequence of the 13a-linkB sgRNA is shown in SEQ ID NO:6.

[0011] In some embodiments, in the CRISPR / Cas13a system, the crRNA of Cas13a is complementary to a specific target miR-146a, the sequence of miR-146a is shown in SEQ ID NO:9, and the sequence of the 13a-linkB sgRNA is shown in SEQ ID NO:10.

[0012] A preparation method of a ratio-type pH sensor based on a tetrahedral framework nucleic acid-based double-CRISPR system as described above, comprising the following steps: S1, framework assembly: four single strands are mixed in an equimolar ratio in a buffer, and a tetrahedral framework nucleic acid is self-assembled by an annealing reaction; wherein two single strands carry a first fluorescent reporter molecule and a second fluorescent reporter molecule respectively; S2, hybridization of sgRNA: 2 times the molar amount of 12a-linkA sgRNA and 13a-linkB sgRNA is added to the assembled tetrahedral framework nucleic acid, and incubation is performed to allow the sgRNA to hybridize to the extension arm of the tetrahedral framework nucleic acid by base complementary pairing; S3, loading of Cas protein: adding 2 times molar amount of Cas12a protein and Cas13a protein to the tetrahedral framework nucleic acid, incubating, forming a stable ribonucleoprotein complex with the corresponding sgRNA to obtain a complete sensor; S4, purification of the sensor: purifying the complete sensor using size exclusion chromatography to remove unbound proteins and DNA, RNA.

[0013] In some embodiments, the preparation method comprises the following steps: S1, framework assembly: mixing four single strands each at 1 μM in TM buffer, heating at 95℃ for 10 minutes, then rapidly cooling to 4℃ and keeping for 10 minutes to induce self-assembly of the tetrahedron; the four single strands are A26-linkA, B26-linkB, C26-Rep1, and D26-Rep2, and the sequences of the four single strands are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively; the C26-Rep1 strand carries a first fluorescent reporter molecule, and the D26-Rep2 strand carries a second fluorescent reporter molecule; the TM buffer has a composition of 20 mM Tris-HCl, pH 8.5, and 50 mM MgCl2; S2, hybridization of sgRNA: adding 2 times molar amount of 12a-linkA sgRNA and 13a-linkB sgRNA to the assembled tetrahedral framework nucleic acid, incubating at 37℃ for 1 hour to allow the sgRNA to hybridize to the extension arm of the TDF through base complementary pairing; S3, loading of Cas protein: adding 2 times molar amount of Cas12a protein and Cas13a protein to the tetrahedral framework nucleic acid, incubating at 37℃ for 1 hour, forming a stable ribonucleoprotein complex with the corresponding sgRNA to obtain a complete sensor; S4, purification of the sensor: purifying the complete sensor using size exclusion chromatography to remove unbound proteins and DNA; the size exclusion chromatography system used is Agilent 1260 equipped with a size exclusion chromatography column Superdex 200Increase 10 / 300 GL, the mobile phase is 22.5 mM Tris-HCl + 450 mM NaCl, pH 7.4, the flow rate is 1 mL / min, and the detection wavelength is 260 nm.

[0014] The application also provides an application of a ratio-type pH sensor based on the tetrahedral framework nucleic acid-based double-CRISPR system as described above, which is used for monitoring the pH at the biomembrane interface, comprising the following steps: 1) modifying one vertex of the tetrahedral framework nucleic acid with a hydrophobic group; 2) Co-incubate the sensor with lipid vesicles or extracellular vesicles, and achieve stable anchoring by inserting the hydrophobic group into the lipid bilayer membrane; 3) Monitor the dynamic changes of pH at the membrane interface.

[0015] Further, in step 3), the fluorescence intensities of the two fluorescence reporter molecules are collected and the ratio is calculated, and the pH value is determined according to the pre-established pH-fluorescence ratio standard curve.

[0016] The beneficial effects of the present application are: 1) High precision ratio measurement: using dual-channel fluorescence ratio (Cy3 / Cy5) to eliminate concentration and environmental interference, achieving self-calibration, and improving the quantitative accuracy of pH detection.

[0017] 2) Accurate spatial arrangement: TDF rigid support prevents random aggregation of enzymes and substrates, ensures a uniform stoichiometric ratio of Cas12a, Cas13a and their fluorescence reporter molecules 1:1:1:1, and guarantees the stability and consistency of the signal.

[0018] 3) Conditional activation: realizing the logic gating of "target recognition-pH sensing", reporting pH only when specific molecular events (such as vesicle fusion releasing target RNA) occur, greatly improving the specificity of biological detection, and enabling specific target pH monitoring in complex biological environments.

[0019] 4) Membrane stable anchoring: stable anchoring of the sensor on the lipid membrane is achieved through cholesterol modification, which is suitable for monitoring extracellular vesicle fusion, membrane interface pH dynamics and other key biological processes, and expands the application scenarios of the sensor.

[0020] 5) Wide pH response range: using the completely orthogonal cleavage activity and different pH dependence of Cas12a (optimum pH 8.5) and Cas13a (optimum pH 7.2), a complementary dual-channel ratio-type sensing system is constructed, realizing accurate measurement in a wide pH range (6.5-9.2).

[0021] The above description is only a summary of the technical solutions of the present application. In order to more clearly understand the technical means of the present application, and to implement the content of the description, the following will describe the preferred embodiments of the present application in detail with the help of the accompanying drawings. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the following will briefly introduce the drawings needed to be used in the specific embodiments or prior art description. Obviously, some of the drawings described below are some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creating any creative labor.

[0023] Figure 1 Working principle of the TDF-based dual-CRISPR ratiometric pH sensor; Figure 2 DLS characterization of the TDF sensor shown in Example 2 of the present application, wherein Part A is a schematic diagram of the assembly process, and Part B is a dynamic light scattering (DLS) analysis showing the increase in size from bare TDF (7.8 nm), TDF+sgRNA+reporters (11.3 nm) to the complete sensor (~21.0 nm); Figure 3 Fluorescence quenching curve of the TDF sensor shown in Example 2 of the present application under TIRFM; Figure 4 pH response characteristic fluorescence intensity curve of the TDF sensor shown in Example 3 of the present application; Figure 5 Intensity ratio of single molecule imaging of the TDF sensor shown in Example 3 of the present application under STED super-resolution microscopy at different pH values; Figure 6 Confocal microscope imaging of the TDF sensor shown in Example 4 of the present application stably anchored on the surface of the vesicle and smoothly activated; Figure 7 Statistical analysis of the fluorescence intensity ratio of the single vesicle surface shown in Example 4 of the present application and its corresponding relationship with pH; Figure 8 Confocal image of the TDF sensor shown in Example 5 of the present application recovering the pH sensing ability and monitoring pH after the fusion of positive and negative charged vesicles and the recognition of specific RNA targets. DETAILED DESCRIPTION

[0024] In order to better describe the present application, the following specific examples are further described, and the methods in the following examples are all conventional methods unless otherwise specified.

[0025] The technical solutions described in the present application are all conventional solutions in the art unless otherwise specified; the reagents or materials described are all from commercial channels unless otherwise specified.

[0026] The following examples are directed to intermediate compounds and final products identified in the specification and synthetic schemes. The preparation of compounds of the application is described in detail using the following examples, but the chemical reactions described are disclosed by their general applicability to the preparation of compounds of the application. Sometimes, the reactions described can not be applicable to every compound within the scope of the application as described. The compounds for which this occurs will be readily recognized by one of ordinary skill in the art. In these cases, the reactions described can be successfully performed by conventional modifications known to those of ordinary skill in the art. In all preparative methods, all starting materials are known or can be readily prepared from known starting materials. All temperatures are given in degrees Celsius, and unless otherwise stated, all parts and percentages are by mole when referring to yields, and by volume when referring to solvents and eluents.

[0027] Example 1 Preparation of TDF-based dual CRISPR sensor 1.1 Reagents and materials: 1) Nucleotide strands (purchased from Shanghai Generay Biotech Co., Ltd.): A 26-linkA strand (containing 12a-sgRNA linker), the sequence of which is shown as SEQ ID NO: 1; B 26-linkB strand (containing 13a-sgRNA linker), the sequence of which is shown as SEQ ID NO: 2; C 26-Rep1 strand (containing a cholesteryl group and a Cy3-DNA reporter molecule, Cholesteryl-TEG-C26-Rep1, for the membrane-anchored version), the sequence of which is shown as SEQ ID NO: 3; D 26-Rep2 strand (containing a Cy5-RNA reporter molecule), the sequence of which is shown as SEQ ID NO: 4.

[0028] 12a-linkA sgRNA, the sequence of which is shown as SEQ ID NO: 5; 13a-linkB sgRNA (targeting miR-146a), the sequence of which is shown as SEQ ID NO: 6; activ-12a activating DNA, the sequence of which is shown as SEQ ID NO: 7; activ-13a activating RNA, the sequence of which is shown as SEQ ID NO: 8.

[0029] The sequences of each of the above strands are as follows: SEQ ID NO: 1 (A26-linkA, containing 12a-sgRNA linker): GCGTAATGTGCATGTATCTCCAGGCTTTCCGCAGCGGAGCAGGAGTCCTCGGCCTTTGGGCATTCTAGTTGAACGACTGTCGC / iCy5 / / rU / / rU / / rU / / rU / / rU / -BHQ3 SEQ ID NO: 2 (B26-linkB, with 13a-sgRNA linker): GCGTAATGTGCATGTATCTCCAGGCTTTCCGCAGCGGAGCAGGAGTCCTCGGCCTTTGGGCATTCTAGTTGAACGACTGTCGC / iCy5 / / rU / / rU / / rU / / rU / / rU / -BHQ3 SEQ ID NO: 3 (C26-Rep1, with Cy3-DNA reporter): Cholesteryl-TEG-GCCTGGAGATACATGCACATTACGGCTTTCCCTATTAGAAGGTCTCAGGTGCGCGTTTCGGTAAGTAGACGGGACCAGTTCGCCC / iCy3 / TTTTT-BHQ2 (where Cholesteryl-TEG is a hydrophobic group modified with cholesteryl to anchor the synthesized TDF sensor stably on the phospholipid bilayer; / iCy3 / TTTTT-BHQ2 is the fluorescent reporter part corresponding to Cas12a, where TTTTT is the substrate of Cas12a, and BHQ2 is a quenching group of Cy3 fluorescence, which is recovered when Cas12a activity is triggered); SEQ ID NO: 4 (D26-Rep2, with Cy5-RNA reporter): GCGTAATGTGCATGTATCTCCAGGCTTTCCGCAGCGGAGCAGGAGTCCTCGGCCTTTGGGCATTCTAGTTGAACGACTGTCGC / iCy5 / / rU / / rU / / rU / / rU / / rU / -BHQ3 (where / iCy5 / / rU / / rU / / rU / / rU / / rU / -BHQ3 is the fluorescent reporter part corresponding to Cas13a, where / rU / / rU / / rU / / rU / / rU / is the substrate of Cas13a, and BHQ3 is a quenching group of Cy5 fluorescence, which is recovered when Cas13a activity is triggered); SEQ ID NO: 5 (12a-linkA sgRNA): AAUUUCUACUAAGUGUAGAUAUCGCGUAUCGCUAGUCUGUGGAUUGGGUUUGCGU SEQ ID NO: 6 (13a-linkB sgRNA): GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUACUCAUGCCAGGUCAUCGUCGAUCUGAUAGUAGAUCGCGUAU; SEQ ID NO: 7 (activ-12a activating DNA): ATCGACAGACTAGCGATACGCG; SEQ ID NO: 8 (activ-13a activating RNA): UCAGAUCGACGAUGACCUGGCAUGAGUA; 2) CRISPR protein components (purchased from New England Biolabs): Cas12a protein (LbCas12a, ≥99% purity); Cas13a protein (LwaCas13a, ≥99% purity).

[0030] 3) Buffers: TM buffer: 20 mM Tris-HCl (pH 8.5), 50 mM MgCl2; Reaction buffer: 20 mM Tris-HCl, 50 mM NaCl, 5 mM MgCl2, 0.1 mM DTT, pH adjusted according to experimental requirements (6.2-9.5).

[0031] 1.2 Preparation steps: S1, assembly of TDF backbone: S11, mix four single-stranded DNAs A26-linkA, B26-linkB, C26-Rep1, and D26-Rep2 in equal molar ratios (final concentration of each 1 μM) in TM buffer, total volume 100 μL; among them, A26-linkA strand contains 12a-sgRNA connecting arm, B26-linkB strand contains 13a-sgRNA connecting arm, C26-Rep1 strand is pre-labeled with the first fluorescent reporter molecule (Cy3 fluorescent group-connection sequence 1-BHQ2 quenching group, where connection sequence 1 is the substrate of Cas12a), and D26-Rep2 strand is pre-labeled with the second fluorescent reporter molecule (Cy5 fluorescent group-connection sequence 2-BHQ3 quenching group, where connection sequence 2 is the substrate of Cas13a).

[0032] S12, place the mixed solution in a PCR thermal cycler to form a tetrahedral framework nucleic acid with integrated fluorescent reporter molecules. The program settings are as follows: 95℃ heating for 10 minutes (to fully anneal the DNA), rapid cooling to 4℃ and holding for 10 minutes (to induce tetrahedral self-assembly), and then storing at 4℃ for standby after removal.

[0033] S2, hybridization of arm chains: S21, take the TDF solution assembled in step S12, and add 12a-linkA sgRNA (2 μM) and 13a-linkB sgRNA (2 μM) at a final concentration of 2 times the molar amount of TDF; S22, incubate at 37℃ for 1 hour to allow the sgRNA to hybridize to the linkA and linkB extension arms of the TDF through base complementary pairing; S23, store at 4℃ after incubation as a TDF-sgRNA intermediate.

[0034] S3, loading of Cas protein: S31, to the TDF-sgRNA intermediate obtained in step S23, add Cas12a protein and Cas13a protein (2 μM each, final concentration) in a molar ratio of 2:1 (relative to TDF) in sequence; S32, after gentle mixing at room temperature (25℃), incubate at 37℃ for 1 hour to allow the Cas protein to form a stable RNP (ribonucleoprotein) complex with its corresponding sgRNA; S33, after incubation, transfer the solution to ice to obtain a TDF-Cas12a-Cas13a-reporters complex (hereinafter referred to as "TDF sensor") with a complete structure and pre-integrated fluorescent reporter molecules.

[0035] S4, purification of the sensor: S41, use an Agilent 1260 HPLC system equipped with a size exclusion chromatography column (Superdex 200 Increase 10 / 300 GL or equivalent) for purification; S42, mobile phase: 22.5 mM Tris-HCl + 450 mM NaCl (pH 7.4), flow rate 1 mL / min, detection wavelength 260 nm; S43, injection volume 200 μL, collect the elution peak with a retention time of 5-15 minutes (corresponding to the intact sensor complex), and discard the unbound proteins and DNA; S44, use a Hitachi U-3010 ultraviolet spectrophotometer to measure the absorbance at 260 nm, and calculate the concentration according to the formula: c (nM) = A 260× Dilution factor / ε, where ε is the molar extinction coefficient of TDF.

[0036] Example 2 Multi-scale characterization validation of TDF sensor assembly 2.1 Dynamic light scattering (DLS) analysis: Three samples were prepared respectively: (i) bare TDF, (ii) TDF + sgRNA, (iii) TDF + sgRNA + Cas protein (1 μΜ each, diluted in reaction buffer). The hydrodynamic diameter was measured using Malvern Zetasizer Nano ZS at 25 °C. The results, as shown in Figure 2 , showed an increasing size: 7.8 ± 0.5 nm → 11.3 ± 0.8 nm → 21.0 ± 1.2 nm, confirming the successful step-by-step assembly.

[0037] 2.2 TIRFM single-molecule photobleaching experiment: Four TDF sensors, each labeled with Alexa Fluor 488 at the four vertices, were prepared, and the samples were immobilized on a glass substrate, imaged using a Leica AM TIRF MC system, and the fluorescence intensity was recorded under continuous laser irradiation. Four discrete stepwise quenching steps were observed in Figure 3 , confirming a 1 : 1 : 1 : 1 stoichiometric ratio.

[0038] Example 3 pH-responsive performance test 3.1 Fluorescence spectroscopy characterization: After purification, the sensor was placed in buffers of different pH (6.5-9.2) and incubated at 37 °C for 2 hours. The fluorescence intensities of Cy3 (indicating Cas12a activity) and Cy5 (indicating Cas13a activity) were detected using a fluorescence spectrometer. The dual-channel pH response curve of the TDF sensor was obtained, as shown in Figure 4 , and the results showed that the Cas12a activity increased with increasing pH (~pH 8.5 reached the peak), and the Cas13a activity was strongest near pH 7.2, then decreased.

[0039] 3.2 STED single-molecule imaging characterization: The TDF sensor (200 pM) was placed on a glass dish, and the sample was covered with buffers of different pH (containing Cas protein target chains), and incubated at 37 °C for 2 hours. The Abberior EXPERT LINE STED microscope (100x oil objective, NA 1.4) was used for dual-color imaging. The fluorescence ratio of Cy3 / Cy5 was calculated, and it was found that the ratio showed a good monotonic relationship with pH, and the error was significantly smaller than that of single-channel measurement (see Figure 5 ), proving the superiority of the ratio-type detection.

[0040] Example 4 Membrane anchoring of the sensor and lipid interface pH detection 4.1 Preparation of negatively charged liposomes (Lip2): The following raw material ratio: DOPC (dioleoylphosphatidylcholine): 60%, DOPS (dioleoylphosphatidylserine): 30% (to impart negative charge), cholesterol: 10%, total amount 10 mg, dissolved in 2 mL of chloroform, according to the thin film hydration method to prepare negatively charged liposomes.

[0041] 4.2 Membrane anchoring of sensor to vesicles: Cholesterol-modified TDF sensor (final concentration 200 nM) was added to Lip2 vesicle suspension (lipid concentration 1 mg / mL). Incubate in water bath for 30 minutes, gently shake (avoid vigorous shaking to break the vesicles), and insert the sensor into the membrane surface through cholesterol. Remove unbound sensors by 100 kDa Amicon ultrafiltration tube (3000 rcf, 4°C, 10 minutes), and wash twice. Resuspend in reaction buffer and dilute to 0.1 mg / mL lipid concentration for imaging.

[0042] 4.3 Confocal microscopy verifies that the sensor can stably anchor the membrane: Drop the above vesicle-sensor complex (100 μL) on a glass bottom confocal dish (purchased from Nest), incubate at room temperature for 2 hours to allow the vesicles to settle to the bottom. Add activ-12a and activ-13a activator chains (final concentration of each 200 nM), incubate at 37°C for 1 hour in pH 7.8 buffer. Leica TCS SP8 confocal microscopy imaging. As shown in Figure 6 , all three channels show clear "ring-like" fluorescence (optical section of the equatorial plane of the vesicle), AF405 (blue, TDF backbone label), Cy3 (green), and Cy5 (red) are completely co-localized, confirming stable anchoring of the sensor.

[0043] 4.4 Membrane surface pH gradient detection: Add equal amounts of vesicle-sensor complex and activator to different pH buffers, incubate at 37°C for 2 hours, transfer to a glass bottom dish, and perform confocal imaging. Use ImageJ to manually outline the vesicle membrane area for quantitative analysis, and calculate the I_Cy3 / I_Cy5 ratio for each vesicle. As shown in Figure 7 , the Cy3 / Cy5 ratio shows a good monotonic relationship with pH, ranging from pH 6.5 to 9.2, proving that the sensor maintains excellent pH response characteristics at the lipid interface. The AF405 signal remains constant under all pH conditions.

[0044] Example 5 Target-gated vesicle fusion pH detection 5.1 Design of Cas13a-sgRNA targeting miR-146a: miR-146a target, the sequence of which is shown as SEQ ID NO: 9; 13a-linkB-146a, miRNA targeting, the sequence of which is shown as SEQ ID NO: 10; SEQ ID NO: 9 (miR-146a target): UGAGAACUGAAUUCCAUGGGUU; SEQ ID NO: 10 (13a-linkB-146a, miRNA targeting): GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAACCCAUGGAAUUCAGUUCUCAUCUUAUUAGUAGAUCGCGUAU.

[0045] 5.2 Preparation of positively charged vesicles (Lip1) and encapsulation of miR-146a: According to the following raw material ratio: DOPC: 50%, DOTAP (dioleoyl-3- trimethylammonium propane, cationic lipid): 40%, cholesterol: 10%, according to the film hydration method, using Tris buffer (20 mM, pH 7.4) containing miR-146a (10 μM) and AF488 fluorescent dye (5 μM) as the hydration liquid, to obtain Lip1.

[0046] 5.3 Construction and detection of vesicle fusion system: Lip1 and Lip2-TDF pH sensor anchor (refer to the above method) solutions were prepared respectively, and electrostatic interaction mediated fusion of the two, and were placed together in different pH reaction buffers, and were incubated at 37°C for 1 h to ensure fusion, then were moved to glass bottom dishes (Nest) for confocal imaging. The fused vesicles showed AF405 (blue ring) and AF488 (green lumen) signals, confirming the successful fusion of Lip1 and Lip2. Importantly, obvious Cy5 fluorescence (red) appeared after fusion, proving that Cas13a recognized miR-146a released from Lip1 and was activated, thus restoring the pH response ability of the sensor, as shown in Figure 8 , which completely followed the target-gated mechanism and pH response mechanism shown in Figure 1 .

[0047] In summary, the present application constructs a nanosensor with stoichiometric ratio precision (1:1:1:1) by precisely assembling Cas12a, Cas13a and their corresponding fluorescent reporter molecules (ssDNA and ssRNA probes) at the four vertices of the tetrahedral framework nucleic acid. It can realize the following functions: 1. Dual-enzyme complete orthogonality pH response: Cas12a is best active in alkaline environment (pH ~ 8.5), and Cas13a is best active in neutral environment (pH ~ 7.2). The intersection of the activity curves of the two and the different complementary characteristics of the reporter molecules constitute the basis of the ratio-type sensing. 2. Target-gated: The activation of the sensor depends on the recognition of a specific target (such as miR-146a). Without the target, Cas13a is in an inactive state and does not produce a signal; only after the target is recognized (for example, after encountering the target after vesicle fusion), does the sensor start the pH response function. 3. Membrane-stable anchoring: Through cholesterol modification, the sensor can be stably anchored on the surface of the lipid membrane to monitor the pH change at the membrane interface.

[0048] The technical features of the above-described embodiments can be combined in any manner. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described, but as long as the combinations of the technical features do not contradict, they should be considered within the scope of the present disclosure.

[0049] The above-described embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be pointed out that for ordinary skilled persons in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are all within the protection scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.

Claims

1. A ratiometric pH sensor based on a tetrahedral framework nucleic acid dual CRISPR system, characterized in that, It includes a tetrahedral framework nucleic acid and a CRISPR / Cas12a system, a CRISPR / Cas13a system, a first fluorescent reporter molecule, and a second fluorescent reporter molecule respectively connected to the four vertices of the tetrahedral framework nucleic acid; The tetrahedral framework nucleic acid is formed by the self-assembly of four single strands. The CRISPR / Cas12a system is connected to one vertex of the tetrahedral framework nucleic acid via 12a-linkA sgRNA, and the CRISPR / Cas13a system is connected to the other vertex of the tetrahedral framework nucleic acid via 13a-linkB sgRNA. The first fluorescent reporter molecule is a specific substrate of Cas12a, and the second fluorescent reporter molecule is a specific substrate of Cas13a.

2. The ratiometric pH sensor based on a tetrahedral framework nucleic acid dual CRISPR system as described in claim 1, characterized in that, One vertex of the tetrahedral framework nucleic acid is modified with a hydrophobic group.

3. The ratiometric pH sensor based on a tetrahedral framework nucleic acid dual CRISPR system as described in claim 2, characterized in that, The first fluorescent reporter molecule is an ssDNA probe labeled Cy3-BHQ2, and the second fluorescent reporter molecule is an ssRNA probe labeled Cy5-BHQ3.

4. The ratiometric pH sensor based on a tetrahedral framework nucleic acid dual CRISPR system as described in claim 3, characterized in that, The four single chains are A26-linkA, B26-linkB, C26-Rep1, and D26-Rep2, and the sequences of the four single chains are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, respectively.

5. The ratiometric pH sensor based on a tetrahedral framework nucleic acid dual CRISPR system as described in claim 1, characterized in that, The sequence of the 12a-linkA sgRNA is shown in SEQ ID NO:5, and the sequence of the 13a-linkB sgRNA is shown in SEQ ID NO:

6.

6. The ratiometric pH sensor based on a tetrahedral framework nucleic acid dual CRISPR system as described in claim 1, characterized in that, In the CRISPR / Cas13a system, the Cas13a crRNA is complementary to the specific target miR-146a, the sequence of which is shown in SEQ ID NO:9, and the 13a-linkB sgRNA sequence is shown in SEQ ID NO:

10.

7. A method for preparing a ratiometric pH sensor based on a tetrahedral framework nucleic acid dual CRISPR system as described in any one of claims 1 to 6, characterized in that, Includes the following steps: S1, Framework Assembly: Four single strands are mixed in an equimolar ratio in a buffer solution and annealed to induce the self-assembly of tetrahedral framework nucleic acids; two of the single strands carry the first fluorescent reporter molecule and the second fluorescent reporter molecule, respectively. S2, sgRNA hybridization: Add 2 molar amounts of 12a-linkAsgRNA and 13a-linkB sgRNA to the assembled tetrahedral framework nucleic acid, incubate, and allow the sgRNA to hybridize to the extension arm of the tetrahedral framework nucleic acid through base complementarity pairing. S3, Loading of Cas proteins: Add Cas12a and Cas13a proteins in 2 molar amounts to the tetrahedral framework nucleic acids, incubate, and form a stable ribonucleoprotein complex with the corresponding sgRNA to obtain a complete sensor; S4, Sensor Purification: Purify the intact sensor using size exclusion chromatography to remove unbound proteins, DNA, and RNA.

8. The preparation method according to claim 7, characterized in that, Includes the following steps: S1. Framework Assembly: Four single strands, each at 1 μM, were mixed in TM buffer, heated at 95°C for 10 minutes, then rapidly cooled to 4°C and held for 10 minutes to induce tetrahedral self-assembly. The four single strands are A26-linkA, B26-linkB, C26-Rep1, and D26-Rep2, and their sequences are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, respectively. The C26-Rep1 strand carries the first fluorescent reporter molecule, and the D26-Rep2 strand carries the second fluorescent reporter molecule. The TM buffer consists of 20 mM Tris-HCl, pH 8.5, and 50 mM MgCl2. S2, sgRNA hybridization: Add 2 molar amounts of 12a-linkAsgRNA and 13a-linkB sgRNA to the assembled tetrahedral framework nucleic acid, and incubate at 37°C for 1 hour to allow sgRNA to hybridize to the extension arm of TDF through base complementarity pairing. S3, Cas protein loading: Add Cas12a protein and Cas13a protein in 2 molar amounts to the tetrahedral framework nucleic acid, incubate at 37°C for 1 hour, and form a stable ribonucleoprotein complex with the corresponding sgRNA to obtain a complete sensor; S4. Sensor Purification: The intact sensor was purified using size exclusion chromatography to remove unbound proteins and DNA. The size exclusion chromatography system used was an Agilent 1260, equipped with a Superdex 200 Increase10 / 300 GL size exclusion column. The mobile phase was 22.5 mM Tris-HCl + 450 mM NaCl, pH 7.4, flow rate 1 mL / min, and detection wavelength 260 nm.

9. An application of a ratiometric pH sensor based on a tetrahedral framework nucleic acid dual CRISPR system, prepared by any one of claims 1-6 or any one of claims 7-8, characterized in that, The sensor is used for monitoring pH at the biofilm interface, and includes the following steps: 1) Modify one vertex of a tetrahedral framework nucleic acid using a hydrophobic group; 2) The sensor is co-incubated with lipid vesicles or extracellular vesicles, and stable anchoring is achieved by inserting hydrophobic groups into the lipid bilayer membrane; 3) Monitor the dynamic changes of pH at the membrane interface.

10. The application as described in claim 9, characterized in that, In step 3), the pH value is determined by collecting the fluorescence intensity of the two fluorescent reporter molecules and calculating their ratio, based on a pre-established pH-fluorescence ratio standard curve.

Images