InDel molecular marker related to welsh onion leaf wax as well as primer and application of InDel molecular marker
By developing InDel molecular markers and primers related to waxy scallion leaves and combining them with KASP technology, the problem of efficient screening of waxy traits in scallion breeding was solved, enabling rapid and accurate waxy identification and variety improvement.
Patent Information
- Application Number
- CN202610150506.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-03
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2046-02-03
AI Technical Summary
Existing technologies are insufficient for efficiently and accurately screening and identifying waxy traits in scallion leaves, which affects the scallion breeding process and variety improvement.
We developed an InDel molecular marker and its primers related to the waxy texture of scallion leaves, and used competitive allele-specific PCR (KASP) technology for high-throughput detection. By designing specific primer pairs, we achieved rapid and large-scale identification of waxy traits.
This technology enables rapid and precise screening of waxy traits in scallion leaves, promoting genetic background analysis and hybrid variety breeding in scallions, and has broad application prospects.
Smart Images

Figure CN121718652A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomolecular breeding technology, and in particular to an InDel molecular marker related to the waxy coating of scallion leaves, its primers, and applications. Background Technology
[0002] scallions ( Allium fistulosum L. var. Giganteam Makino is a member of the genus L. in the family Liliaceae. Allium Scallions are a crop primarily grown for their large pseudostems composed of leaf sheaths and tender leaves, with the leaf surface covered by a distinct waxy layer. Scallions are rich in nutrients; the phytochemicals they contain not only enhance appetite and digestion but also possess antibacterial and anti-inflammatory properties. Scallions also contribute to regional economic development, and their cultivation is widespread.
[0003] The cuticle of a plant's epidermis, located on the outermost layer of epidermal cells, is composed of cuticle and wax. The plant cuticle forms a network structure, and the wax filling the spaces between these structures is called the inner epidermal wax. This epidermal wax, covering the surface of organs, has strong hydrophobic properties, protecting against biotic and abiotic stresses. For example, it controls water loss, improving drought tolerance, resisting pests and diseases, and protecting plants from UV damage. It also plays a role in determining the glossiness of organs. The composition of the plant's epidermal wax dynamically adjusts due to species differences, growth stages, and variations in external environmental conditions. Typically, the main components of the cuticle wax include very long-chain fatty acids and their various derivatives (such as alkanes, aldehydes, primary alcohols, secondary alcohols, ketones, and esters) and various lipophilic secondary metabolites (such as pentacyclic triterpenes, flavonoids, and tocopherols). Studies have shown that plant epidermal wax can limit non-stomatal water loss and is closely related to plant drought resistance.
[0004] InDel (insertion / deletion) markers, as an important class of molecular markers, trace their origins back to the widespread insertion and deletion polymorphisms in the genome. These markers are developed based on short-fragment insertion or deletion variations at specific sites in the genome among different individuals, representing one of the most common forms of variation in DNA sequences. InDel molecular markers allow for the precise detection and analysis of insertion and deletion events in DNA sequences, enabling in-depth studies of genome structure and function, and are crucial markers for molecular breeding applications. Overall, InDel markers, with their stability, reliability, cost-effectiveness, and efficiency, have become an indispensable tool in modern plant genomics and molecular breeding research.
[0005] Kompetitive allele-specific PCR (KASP) marker technology is a high-throughput single nucleotide polymorphism (SNP) genotyping method based on fluorescence signals. It offers advantages such as time-saving convenience, low cost, and reliable results. Currently, KASP technology has been successfully applied to molecular marker-assisted selection of fertility-related genes in various crops, including sorghum, rice, maize, wheat, tomato, and soybean. KASP molecular marker technology is not limited by environmental conditions, allows for seedling selection, accelerates the breeding process, and facilitates the screening of regulatory genes for beneficial traits, guiding subsequent variety improvement and gene validation. Summary of the Invention
[0006] The purpose of this invention is to provide an InDel molecular marker related to the waxy substance in scallion leaves, its primers, and its applications, in order to solve the problems existing in the prior art.
[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides an InDel molecular marker associated with the waxy coating of scallion leaves. The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO. 4, and an insertion of the sequence shown in SEQ ID NO. 1 is present at the 302-978 bp bases of the sequence shown in SEQ ID NO. 4.
[0008] This invention provides primer pairs for amplifying the InDel molecular marker as described above, wherein the primer pairs include primer pair 1 or primer pair 2; primer pair 1 includes the nucleotide sequence InPF3F as shown in SEQ ID NO. 2 and the nucleotide sequence InPF3R as shown in SEQ ID NO. 3; primer pair 2 includes the nucleotide sequence KASP_26_F1 as shown in SEQ ID NO. 5, the nucleotide sequence KASP_26_F2 as shown in SEQ ID NO. 6, and the nucleotide sequence KASP_26_R as shown in SEQ ID NO. 7.
[0009] This invention provides the application of the above-mentioned primer pair in the preparation of a product for identifying the presence or absence of wax in scallion leaves.
[0010] Optionally, the product includes reagents, reagent kits, and chips.
[0011] This invention provides a product for identifying whether scallion leaves have a waxy coating, the product comprising the primer pair described above.
[0012] Optionally, the product includes reagents, reagent kits, and chips.
[0013] This invention provides the application of the above-mentioned primer pairs or the above-mentioned products in identifying the presence or absence of wax in scallion leaves.
[0014] This invention provides a method for identifying whether scallion leaves have a waxy coating, the method comprising the following steps: Using the DNA of the scallion material to be tested as a template, PCR amplification was performed using the primer pairs mentioned above to obtain PCR amplification products; the amplification products were detected by agarose gel electrophoresis, and the results were used to make judgments. Alternatively, using the DNA of the scallion material to be tested as a template, PCR amplification is performed using primer pair 2 as described in claim 2, and genotyping is performed based on the PCR amplification results.
[0015] Optionally, when the length of the amplification product is 461 bp, the scallion material to be tested is a waxy scallion material; when the length of the amplification product is 461 bp and 1138 bp, the scallion material to be tested is a waxy scallion material; when the length of the amplification product is 1138 bp, the scallion material to be tested is a non-waxy scallion material. Alternatively, if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of KASP_26_F1, then the scallion material to be tested is a homozygous scallion material with wax; if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of KASP_26_F2, then the scallion material to be tested is a homozygous scallion material without wax; if the fluorescence signal color of the PCR amplification result is different from the fluorescence adapter colors of both KASP_26_F1 and KASP_26_F2, then the scallion material to be tested is a heterozygous scallion material with wax.
[0016] This invention provides the use of the above-described primer pairs or the above-described products in any of the following: (1) Select scallion varieties with waxy coating; (2) Select scallion varieties without wax coating; (3) Cultivate scallion varieties with waxy coating; (4) Cultivate wax-free scallion varieties.
[0017] The present invention discloses the following technical effects: This invention provides a superior InDel locus closely linked to the waxy trait of scallion epidermis. It can be used to detect scallion epidermal wax, rapidly screen for wax-free scallion varieties, analyze and screen scallion genetic background, promote hybrid breeding, identify superior loci with potential application value, and utilize waxy molecular marker-assisted selection breeding, demonstrating broad application prospects.
[0018] This invention develops an InDel molecular marker associated with the waxy trait of scallion epidermis, based on the InDel locus. This marker is directly expressed in DNA form and can be detected in various developmental stages and different tissues and organs of scallions, unaffected by environmental or seasonal limitations, and without being affected by expression status. By extracting DNA from scallion tissues and performing PCR amplification using the specific primers described in this invention, a 461 bp or double band of 461 bp and 1138 bp indicates waxy material, while a 1138 bp amplification product indicates non-waxy material. This achieves rapid, large-scale, and automated detection of the test samples. Therefore, the InDel molecular marker provided by this invention is tightly linked to the non-waxy trait. This InDel molecular marker and its primer pair can be used to detect the waxy condition of scallion leaves, accurately screen waxy and non-waxy varieties, and detect their genotypes. This can be used for scallion genetic background analysis and screening, promoting the breeding of hybrid varieties. The superior loci and waxy molecular markers identified in this invention, which have potential application value, can assist in selective breeding and are of profound significance for elucidating the evolution of wax and the molecular mechanism of wax formation in the evolution of scallions, with broad application prospects. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 For gl 351 × Genetic diagram of the waxy epidermis of hybrid scallion combinations; Figure 2 The results of agarose gel electrophoresis of PCR products amplified from the DNA of two parents, F1 and 226 F2 progeny scallions using InPF3F / InPF3R primers; ♂ (lane 227): male parent, a waxy variety; ♀ (lane 228): gl 351 The maternal parent was a non-waxed variety; F1 (lane 229): F1 hybrid offspring; water (lane 230): negative treatment; F2 offspring with waxed PCR products in lanes 1-226 showed 461bp or double-banded PCR products on electrophoresis, while F2 offspring without waxed PCR products showed 1138bp PCR products on electrophoresis. Figure 3 This is the verification result for Example 2; Figure 4 This is the genotyping result for the KASP primer pair. Detailed Implementation
[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0026] Example 1: InDel site and development of InDel molecular markers 1. Materials Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.
[0027] 2. Methods 2.1 Screening of InDel molecular markers in scallion leaf wax 2.1.1 Experimental Materials and Population Construction The non-waxygenated mutant gl was collected by the Vegetable Functional Gene Research Center Laboratory of Qingdao Agricultural University. 351Using a female parent (P1) and a waxy scallion that has been continuously self-pollinated for many years as the male parent (P2), hybridization was performed through artificial emasculation and bagging to obtain F1. F1 was then self-pollinated to obtain F2, resulting in a total of 226 F2 plants. Figure 1 The scallions were used as a genetic population for research. This experiment was conducted at the Huangdanxian Scallion Planting Base of Qingdao Agricultural University in Jimo District. All materials were planted in the same plot of land under completely identical environmental conditions and with uniform field management to reduce errors caused by human factors.
[0028] 2.1.2 Field survey of waxy properties of scallions The results are as follows Figure 2 As shown, the wax-free mutant gl 351 The F1 generation of scallion plants, obtained by bagging a cross between a waxy scallion (maternal parent) and a waxy scallion (paternal parent) that had been continuously self-pollinated for many years, all exhibited waxy leaf epidermis. Since the presence or absence of wax is a very distinct phenotypic trait, manual identification was used to demonstrate that waxy leaf epidermis is dominant over non-waxy leaf epidermis. In the F2 generation, 168 scallion plants showed waxy leaves, while 58 showed non-waxy leaves. A chi-square test revealed that the segregation ratio generally followed a waxy:non-waxy leaf ratio of 3:1, with a p-value of 0.818 > 0.05, consistent with the inheritance pattern controlled by a single gene.
[0029] Table 1. Segregation of traits in the F2 generation of hybrids 2.1.3 BSR High-Throughput Sequencing Based on the above genetic analysis results, samples were taken from both waxy and non-waxy plants in the F2 population to construct mixed pools for the waxy trait. BSR high-throughput sequencing was performed, and the sequencing results were compared with reported onion genome databases to ensure accuracy. Based on the detected InDel sites and the sample phenotypes, candidate regions closely linked to the waxy trait and differentially expressed InDel sites were located. A significant peak was found on chromosome 5 of the onion. Further analysis revealed an InDel site after base position 348951997 of Chr 5. The InDel sequence is shown in SEQ ID NO. 1, specifically: The reference genome is the onion genome assembled by Professor Yu Jingquan's team at Zhejiang University in 2022, with accession number CNP0002276.
[0030] 2.1.4 InDel Detection The accuracy of the InDel sequence results was verified in individual plants of the F2 population using genotyping technology to obtain reliable analytical results. Specific extension primers were designed based on the InDel site, as shown in Table 2 below.
[0031] Table 2 InDel-specific primers The aforementioned specific primers can also be used to create a kit for detecting the waxy trait of scallion leaves. This kit contains the aforementioned InDel specific primers and is used for breeding scallion varieties without waxy leaves and for marker-assisted breeding of waxy leaves. The target sequence is then amplified by PCR. The specific PCR reaction system is shown in Table 3, and the PCR reaction procedure is shown in Table 4.
[0032] Table 3 PCR reaction system Table 4 PCR reaction procedure The results are shown in Table 5. The results show that among the 226 F2 plants tested, 50 plants with waxy genotypes at the InDel locus had an amplification product size of 461 bp, identical to the paternal parent; 118 plants had heterozygous genotypes with amplification products of 461 bp and 1138 bp. Meanwhile, 58 plants without waxy genotypes at the InPF3 locus had an amplification product size of 1138 bp, identical to the maternal parent (Table 5). Chi-square test showed that the genotype segregation ratio generally followed the pattern of no insertion: heterozygous: insertion = 1:2:1, with a P-value of 0.604 > 0.05, consistent with the genetic rules of single-gene control. These results indicate that the InPF3 locus at InDel is closely linked to or co-segregates with the waxy trait in scallions. It can be used as a molecular marker for the molecular detection of the waxy trait in scallions, and can also be used for genetic background analysis and screening of scallions, as well as marker-assisted selection breeding for the waxy trait in scallions, showing broad application prospects.
[0033] Table 5 Genotype segregation in F2 hybrids The InDel molecular marker containing the InDel sequence is shown in SEQ ID NO.4, specifically: ACAGTTATAGGTGCGCGTCAG GGATTGCACGAAGC ATACAG .
[0034] The underlined portion indicates the primer binding site, and the lowercase portion indicates the insertion site of the 677 bp nucleotide sequence in the unwaxed material genome. The inserted 677 bp nucleotide sequence is shown in SEQ ID NO. 1.
[0035] 2.2 Method for identifying waxy traits in scallion epidermis using InDel markers This embodiment provides a method for detecting the waxy texture of scallion leaves using tightly linked InDel molecular markers, including the following steps: (1) DNA was extracted from the leaves of the scallion to be tested using the CTAB method; The DNA extraction method is based on the modified CTAB method. Use tweezers to take a 4 cm sample. 2 Place scallion leaves in a clean 2 mL centrifuge tube. Add 200 μL of CTAB extraction buffer (purchased from Beijing Leigen Biotechnology Co., Ltd., product number NE0011; the CTAB extraction buffer: 2-ME ratio should be mixed thoroughly at 50:1) and 2 steel balls to the centrifuge tube. Cap the centrifuge tube and place it in a plant grinder, grinding at 60 Hz for 120 s. Remove the centrifuge tube and centrifuge briefly at 12000 rpm for 1 min. Add another 800 μL of CTAB extraction buffer and mix the liquid in the centrifuge tube using a vortex mixer. Place the centrifuge tube in a preheated 65℃ water bath and incubate for 30 min, inverting the centrifuge tube every 15 min to mix. After incubation, add 800 μL of chloroform solution to the centrifuge tube, invert it several times, and centrifuge at 12000 rpm for 10 min. Remove the centrifuge tube and transfer the supernatant to a new 1.5 mL centrifuge tube. Add 700 μL of isopropanol, mix well, and place at -20°C overnight. The next day, remove the centrifuge tube and centrifuge at 12,000 rpm for 20 min. Remove the supernatant and add 500 μL of 75% ethanol. Centrifuge at 12,000 rpm for 20 min. Remove the supernatant and aspirate any remaining liquid from the centrifuge tube with a pipette. Place the tube in a 65°C oven with the lid open for 20 min, add 100 μL of double-distilled water, and measure the concentration and purity using a micro spectrophotometer. Then, freeze the tube at -20°C for subsequent experiments.
[0036] Using genotyping technology, specific primers were designed based on the aforementioned InDel molecular markers, and their sequences are shown in Table 2.
[0037] (2) Using scallion tissue DNA as a template, PCR amplification was performed using the designed specific primers. The PCR amplification system and procedure are shown in Tables 3 and 4.
[0038] (3) Agarose gel electrophoresis Agarose from Wuhan Boyuan Biotechnology Co., Ltd., 50×TAE Buffer from Ruiboxing Technology, and green fluorescent nucleic acid dye (10000×) from Beijing Solarbio Science & Technology Co., Ltd. were used as experimental reagents. 50×TAE Buffer was diluted to 0.5×TAE Buffer. 0.5 g of agarose was added to 50 mL of 0.5×TAE Buffer. After boiling twice in a microwave oven and cooling to approximately 60°C, 5 μL of nucleic acid dye was added. The mixture was poured into a gel bath and cooled to prepare a 1% agarose gel. PCR stock solution was spotted into the gel wells for electrophoresis at 120 mA and 90 V. After electrophoresis, the electrophoretic bands were observed in a gel imaging analyzer, and the images were scanned and saved.
[0039] The results are as follows Figure 2 As shown. The results indicate that the unwaxed material has a unique banding pattern, completely different from that of the waxed material, and the InPF3F / InPF3R markers exhibit polymorphism in both materials. Agarose gel electrophoresis clearly distinguished the band of the unwaxed DNA amplification product (1138 bp), which was significantly larger than the band of the waxed material DNA amplification product (461 bp or double bands (461 bp and 1138 bp)). The InPF3F / InPF3R markers showed a close linkage (co-segregation) with the waxy trait of scallion epidermis. Alignment of the DNA sequences of the waxed and unwaxed materials using genome visualization software and first-generation sequencing results clearly showed that the unwaxed material had an insertion of 677 bases after the 301st base compared to the waxed material (SEQ ID NO. 1).
[0040] Example 2: Practical Application 1. Experimental materials: 10 waxy plants and 10 non-waxy plants from the F2 population of Example 1.
[0041] 2. PCR amplification was performed using the method described in Example 1. The results showed that the DNA amplification products of single plants with waxy coating all showed a 461 bp band or double bands (461 bp and 1138 bp); while the DNA amplification products of single plants without waxy coating all showed a 1138 bp band. Therefore, the primer pair provided by this invention can accurately identify the presence or absence of waxy coating on scallion leaves.
[0042] Example 3: Design and application of KASP primer pairs KASP primer pairs were designed on the antisense strand of the sequence SEQ ID NO.4, and the sequences are shown in Table 6.
[0043] Table 6. Sequences of KASP primer pairs Fifty-nine waxy single plants and 23 non-waxy single plants from the F2 population of Example 1 were selected. KASP PCR was performed using the primers listed in Table 6, and the results were distinguished by color. The KASP PCR results are shown in Table 7, the procedure is shown in Table 8, and the genotyping results are as follows: Figure 4 As shown.
[0044] Table 7 Kasp PCR System Table 8 Kasp PCR Procedure The typing results show that: 19 individual plants with red dots indicate the detection of FAM signals, belonging to haplotype 1, which is a homozygous, waxy onion material, consistent with the field phenotype; 40 individual plants with green dots indicate the simultaneous detection of FAM and HEX signals, belonging to haplotype 2, which is a heterozygous, waxy onion material, consistent with the field phenotype; 23 individual plants with blue dots indicate the detection of HEX signals, belonging to haplotype 3, which is a homozygous, non-waxy onion material. Black dots represent NTC (water).
[0045] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. An InDel molecular marker associated with the waxy coating of scallion leaves, characterized in that, The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO. 4, and an insertion of the sequence shown in SEQ ID NO. 1 is present at positions 302-978 bp of the sequence shown in SEQ ID NO.
4.
2. A primer pair for amplifying the InDel molecular marker as described in claim 1, characterized in that, The primer pairs shown include primer pair 1 or primer pair 2; primer pair 1 includes the nucleotide sequence InPF3F as shown in SEQ ID NO. 2 and the nucleotide sequence InPF3R as shown in SEQ ID NO. 3; primer pair 2 includes the nucleotide sequence KASP_26_F1 as shown in SEQ ID NO. 5, the nucleotide sequence KASP_26_F2 as shown in SEQ ID NO. 6 and the nucleotide sequence KASP_26_R as shown in SEQ ID NO.
7.
3. The use of the primer pair according to claim 2 in the preparation of a product for identifying the presence or absence of wax in scallion leaves.
4. The application according to claim 3, characterized in that, The products include reagents, reagent kits, and chips.
5. A product for identifying the presence or absence of wax on scallion leaves, characterized in that, The product comprises the primer pair as described in claim 2.
6. The product according to claim 5, characterized in that, The products include reagents, reagent kits, and chips.
7. The application of the primer pair of claim 2 or the product of claim 5 or 6 in identifying the presence or absence of wax in scallion leaves.
8. A method for identifying the presence or absence of wax on scallion leaves, characterized in that, The method includes the following steps: Using the DNA of the scallion material to be tested as a template, PCR amplification was performed using primer pair 1 as described in claim 2 to obtain PCR amplification products; the amplification products were detected by agarose gel electrophoresis, and the results were used to make a judgment. Alternatively, using the DNA of the scallion material to be tested as a template, PCR amplification is performed using primer pair 2 as described in claim 2, and genotyping is performed based on the PCR amplification results.
9. The method according to claim 8, characterized in that, When the length of the amplification product is 461 bp, the scallion material to be tested is a waxy scallion material; when the length of the amplification product is 461 bp and 1138 bp, the scallion material to be tested is a waxy scallion material; when the length of the amplification product is 1138 bp, the scallion material to be tested is a non-waxy scallion material. Alternatively, if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of KASP_26_F1, then the scallion material to be tested is a homozygous scallion material with wax; if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of KASP_26_F2, then the scallion material to be tested is a homozygous scallion material without wax; if the fluorescence signal color of the PCR amplification result is different from the fluorescence adapter colors of both KASP_26_F1 and KASP_26_F2, then the scallion material to be tested is a heterozygous scallion material with wax.
10. The use of the primer pair of claim 2 or the product of claim 5 or 6 in any of the following: (1) Select scallion varieties with waxy coating; (2) Select scallion varieties without wax coating; (3) Cultivate scallion varieties with waxy coating; (4) Cultivate wax-free scallion varieties.