Benzyl isoquinoline alkaloid yarrowia lipolytica production strain and application thereof

By modifying the *Yersinia lipophila* strain, overexpressing related enzyme genes, and optimizing dopamine utilization, the problems of limited accumulation and insufficient yield of BIA in plants were solved, and the efficient synthesis of (S)-norcodine and (S)-horsenosides was achieved.

CN121759330APending Publication Date: 2026-03-31TIANJIN UNIV OF SCI & TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610245499.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-02
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

In the existing technology, benzyl isoquinoline alkaloids (BIA) accumulate in plants in a limited manner, which limits their medicinal potential. Furthermore, heterologous synthesis of BIA using Escherichia coli and Saccharomyces cerevisiae as microbial hosts suffers from insufficient yield.

Method used

By modifying the *Yarrowia lipolytica* strain, overexpressing the phenylpyruvate decarboxylase gene ARO1 and the branching acid synthase gene ARO2, the feedback inhibition of shikimic acid was relieved. Overexpressing the 3-deoxy-D-arabino-heptanulose-7-phosphate synthase mutant Aro4K221L and the branching acid dismutase mutant Aro7G139S increased the tyrosine biosynthesis flux. Furthermore, heterologous introduction of tyrosine hydroxylase CYP76AD5, dopamine decarboxylase DODC, and (S)-norcoguline synthase NCS35 optimized dopamine utilization, reduced dopamine degradation, and synthesized (S)-norcoguline and (S)-codonoline.

Benefits of technology

It significantly improves the synthesis efficiency and yield of (S)-norcodonine and (S)-horsenoside, providing a highly efficient microbial cell factory for BIA production and solving the problem of insufficient yield in existing technologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759330A_ABST
    Figure CN121759330A_ABST
Patent Text Reader

Abstract

The invention provides a benzyl isoquinoline alkaloid yarrowia lipolytica production strain and application thereof.The benzyl isoquinoline alkaloid yarrowia lipolytica production strain is a strain finally obtained through heterologous expression of CYP76AD5, DODC, NCS35, 6 'OMT, CNMT, NMCH and 4' OMT, deletion of HPPD, COMT, ADH2 and PAR4 genes and overexpression of ARO1, ARO2, Aro4K221L, Aro7G139S and ARO10, has the potential of being used as a microbial cell factory for producing BIA, and can be used as a microbial cell factory for producing BIA. (S)-higenamine and (S)-phylline can be synthesized from the beginning under the aerobic condition by using the YPD culture medium, and the synthesis efficiency and yield are remarkably improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology, and in particular to a benzyl isoquinoline alkaloid-producing strain of Yersinia lipophila and its application. Background Technology

[0002] Benzylisoquinoline alkaloids (BIAs) are a family of alkaloids with potential medicinal value. Besides their prominent roles in traditional medicine, they also have a wide range of pharmacological applications, such as analgesics, antitussives, and antibacterial agents. Recently, preliminary studies have revealed new potential for treating cancer, malaria, AIDS, and mental illness. Despite the broad clinical applications of BIAs, only a few types tend to accumulate easily in plants, limiting their medicinal potential.

[0003] To overcome this obstacle, utilizing microorganisms as bioreactors to produce BIAs has become the primary direction at present. However, BIA diversity originates from a single scaffold; the synthesis of BIAs in plants begins with the condensation of dopamine and 4-hydroxyphenylacetaldehyde (4-HPAA) to form (S)-norcoclaurine. (S)-norcoclaurine, as a scaffold, can produce over 2500 other BIAs, thus enabling the development of microbial platform strains that can generate BIA scaffolds from simple carbon sources, and further facilitate the engineered production of BIAs. Figure 1 ).

[0004] Currently, the commonly used microbial host for BIA heterologous synthesis is Escherichia coli (E. coli). Escherichia coli ) and brewer's yeast ( Saccharomyces cerevisiae There are very few research reports on the use of metabolic engineering to modify other hosts for fermentation production of BIA, and the yield of BIA needs to be improved. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a benzyl isoquinoline alkaloid-producing Yersinia lipophila strain.

[0006] Another technical problem to be solved by the present invention is to provide the application of the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipophila strain.

[0007] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows: A type of lipophilic yeast (Yersinia spp.) Yarrowia lipolytica The engineered strain, named *Yersinia lipolytica* Po1g N1, is a production strain of the benzyl isoquinoline alkaloid *Yersinia lipolytica* Po1gΔku70. It was obtained by overexpressing the phenylpyruvate decarboxylase gene ARO1 and the branching acid synthase gene ARO2 to increase the flux towards tyrosine biosynthesis; and overexpressing the 3-deoxy-D-arabino-heptanulose-7-phosphate synthase mutant Aro4.K221L and the cladistic acid dismutase mutant Aro7 G139S To relieve shikimic acid feedback inhibition; the codon-optimized phenylpyruvate decarboxylase gene ARO10 from Saccharomyces cerevisiae was overexpressed to improve the utilization of 4-hydroxyphenylacetaldehyde (4-HPAA); and heterologous introduction of beetroot... Beta vulgaris Tyrosine hydroxylase CYP76AD5 and Pseudomonas putida from Pseudomonas putida The dopa decarboxylase gene DODC was introduced to efficiently produce dopamine; a heterologous gene from Coptis chinensis in Japan was also introduced. Coptis japonica The (S)-norcodonopsis alkaloid synthase gene was obtained by truncating the N-terminus by 35 amino acids to obtain NCS. 35, for efficient production of (S)-norcodine.

[0008] Preferably, the above-mentioned benzyl isoquinoline alkaloid-producing *Yersinia lipolytica* strain, named benzyl isoquinoline alkaloid-producing *Yersinia lipolytica* strain Po1g N2, is obtained by modifying the above-mentioned benzyl isoquinoline alkaloid-producing *Yersinia lipolytica* strain Po1g N1: it overexpresses one or two NCSs based on Po1g N1. 35, further preferred, overexpression of an NCS 35.

[0009] Preferably, in the above-mentioned benzyl isoquinoline alkaloid-producing *Yarrowia lipolytica* strain, the nucleotide sequence of the tyrosine hydroxylase CYP76AD5 is shown in SEQ ID NO.1, the nucleotide sequence of the dopa decarboxylase gene DODC is shown in SEQ ID NO.2, and the (S)-norcodonine synthase gene NCS... The nucleotide sequence of 35 is shown in SEQ ID NO. 3 of the sequence listing; the nucleotide sequence of the phenylpyruvate decarboxylase gene ARO1 is shown in SEQ ID NO. 4 of the sequence listing; the nucleotide sequence of the branched acid synthase gene ARO2 is shown in SEQ ID NO. 5 of the sequence listing; and the 3-deoxy-D-arabino-heptanulose-7-phosphate synthase mutant Aro4 is shown. K221L The nucleotide sequence is shown in SEQ ID NO.6 of the sequence listing, the branched acid dismutase mutant Aro7. G139S The nucleotide sequence of the gene ARO10, derived from Saccharomyces cerevisiae, is shown in SEQ ID NO.7. The nucleotide sequence of the gene ARO10, derived from Saccharomyces cerevisiae, is shown in SEQ ID NO.8.

[0010] Preferably, the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain is named benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1g N3, which is obtained by modifying the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1g N2: the 4-hydroxyphenylpyruvate dioxygenase gene 4-HPPD is knocked out. This gene acts as a 4-HPP degradation gene to produce homogentisic acid in yeast.

[0011] Preferably, the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain is named benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1g N4, which is obtained by modifying the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1g N3: the catechol-O-methyltransferase gene COMT, which is a potential dopamine degradation gene, has been knocked out.

[0012] Preferably, the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain is named benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1g N5-1, which is obtained by modifying the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1g N4: the potential aldehyde reductase gene ADH2 from the substrate 4-hydroxyphenylacetaldehyde has been knocked out.

[0013] Preferably, the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain is named benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1g N5-2, which is obtained by modifying the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1g N4: the potential dehydrogenase gene PAR4 from the substrate 4-hydroxyphenylacetaldehyde has been knocked out.

[0014] Preferably, the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain, named benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1g N6, is obtained by modifying the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1g N4: the potential dehydrogenase gene PAR4 from the substrate 4-hydroxyphenylacetaldehyde and the potential aldehyde reductase gene ADH2 from the substrate 4-hydroxyphenylacetaldehyde are knocked out.

[0015] Preferably, in the above-mentioned benzyl isoquinoline alkaloid-producing *Yersinia lipophila* strain, the nucleotide sequence of 4-hydroxyphenylpyruvate dioxygenase 4-HPPD is shown in SEQ ID NO. 14, the nucleotide sequence of catechol-O-methyltransferase COMT is shown in SEQ ID NO. 15, the nucleotide sequence of alcohol dehydrogenase ADH2 is shown in SEQ ID NO. 16, and the nucleotide sequence of dehydrogenase gene PAR4 is shown in SEQ ID NO. 17.

[0016] Preferably, the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain is named benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1g N7, which is obtained by modifying the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain Po1gN6: heterologous introduction of the 6'OMT gene from poppy, the CNMT gene from poppy, the N'-methylcorydaline 3'-hydroxylase gene from California poppy, the ATR1 cell p450 chaperone from Arabidopsis thaliana, and the 4'OMT gene from poppy.

[0017] Preferably, in the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain, the 4'-O-methyltransferase gene 4'OMT is a double copy of 4'OMT, which can effectively catalyze the production of (S)-serotonin.

[0018] Preferably, the above-mentioned benzyl isoquinoline alkaloid-producing *Yersinia lipolytica* strain is named benzyl isoquinoline alkaloid-producing *Yersinia lipolytica* strain Po1g N8, which is obtained by modifying the above-mentioned benzyl isoquinoline alkaloid-producing *Yersinia lipolytica* strain Po1gN6: heterologous introduction of the 6'OMT gene from poppy, the CNMT gene from poppy, the N'-methylcorydaline 3'-hydroxylase gene from California poppy, the ATR1 gene from Arabidopsis thaliana, and the 4'OMT gene from poppy, while replacing the original promoter of NMCH with Php4d and the original promoter of ATR1 with Ptdh.

[0019] Preferably, in the above-mentioned benzyl isoquinoline alkaloid-producing *Yersinia lipophila* strain, the 6-O-methyltransferase gene 6'OMT (derived from poppy) is... Papaver somniferum The nucleotide sequence of the linderine N-methyltransferase gene CNMT (source: poppy) is shown in SEQ ID NO.9 of the sequence listing. Papaver somniferum The nucleotide sequence of N-methylcorydaline 3'-hydroxylase gene NMCH (source: California poppy) is shown in SEQ ID NO. 10 of the sequence listing. Eschscholzia californica The nucleotide sequence of the cell p450 chaperone ATR1 (from Arabidopsis thaliana) is shown in SEQ ID NO.11 of the sequence listing. Arabidopsis thaliana The nucleotide sequence of the 4'-O-methyltransferase gene 4'OMT (source: poppy) is shown in SEQ ID NO.12. Papaver somniferum The nucleotide sequence of is shown in the sequence listing SEQ ID NO.13.

[0020] Application of the above-mentioned benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain in the fermentation production of (S)-norcodon and (S)-caryophylline.

[0021] Preferably, in the above application, (S)-norcodine is synthesized by shake-flask fermentation in YPD medium under aerobic conditions, according to the initial fermentation OD... 600 Yeast extracts Po1g N1-Po1g N6 were inoculated into YPD medium at an inoculum size of 0.1 g / L. The culture temperature was 30℃, the rotation speed was 220 rpm, and the culture time was 120 ± 5 h.

[0022] Samples were taken after 120 h of fermentation to detect the content of (S)-norcoguline. The (S)-norcoguline contents in the fermentation broths of strains Po1g N1-Po1g N6 (Po1g N1, Po1g N2, Po1g N3, Po1g N4, Po1g N5-1, Po1g N5-2 and Po1g N6) under shake-flask fermentation reached 111.3 μg / L, 155.1 μg / L, 465.9 μg / L, 1101.5 μg / L, 910 μg / L, 972.5 μg / L and 1193.9 μg / L, respectively.

[0023] Preferably, in the above application, (S)-Boscin is synthesized by shake-flask fermentation in YPD medium under aerobic conditions, according to the initial OD of fermentation. 600 Yeast extracts Po1g N7-Po1g N8 were inoculated into YPD medium at an inoculum size of 0.1 g / L. The culture temperature was 30℃, the rotation speed was 220 rpm, and the culture time was 120 ± 5 h.

[0024] Samples were taken after 120 h of fermentation to determine the content of (S)-horsenoside. The (S)-horsenoside content in the fermentation broth of strains Po1g N7 and Po1g N8 under shake-flask fermentation reached 1112.5 μg / L and 1332.5 μg / L, respectively.

[0025] Preferably, in the above application, the YPD culture medium is composed of: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, with the remainder being water, pH 5.7-5.8, sterilized at 115℃ for 20 min.

[0026] Preferably, in the above application, the pH during shake-flask fermentation is 4.

[0027] Dopamine is prone to spontaneous oxidation, and its instability causes the fermentation broth to gradually darken over time. Initially, dopamine reacts with oxygen to produce quinones and superoxide anions, which subsequently decompose into various reactive oxygen species (ROS). The quinone intermediates undergo intramolecular Michael addition (cyclization) to generate amino pigments. These amino pigments further polymerize to form dark neuromelanin polymers. Because *Yarrowia lipolytica* has a naturally high tolerance to acidic environments and a short fermentation cycle, the pH of the shake-flask fermentation was optimized to further reduce dopamine auto-oxidation. Fermentation tests were conducted on strain Po1g N8 at different pH gradients (pH=3, pH=4, pH=5, pH=6, pH=7). The final fermentation test results showed that the contents of (S)-caryophylline at pH=3, pH=4, pH=5, pH=6, and pH=7 were 1246.5 μg / L, 1528.5 μg / L, 890 μg / L, 825.9 μg / L, and 779.1 μg / L, respectively. Based on this, pH=4 was selected as the optimal pH value for the fermentation medium.

[0028] All of the above-mentioned culture media can be prepared using standard methods.

[0029] Beneficial effects: The aforementioned benzyl isoquinoline alkaloid-producing *Yersinia lipophila* strain was produced through heterologous expression of CYP76AD5, DODC, and NCS. 35, 6'OMT, CNMT, NMCH, 4'OMT, HPPD, COMT, ADH2, PAR4 genes are deleted, and ARO1, ARO2, and Aro4 are overexpressed. K221L Aro7 G139S The strain ultimately obtained from ARO10 has the potential to serve as a microbial cell factory for BIA production. It can de novo synthesize (S)-norcodine and (S)-caryophylline under aerobic conditions using YPD medium, and significantly improves their synthesis efficiency and yield. Specifically; (1) Through a series of overexpressions of the shikimic acid pathway and the removal of feedback inhibition, sufficient L-tyrosine was provided for the biosynthesis of alkaloids.

[0030] (2) By knocking out the HPPD gene, the production of important precursor substances of 4-HPAA is increased and the production of homogentisic acid (hypoxic acid) by the byproduct is reduced, providing sufficient 4-hydroxyphenylacetaldehyde (4-HPAA) for the production of (S)-norcodone.

[0031] (3) By knocking out the unique dopamine degradation gene COMT in Yersinia lipolytica, dopamine is further reduced during fermentation, providing more dopamine for the production of (S)-norcodone. Attached Figure Description

[0032] Figure 1 To establish a complete biosynthetic pathway for the production of (S)-norcodonine and (S)-caryophylline in Yersinia lipolytica.

[0033] Figure 2 The image shows the PCR validation diagram of the Po1g N1 strain genome. Lanes 1-8 represent Po1g N1 (DODC-CYP76AD5, NCS) and NCS, respectively. 35-ARO1, ARO10-ARO2, ARO4 K221L -ARO7 G139S ), where every two lanes are the same inverter.

[0034] Figure 3 Production diagram for Example 2 Figure 4 Construction of a recombinant plasmid containing two sgRNAs and homologous arms.

[0035] Figure 5 The PCR validation diagram for knocking out the COMT genome (high is the control group Po1g, low is the transformant after COMT knockout), with each pair of lanes representing one identical transformant.

[0036] Figure 6 Sequencing results for the knockout gene COMT.

[0037] Figure 7 The image shows the PCR verification diagram of the Po1g N6 strain gene. Lanes 1-6 are Po1g N4 (NMCH-ATR1, 6'OMT-4'OMT, CNMT-4'OMT), respectively.

[0038] Figure 8 The graph shows the yields of strains Po1g N1, Po1g N2, Po1g N3, Po1g N4, Po1g N5, and Po1g N6.

[0039] Figure 9 The graph shows the yields of strains Po1g N7 and Po1g N8.

[0040] Figure 10 The yield of strain Po1g N8 under different gradient pH conditions in shake flasks is shown in the figure. Detailed Implementation

[0041] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be further described in detail below with reference to specific embodiments.

[0042] The *Yersinia lipolyticis* Po1gΔku70 (genotype MATA,xpr2-332,leu2-270,ku70-,ura3-302:URA3,Axp-2) used in the examples is existing technology, and is a knockout of wild-type *Yersinia lipolyticis* Po1g W29. KU70 The gene was obtained, and its construction method is referenced in *Genetic engineering of an unconventional alyeast for renewable biofuel and biochemical production*. *Journal of Visualized Experiments*, 2016, 115, e54371. The wild-type *Yersinia lipophila* strain Po1g W29 was purchased from Yeastern Biotech Co.

[0043] The pYLEX1 plasmid used was purchased from Yeeastern Biotech Co., Ltd. The plasmid contains a leucine expression cassette for the auxotrophic selection gene, the marker gene Amp, the strong promoter hp4d, and the terminator XPR2 term.

[0044] The cristr-cas9 (hyg) plasmid used was purchased from Beijing Zhongyuan Biotechnology Co., Ltd., China. The plasmid contains the hygromycin expression cassette, the marker gene Amp, the strong promoter TEF, and the terminator TEFterminator.

[0045] The overexpression vectors pYLEX1 and pYLEX1(nat) involved are carrying selection markers. Among them, the expression vector pYLEX1(nat) is constructed by integrating the nourseothricin expression cassette on the expression vector pYLEX1.

[0046] The culture media involved are as follows: YPD solid culture medium formula: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, 20 g / L agar powder, with the remainder being water.

[0047] YNB solid screening medium formula: YNB (Yeast Nitrogen Base) 6.7 g / L, glucose 20 g / L, agar powder 20 g / L, balance water.

[0048] YPD-hyg solid culture medium formula: yeast extract 10g / L, peptone 20g / L, glucose 20g / L, hygromycin 0.6g / L, agar powder 20g / L, balance water.

[0049] YPD-nat solid culture medium formula: yeast extract 10g / L, peptone 20g / L, glucose 20g / L, norovirus 0.08g / L, agar powder 20g / L, balance water.

[0050] The nucleotide sequences of the genes used in the construction of the benzyl isoquinoline alkaloid-producing Yersinia lipophila strain Po1g N1-N5 are shown in the sequence listing SEQ ID NO.1-17.

[0051] Example 1 Constructing the (S)-norcodone synthesis pathway of benzyl isoquinoline alkaloid-producing *Yersinia lipophila* strain Po1gN1 1.1 Constructing the expression carrier 1.1.1 Construction of ARO4 and ARO7 point mutant plasmids to relieve feedback suppression (1) The 3-deoxy-D-arabino-heptanulonate-7-phosphate synthase gene Aro4 was introduced into the pYLEX1 plasmid to construct the recombinant plasmid pYLEX1-ARO4 containing the 3-deoxy-D-arabino-heptanulonate-7-phosphate synthase ARO4 gene. The 3-deoxy-D-arabino-heptanulonate-7-phosphate synthase ARO4 gene was obtained by polymerase chain reaction (PCR), and the construction of the recombinant plasmid can be carried out using common methods in this field. The method for constructing the recombinant plasmid pYLEX1-ARO7 is the same.

[0052] (2) Primer design: The mutation site was introduced by reverse PCR to construct the expression plasmid of 3-deoxy-D-arabino-heptanulose-7-phosphate synthase mutant. Using pYLEX1-ARO4 plasmid as a template, primers were designed using Primer Premier 5.0 (similar to branched acid dismutase Aro7). The primer sequences are shown in Table 1.

[0053] Table 1 Construction of mutant Aro4 K221L and Aro7 G139S Primers used

[0054] (3) Reverse PCR: The reaction system and reaction procedure for reverse PCR are shown in Table 2 and Table 3, respectively.

[0055] Table 2 Reaction system for reverse PCR

[0056] Table 3 Reverse PCR reaction procedure

[0057] The PCR product was digested with 0.25 μL of Dpn I to remove methylation, and then transformed. E. coli DH5α strain was cultured for 12-14 hours, and single colonies were picked. After overnight culture, plasmids were extracted and DNA sequencing was performed to verify whether the 221st lysine of 3-deoxy-D-arabino-heptanulose-7-phosphate synthase Aro4 was successfully replaced with leucine, and whether the 139th glycine of cladoid dismutase Aro7 was successfully replaced with serine. PCR and sequencing confirmed the successful acquisition of the mutant plasmid pYLAro4. K221L pYLAro7 G139S .

[0058] 1.1.2 Construction of expression vector for (S)-norcodonine synthesis pathway (1) Tyrosine hydroxylase CYP76AD5 from beetroot (GenBank accession number: KM592961); dopa decarboxylase DODC from *Pseudomonas putida* (GenBank accession number: AKH61506); (S)-norcodonine synthase NCS from *Coptis chinensis* (GenBank accession number: BAF45338.2). Codon optimization was performed based on the codon usage preference of *Yarrowia lipolytica*, followed by gene synthesis and integration into plasmid pYLEX1, resulting in plasmids pYLEX1-CYP76AD5, pYLEX1-DODC, and pYLEX1-NCS. 35.

[0059] (2) Based on the genome sequences of *Yersinia lipolytica* / *Saccharomyces cerevisiae* in GenBank (phenylpyruvate decarboxylase gene ARO1: SEQ ID NO.4, branched acid synthase gene ARO2: SEQ ID NO.5), and following commonly used methods in the field for constructing recombinant plasmids, recombinant plasmids pYLEX1-ARO1, pYLEX1-ARO2, and pYLEX1-ARO10 were constructed from the five-functional AROM polypeptide (YALI1_E20751g ARO1) from *Yersinia lipolytica*, the branched acid synthase (YALI1_D22237g ARO2), and the phenylpyruvate decarboxylase (S288C ARO10) from *Saccharomyces cerevisiae*.

[0060] (3) The plasmid pYLEX1-DODC was digested with EcoNi restriction enzyme and then purified. Primers EcoNi-F (SEQ ID NO.22): CTCCCTTATGCGACTCCTGCATTAGGAGGGCATCGGTCGACGCT and EcoNi-R (SEQ ID NO.23): ACTACTGGGCTGCTTCCTAAGATCGTCAAGGGTTTGTGGC were designed based on the EcoNi sequence of the integration site EcoNi in the expression vector pYLEX1-CYP76AD5. Using the expression vector pYLEX1-CYP76AD5 as a template, the EcoNi-F / EcoNi-R primers were used to amplify the PCR fragment carrying the corresponding terminal homologous sequence CYP76AD5 into the expression cassette assembly. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-DODC restriction fragment and the CYP76AD5 expression cassette assembly fragment were assembled using the Vazyme ClonExpress II One Step Cloning Kit to construct the pYLEX1-DODC-CYP76AD5 plasmid. An EcoNi site was reserved on the CYP76AD5 expression cassette in the integration fragment as the gene integration site for the next round of plasmid construction through primer design.

[0061] (4) The plasmid pYLEX1-DODC-CYP76AD5 was digested with EcoNi restriction enzyme and then purified. Primers were designed based on the EcoNi sequence of the integration site of the expression vector pYLEX1-DODC-CYP76AD5: EcoNi-2-F (SEQ ID NO.24): GCACTACCTGCGAAGGAGCTGACTGGGTTGAAGG, EcoNi-2-R (SEQ ID NO.25): ACGTCTTGCTGGCGTTCGGTACCCAGCCGGCCGGGA to express the vector pYLEX1-NCS Using 35 as a template, the EcoNi-2-F / EcoNi-2-R primers were used for PCR amplification to obtain NCSs carrying the corresponding terminal homologous sequences. 35 expression cassette assembly fragment. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min 30 s, 30 cycles, followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-DODC-CYP76AD5 restriction enzyme fragment NCS was digested using the Vazyme ClonExpress II One Step Cloning Kit. The 35-piece assembly fragment was assembled to complete the pYLEX1-DODC-CYP76AD5-NCS assembly. 35 plasmids.

[0062] (5) Plasmid pYLEX1-DODC-CYP76AD5-NCS 35 was digested with Nru I restriction enzyme and then purified. Based on the expression vector pYLEX1-DODC-CYP76AD5-NCS Primers for the Nru I sequence at integration site 35 were designed as follows: NruI-F (SEQ ID NO. 26): CCATCCAGCCTCGCGTCGCGATGTCCTACGAGTTGCATGATAAAGA, NruI-R (SEQ ID NO. 27): ACCCAGTCAGCTCCTTCGCAGGTAGTGCGGTATCGGCT. Using the expression vector pYLEX1-ARO1 as a template, PCR amplification with primers NruI-F and NruI-R yielded the ARO1 expression cassette assembly fragment carrying the corresponding terminal homologous sequences. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-DODC-CYP76AD5-NCS assembly was performed using the Vazyme ClonExpress II One Step Cloning Kit. The 35 enzyme digestion fragment and the ARO1 expression cassette assembly fragment were assembled to construct pYLEX1-DODC-CYP76AD5-NCS. The 35-ARO1 plasmid, through primer design, reserved the NruI site on the ARO1 expression cassette of the integration piece as the gene integration site for the next round of plasmid construction.

[0063] (6) Plasmid pYLEX1-DODC-CYP76AD5-NCS 35-ARO1 was digested with Nru I restriction enzyme and then purified. Based on the expression vector pYLEX1-DODC-CYP76AD5-NCS Primers for the Nru I sequence at the 35-ARO1 integration site were designed: NruI-F-2 (SEQ ID NO.28): GACAAGGTATAGGGCGGCGCCTCCTCGCCGAAAATGACCC, NruI-R-2 (SEQ ID NO.29): TTGGCATGGATTGTAGGCGGTAGTGCGGTATCGGCTAGGG. Using the expression vector pYLEX1-ARO10 as a template, PCR amplification with NruI-F-2 / NruI-R-2 primers yielded the ARO10 expression cassette assembly fragment carrying the corresponding terminal homologous sequences. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-DODC-CYP76AD5-NCS assembly was performed using the Vazyme ClonExpress II One Step Cloning Kit. The 35-ARO1 restriction fragment and the ARO10 expression cassette assembly fragment were assembled to construct pYLEX1-DODC-CYP76AD5-NCS. 35-ARO1-ARO10 plasmid.

[0064] (7) Plasmid pYLEX1-DODC-CYP76AD5-NCS 35-ARO1-ARO10 was digested with Nar I restriction enzyme and then purified. Based on the expression vector pYLEX1-DODC-CYP76AD5-NCS Primers were designed based on the Nar I sequence of the 35-ARO1-ARO10 integration site: NarI-F (SEQ ID NO.30): GACAAGGTATAGGGCGGCGCCGGTCCTCGCCGAAAATGAC, NarI-R (SEQ ID NO.31): TTGGCATGGATTGTAGGCGAAGAACAATCTTCTTGGAGTCAGTCTT. Using the expression vector pYLEX1-ARO2 as a template, PCR amplification with NarI-F / NarI-R primers yielded the ARO2 expression cassette assembly fragment carrying the corresponding terminal homologous sequences. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-DODC-CYP76AD5-NCS assembly was performed using the Vazyme ClonExpress II One Step Cloning Kit. The 35-ARO1-ARO10 restriction fragment and the ARO2 expression cassette assembly fragment were assembled to construct pYLEX1-DODC-CYP76AD5-NCS. 35-ARO1-ARO10-ARO2 plasmid.

[0065] (8) Plasmid pYLEX1-DODC-CYP76AD5-NCS 35-ARO1-ARO10-ARO2 was digested with FspAI restriction enzyme and then purified. Based on the expression vector pYLEX1-DODC-CYP76AD5-NCS 35-ARO1-ARO10-ARO2 sequence-integrated primers for FspAI: FspAI-F (SEQ ID NO.32): gacagcacgatcatgcgcacTGACGAAGGCTTGAGCGAGG FspAI-R (SEQ ID NO.33): gggtcctggccacgggtgcTGTGGAAGACTAAACCTCCGAAG Using the expression vector pYLEX1-ARO4 K221L PCR amplification using FspAI-F / FspAI-R primers yielded ARO4 carrying the corresponding terminal homologous sequence. K221L Expression cassette assembly fragment. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min 30 s, 30 cycles, followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-DODC-CYP76AD5-NCS expression cassette was assembled using the Vazyme ClonExpressII One Step Cloning Kit. 35-ARO1-ARO10-ARO2 restriction fragment ARO4 K221L The expression box assembly fragments were assembled to construct pYLEX1-DODC-CYP76AD5-NCS. 35-ARO1-ARO10-ARO2-ARO4 K221L The plasmid reserves the FspAI site on the ARO1 expression cassette of the integration fragment through primer design as the gene integration site for the next round of plasmid construction.

[0066] (9) Plasmid pYLEX1-DODC-CYP76AD5-NCS 35-ARO1-ARO10-ARO2-ARO4 K221L After digestion with FspA I restriction enzyme, the sample was recovered and purified. Based on the expression vector pYLEX1-DODC-CYP76AD5-NCS 35-ARO1-ARO10-ARO2-ARO4 K221L Primers designed to integrate the FspAI I sequence: FspAI-F-2 (SEQ ID NO.34): gacagcacgatcatgcgcacATGCCGGCGATAATGGCC FspAI-R-2 (SEQ ID NO.35): aatcttgcacgccctgtgcCACAAACTCGGTGCCGGA expressed using the vector pYLEX1-ARO7 G139S PCR amplification using primers FspAI-F-2 / FspAI-R-2 as template yielded ARO7 carrying the corresponding terminal homologous sequence. G139S Expression cassette assembly fragment. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. pYLEX1-DODC-CYP76AD5-NCS was assembled using the Vazyme ClonExpress II One Step Cloning Kit. 35-ARO1-ARO10-ARO2-ARO4 K221L Enzyme slices ARO7 G139S The expression box assembly fragments were assembled to construct pYLEX1-DODC-CYP76AD5-NCS. 35-ARO1-ARO10-ARO2-ARO4 K221L -ARO7 G139S Plasmid.

[0067] 1.2 The engineered strain Po1g N1 was constructed using the lithium acetate conversion method. The steps are as follows: (1) Preparation of Yersinia lipolyticis Po1gΔKU70 competent cells I. Using an inoculation loop, pick a single colony of *Yarrowia lipolytica* stored on a YPD agar plate and inoculate it into 50 mL of liquid YPD medium. Incubate at 30°C and 220 rpm on a shaker until OD500. 600 =15.

[0068] II. Centrifuge at 5000 rpm for 5 min at room temperature, collect the cells, rinse the cells twice with 10 mL of sterile water, suspend the cells in 5 mL of 0.1 mol / L lithium acetate (pH 6.0), and incubate at room temperature for 10 min.

[0069] III. Add sterile and cooled glycerol to competent cells to a final concentration of 25% (v / v), aliquot 100 μL into sterile 2 mL centrifuge tubes, perform yeast transformation, and store at -80°C.

[0070] (2) Linearized enzyme digestion plasmid pYLEX1-DODC-CYP76AD5-NCS 35. pYLEX1-DODC-CYP76AD5-NCS 35-ARO1-ARO10-ARO2-ARO4 K221L -ARO7 G139S The recombinant gene fragments were obtained and transformed, and recombinants were screened.

[0071] I. Gently mix 100 μL of competent cells, 500 ng to 1 μg of linearized recombinant plasmid, and 10 μL of salmon sperm DNA (10 mg / mL), and incubate at 30°C for 15 min.

[0072] II. Add 700 μL of 40% PEG 4000, mix well by pipetting and aspiration, and incubate at 30℃ and 220 rpm for 1 h.

[0073] III. Place the centrifuge tubes in a 39°C water bath for 1 hour.

[0074] IV. Add 1 mL of YPD medium, incubate at 30°C and 220 rpm for 2 h, centrifuge at 12000 rpm for 1 min at room temperature, discard the supernatant and resuspend the cells in 1 mL of sterile water.

[0075] V. Centrifuge at 12000 rpm for 1 min at room temperature, collect the bacterial cells, resuspend the bacterial cells in 100 μL of sterile water and spread them on YNB screening medium solid plates, and incubate at 30℃ for 2-3 days.

[0076] VI. Randomly select recombinants and perform PCR verification using the following primers: JP-CYPAD5-F (SEQ ID NO.36): ATCCGTAGTGCCAATCTCAG, JP-DODC-R (SEQ ID NO.37): AGGGGTCAAGTGCAGTAGTG, JP-ARO1-F (SEQ ID NO.38): CTCAATGACAAGTCCGAGGG, JP-NCS 35-R ​​(SEQ ID NO.39):TAGTAGGTCACGCCCAGGTC,JP-ARO2-F (SEQ ID NO.40):AGCCCTGTTTCGACAAGCTG,JP-ARO10-R (SEQ ID NO.41):CACACCATACCTATCAGTCA,JP-ARO7G-F (SEQ ID NO.42):TGGAGATCAGCCCGAGAACT,JP-ARO4K-R (SEQ ID NO.43):AACCAACGGGGAAAGACAGA). The obtained fragment size is 2800bp, such as Figure 2 The band size was consistent with the theoretical expectation, indicating that the target gene was successfully integrated into the Yersinia lipophila genome.

[0077] Sequencing further validated pYLEX1-DODC-CYP76AD5-NCS 35. pYLEX1-DODC-CYP76AD5-NCS 35-ARO1-ARO10-ARO2-ARO4 K221L -ARO7 G139S Whether the plasmid restriction fragments integrate into the genome. This will yield: ① fragments containing DODC-CYP76AD5-NCS. The benzyl isoquinoline alkaloid-producing strain of *Yersinia lipophila* with gene 35 was named Po1gNOR, and its genotype is Po1gΔKU70 DODC-CYP76AD5-NCS. 35; ② Including DODC, CYP76AD5, and NCS 35, ARO1, ARO10, ARO2, ARO4 K221L ARO7 G139S The benzyl isoquinoline alkaloid-producing strain of *Yersinia lipophila* was named Po1g N1, with the genotype Po1gΔKU70 DODC-CYP76AD5-NCS. 35-ARO1-ARO10-ARO2-ARO4 K221L -ARO7 G139S .

[0078] Example 2 Multiple copies of norcodonine synthase NCS 35. Enhanced (S)-norcodine production 2.1 Construction of single sgRNA knock-in cassette The single sgRNA knock-in gene sg-A3 sequence: atacgagatgagtgccaaag, using pre-designed primers sg-A3-F (SEQ ID NO.44): ccgggtcggcgcaggttgacatacgagatgagtgccaaaggttttagagctagaaatag, sg-A3-R (SEQ ID NO.45): gctatttctagctctaaaacctttggcactcatctcgtatgtcaacctgcgccgacccg, inserts sg-A3 into the pCRISPRyl plasmid using the restriction enzyme site AvrII, resulting in the pCRISPRyl-sg-A3-box single sgRNA expression cassette.

[0079] 2.2 Construction of single sgRNA and homologous arm recombinant plasmid After successfully constructing the single sgRNA plasmid, using the Po1g genome as a template, PCR amplification was performed using primers (A3-STYB-F (SEQ ID NO.46): TCTGTATCTCTTTATGTTGCGAGAACACTGGTGAAGTGC, A3-STYB-R (SEQ ID NO.47): AGGCTTCACTGGACATGCTCGCGAACAGCTTGTCACTTTG, A3-XTYB-F (SEQ ID NO.48): ACGCAAAGTGACAAGCTGTTCGCGAGCATGTCCAGTGAAGCC, A3-XTYB-R (SEQ ID NO.49): TAACGCCTCACAGTAGTTAAGAAGAGGAGGTTTCCAACGAA) to obtain the upper homologous arm and upper homologous arm fragment, respectively. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min 30 s, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. Simultaneously, the plasmid pCRISPRyl-sg-A3-box was prepared into a linearized vector by digesting the restriction endonuclease HpaI. The pCRISPRyl-sg-A3-box digest and the A3-STYB / A3-XTYB expression cassette assembly fragment were assembled using the Vazyme ClonExpress II One Step Cloning Kit to construct the pCRISPRyl-sg-A3-TYB plasmid. Furthermore, an NruI restriction site was retained in the middle of the homologous arms for subsequent NCS... Gene 35 is inserted between homologous cells.

[0080] 2.3 Construction of Knock-in Gene Tool Plasmids The plasmid pYLEX1-NCS was constructed according to the method in 1.1.2. 35-NCS 35 dual-gene plasmids. Using pYLEX1-NCS 35 and pYLEX1-NCS 35-NCS Using 35 as a template, PCR amplification was performed using primers (A3-F (SEQ ID NO.50): AAAGTGACAAGCTGTTCGCGACGACGCTCTCCCTTATGCG, A3-R (SEQ ID NO.51): CTTCACTGGACATGCTCGCGAACCCAGCCGGCCGGGAGT) to obtain NCS. 35 single-gene and dual-gene expression cassettes (containing promoter, target gene, and terminator). PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min 30 s, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. Simultaneously, the plasmid pCRISPRyl-sg-A3-TYB was prepared into a linearized vector by digesting the restriction endonuclease NruI. The pCRISPRyl-sg-A3-TYB fragment and NCS were digested using the Vazyme ClonExpress II One Step Cloning Kit. 35. NCS 35-NCS 35 expression box assembly fragments were assembled to construct pCRISPRyl-sg-A3-TYB-NCS. 35 and pCRISPRyl-sg-A3-TYB-NCS 35-NCS 35 plasmids.

[0081] 2.4 Transformation of yeast with recombinant plasmid containing single sgRNA knock-in gene Plasmids were extracted using the TIANprepmini Plasmid Kit; the experimental procedure is described in the instruction manual. pCRISPRyl-sg-A3-TYB-NCS 35 and pCRISPRyl-sg-A3-TYB-NCS 35-NCS 35 plasmids were extracted and concentrated to a final concentration of approximately 14 μg. Using the method described in section 1.2 for preparing competent *Yarrowia lipolytica* Po1gΔKU70 cells, the engineered strain Po1g N1 was prepared into competent cells. These cells were transformed into competent *Yarrowia lipolytica* Po1g N1 cells using lithium acetate transformation, plated on YPD-hyg plates, and incubated upside down at 30°C. After single colonies grew, recombinants were randomly selected and PCR verification was performed using the following primers (JYZ-A3-F (SEQ ID NO.52): ACATACTCCTCACCGGCTCA, JYZ-A3-R (SEQ ID NO.53): AACGAGACATCACAAGCAACT). The results showed that the successfully knocked-in transformants had a higher band than the target band. Sequencing further verified the NCS. 35 single gene expression cassettes and NCS All 35 dual-gene expression cassettes were successfully transferred into the Po1g N1 genome.

[0082] 2.5 Removal of free plasmid pCRISPRyl (1) Cultivating single colonies: Streak the correct purified bacterial culture on a regular YPD plate in three zones.

[0083] (2) Continuous subculturing: Pick a single colony and inoculate it into 5 mL of YPD medium. Incubate at 30℃ and 220 rpm for 12 h to complete one subculturing. Inoculate the bacterial solution from the first subculturing into 5 mL of YPD medium again at an inoculation rate of 1%. Incubate at 30℃ and 220 rpm for 12 h to complete the second generation. Repeat this process to complete 7 to 9 generations.

[0084] (3) Photocopying plates: Streak the last generation of bacterial culture on YPD plates. After single colonies grow, prepare hygromycin resistance plates and YPD plates. Draw corresponding squares on the two plates. First, spot the single colony on the resistance plate, and then spot the same colony on the YPD plate. Incubate at 30℃ for 16-24 hours.

[0085] (4) Removal verification: Select colonies that grow on YPD plates but do not grow on resistant plates (these colonies are likely to be successfully removed). Then streak these colonies on hygromycin plates and incubate them in a 30°C incubator. If they do not grow on hygromycin-resistant plates after incubation, it proves that the plasmid has been successfully removed.

[0086] Example 3 Knockout of byproducts of the (S)-norcodine synthesis pathway in Yersinia lipolytica 3.1 Construction of a single sgRNA knockout cassette The DNA sequence of catechol-O-methyltransferase COMT was found in NCBI (SEQ ID NO. 15). Using pre-designed primers COMT-sg1-F (SEQ ID NO. 54): CCGGGTCGGCGCAGGTTGACAAGTACGCTCTGATGACCGTGTTTTAGAGCTAGAAATAGC, COMT-sg1-R (SEQ ID NO. 55): GCTATTTTCTAGCTCTAAAACACGGTCATCAGAGCGTACTTGTCAACCTGCGCCGACCCGG, and COMT-sg2-F (SEQ ID NO. 56): CCGGGTCGGCGCAGGTTGACAGCGAGAGTGGTGAATCGGGGTTTTAGAGCTAGAAATAGC, COMT-sg2-R (SEQ ID NO. 15) was used. NO.57): GCTATTTCTAGCTCTAAAACCCCGATTCACCACTCTCGCTGTCAACCTGCGCCGACCCGG Two sgRNAs were inserted into the pCRISPRyl plasmid using the AvrII restriction site, resulting in two single sgRNA expression cassettes: pCRISPRyl-COMT-sg1-box and pCRISPRyl-COMT-sg2-box. sgRNA design was performed using the Chopchop website. Based on the website selection criteria, a set of screening requirements for *Yarrowia lipolytica* sgRNAs was established: low off-target rate, high overall score, high specificity, GC content not exceeding 60%, and sgRNA having only one target splicing site. For homologous arm design, lengths between 500 and 1000 bp showed higher knockout efficiency; therefore, upper and lower homologous arms of 1000 bp were selected.

[0087] Table 4 Reaction system for short fragment synthesis PCR

[0088] Table 5 Reaction procedures for short fragment synthesis PCR

[0089] 3.2 Construction of the dual sgRNA knockout cassette After successfully constructing two single sgRNA plasmids, the COMT-sg2 expression cassette was amplified by PCR using pCRISPRyl-COMT-sg2-box as a template and primers SG-KZ-F / R (SG-KZ-F (SEQ ID NO.58): CTGGTCGCTATACTGACTAGTAGGGGTTCCGC, SG-KZ-R (SEQ ID NO.59): ACACATTTCCGAGACGAAAGGGCCACTAGATCTAAGGTTCGTACTCAACACTCACG) to obtain the COMT-sg2 expression cassette. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. Simultaneously, the pCRISPRyl-COMT-sg1-box plasmid was digested with restriction endonuclease Spe I to prepare a linearized vector. The pCRISPRyl-COMT-sg1-box enzyme digestion fragment and the COMT-sg2 expression cassette assembly fragment were assembled using the Vazyme ClonExpress II One Step Cloning Kit to construct the pCRISPRyl-COMT-sg1-sg2-box plasmid.

[0090] 3.3 Construction of double sgRNA recombinant plasmid After successfully constructing the plasmid containing two sgRNAs, the upper homologous arm and upper homologous arm fragments were obtained by PCR amplification using the Po1g genome as a template and primers (SG34-COMT-STYB-F (SEQ ID NO.60): TCTGTATCTCTTTATGTTAACGTTGGGGAAACGTGCTCAAG, SG34-COMT-CH-R (SEQ ID NO.61): TGACATGTCACCGAGGTCGCGACGTCCTTTTTGTGCTGC, SG34-COMT-CH-F (SEQ ID NO.62): GCAGCACAAAAAGGACGTCGCGACCTCGGTGACATTGTCA, SG34-COMT-XTYB-R (SEQ ID NO.63): TAACGCCTCACAGTAGTTGCAATTTCACGATCGAGGAACC). PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min 30 s, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. Simultaneously, the plasmid pCRISPRyl-COMT-sg1-sg2-box was prepared into a linearized vector by digesting the restriction endonuclease HpaI. The pCRISPRyl-COMT-sg1-sg2-box digestion fragment and the COMT-STYB COMT-XTYB expression cassette assembly fragment were assembled using the Vazyme ClonExpressII One Step Cloning Kit to construct the pCRISPRyl-COMT-sg1-sg2-TYB plasmid. Figure 4 ).

[0091] 3.4 Transformation of yeast with recombinant plasmid containing double sgRNA and homologous arms Plasmids were extracted using the TIANprepmini Plasmid Kit, and the experimental procedure is described in the instruction manual. The pCRISPRyl-COMT-sg1-sg2-TYB plasmid was extracted and concentrated to approximately 14 μg. The engineered strain Po1g N3 was prepared into competent cells using the method described in section 1.2 for preparing competent Po1g ΔKU70 cells. The cells were transformed into competent Po1g N3 cells using lithium acetate conversion and plated on YPD-hyg plates, which were then inverted and incubated at 30°C. After single colonies grew, recombinants were randomly selected and PCR verification was performed using the following primers (JYZ-TYB-COMT-F (SEQ ID NO.64): TTCAGACTAGTGCTCGGTCA, JYZ-TYB-COMT-R (SEQ ID NO.65): GTAGAGGTCCTTCCAGTGGT). The results showed that the successfully knocked-out transformants had a lower band density than the target band, with a success rate as high as 95%. Figure 5 Further sequencing confirmed that the COMT gene in the genome of *Yarrowia lipophila* was deleted by 230 bp, indicating that the COMT gene knockout was successful. Figure 6 ).

[0092] 3.5 Removal of free plasmid pCRISPRyl Same as method 2.5.

[0093] 3.6 Construction of Po1g-N3, Po1g-N5-1, Po1g-N5-2, and Po1g-N6 knockout strains Similar to the methods described above, the difference lies in the sgRNA sequence. HPPD knockout gene: △HPPD-sgRNA-1 (SEQ ID NO. 66): GGCCTTTGAGGTCGACAATG, △HPPD-sgRNA-2 (SEQ ID NO. 67): CATTCGGGTGATGTAGAAGG. ADH2 knockout gene: △ADH2-sgRNA-1 (SEQ ID NO. 68): AAGACTGCCGCCATCCTCGC, △ADH2-sgRNA-2 (SEQ ID NO. 69): CGATGAAAACCTCGGCACCA. PAR4 knockout gene: △PAR4-sgRNA-1 (SEQ ID NO. 70): GACGTAGGCAGGGTTGACAG, △PAR4-sgRNA-2 (SEQ ID NO. 71): GAGAAGGTGCCTGAGCTCAA. The final fermentation yield results of engineered strains Po1g-N3, Po1g-N5-1, Po1g-N5-2, and Po1g-N6 are shown in the figure. Figure 8 .

[0094] Example 4 Construction of an engineered strain of (S)-caryophylline in Yersinia lipolytica po1g-N7 4.1 Construction of (S)-Boscisic acid pathway expression vector (1) 6-O-methyltransferase 6'OMT from poppy (GenBank accession number: AAQ01669.1); lindera alkaloid N-methyltransferase CNMT from poppy (GenBank accession number: AAP45316.1); N-methyllindera alkaloid 3'-hydroxylase NMCH from California poppy (GenBank accession number: AAC39452.1); cell p450 chaperone ATR1 from poppy (GenBank accession number: AAK96879.1); 4'-O-methyltransferase 4'OMT from poppy (GenBank accession number: AAP45314.1). Codon optimization was performed based on the codon usage preference of Yersinia lipophila, followed by gene synthesis and integration into plasmid pYLEX1, resulting in plasmids pYLEX1-6'OMT, pYLEX1-CNMT, pYLEX1-NMCH, pYLEX1-ATR1, and pYLEX1-4'OMT.

[0095] (2) The plasmid pYLEX1-NMCH was digested with SaiI restriction enzyme and then purified. Primers SaiI-F (SEQ ID NO.72): CTCTCCAAGGGCATCGGTCGACAGGAAGCAGCCCAGTAGTAGGTT and SaiI-R (SEQ ID NO.73): CGCATAAGGGAGAGCGTCGATGTGGCCAACTGGTAAATAAATGA were designed based on the sequence of the SaiI at the integration site of the expression vector pYLEX1-ATR1. Using the expression vector pYLEX1-ATR1 as a template, the assembly fragment of the ATR1 expression cassette carrying the corresponding terminal homologous sequence was amplified by PCR using the SaiI-F / SaiI-R primers. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-NMCH restriction fragment and the ATR1 expression cassette assembly fragment were assembled using the Vazyme ClonExpress II One Step Cloning Kit to construct the pYLEX1-NMCH-ATR1 plasmid.

[0096] (3) The plasmid pYLEX1-NMCH-ATR1 was digested with Nru I restriction enzyme and then purified. Primers NruI-1-F (SEQ ID NO.74): CCATCCAGCCTCGCGTCGCGAACCGGAAGGAGCTGACTGGG and NruI-1-R (SEQ ID NO.75): ACGTCTTGCTGGCGTTCGGTCGGAGGGGACATACGAGAT were designed based on the Nru I-6'OMT expression cassette assembly fragment carrying the corresponding terminal homologous sequence. Using the expression vector pYLEX1-6'OMT as a template, the NruI-1-F / NruI-1-R primers were used to amplify the NruI-1-F / NruI-1-R primers into the 6'OMT expression cassette assembly fragment. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min 30 s, 30 cycles, followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-NMCH-ATR1 restriction fragment and the 6'OMT expression cassette assembly fragment were assembled using the Vazyme ClonExpress II One Step Cloning Kit to construct the pYLEX1-NMCH-ATR1-6'OMT plasmid. The Nru I site on the 6'OMT expression cassette of the integration fragment was reserved as the gene integration site for the next round of plasmid construction through primer design.

[0097] (4) The plasmid pYLEX1-NMCH-ATR1-6'OMT was digested with Nru I restriction enzyme and then purified. Primers NruI-2-F (SEQ ID NO.76): CCATCCAGCCTCGCGTCGCGAACCTGTCCTACGAGTTGCATGAT and NruI-2-R (SEQ ID NO.77): TCAGCTCCTTCCGGTTCGACCTCCGAAGATTGTGACTCAGG were designed based on the Nru I sequence of the Nru I sequence of the integration site Nru I in the expression vector pYLEX1-4'OMT. Using the expression vector pYLEX1-4'OMT as a template, the NruI-2-F / NruI-2-R primers were used to amplify the 4'OMT expression cassette assembly fragment carrying the corresponding terminal homologous sequence by PCR. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-NMCH-ATR1-6'OMT restriction fragment and the 4'OMT expression cassette assembly fragment were assembled using the Vazyme ClonExpress II One Step Cloning Kit to construct the pYLEX1-NMCH-ATR1-6'OMT-4'OMT plasmid.

[0098] (5) The plasmid pYLEX1-NMCH-ATR1-6'OMT-4'OMT was digested with Nar I restriction enzyme and then purified. Primers NarI-1-F (SEQ ID NO.78): GACAAGGTATAGGGCGGCGCCTCCTCGCCGAAAATGACCC and NarI-1-R (SEQ ID NO.79): TTGGCATGGATTGTAGGCGGCCCGTGCTATGTGGAAGAC were designed based on the Nar I sequence of the integration site Nar I in the expression vector pYLEX1-CNMT. Using the expression vector pYLEX1-CNMT as a template, the NarI-1-F / NarI-1-R primers were used to amplify the CNMT expression cassette assembly fragment carrying the corresponding terminal homologous sequence by PCR. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min 30 s, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-NMCH-ATR1-6'OMT-4'OMT restriction enzyme fragment and the CNMT expression cassette assembly fragment were assembled using the Vazyme ClonExpress II One Step Cloning Kit to construct the pYLEX1-NMCH-ATR1-6'OMT-4'OMT-CNMT plasmid.

[0099] (6) The plasmid pYLEX1-NMCH-ATR1-6'OMT-4'OMT-CNMT was digested with Nar I restriction enzyme and then purified. Primers NarI-2-F (SEQ ID NO.80): GACAAGGTATAGGGCGGCGCCAGGCCGATCATCGTCGCG and NarI-2-R (SEQ ID NO.81): CATTTTCGGCGAGGAGGCGTGTGGAAGACTAAACCTCCGAAG were designed based on the NarI sequence of the integration site NarI in the expression vector pYLEX1-NMCH-ATR1-6'OMT-4'OMT-CNMT. Using the expression vector pYLEX1-4'OMT as a template, the NarI-2-F / NarI-2-R primers were used to amplify the 4'OMT expression cassette assembly fragment carrying the corresponding terminal homologous sequence by PCR. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-NMCH-ATR1-6'OMT-4'OMT-CNMT restriction enzyme fragment and the 4'OMT expression cassette assembly fragment were assembled using the Vazyme ClonExpress II One Step Cloning Kit to construct the pYLEX1-NMCH-ATR1-6'OMT-4'OMT-CNMT-4'OMT plasmid, achieving double-copy expression of 4'OMT.

[0100] (7) The plasmid pYLEX1-NMCH-ATR1-6'OMT-4'OMT-CNMT-4'OMT was digested with FspAI I restriction enzyme and then purified. Primers FspAI-1-F (SEQ ID NO.82): GACAGGAGCACGATCATGCGCACTGACGAAGGCTTGAGCGAGG and FspAI-1-R (SEQ ID NO.83): GGGTCCTGGCCACGGGTGCTTGGAGTCAGTCTTGGTCTTCTTAGT were designed based on the FspAI-1-F / FspAI-1-R primers with pYLEX1-nat as a template to amplify the nat expression cassette assembly fragment carrying the corresponding terminal homologous sequence. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, 30 cycles followed by 72℃ extension for 10 min, and storage at 4℃. The pYLEX1-NMCH-ATR1-6'OMT-4'OMT-CNMT-4'OMT restriction enzyme fragment and the nat expression cassette assembly fragment were assembled using the Vazyme ClonExpress II OneStep Cloning Kit to construct the pYLEX1-NMCH-ATR1-6'OMT-4'OMT-CNMT-4'OMT-nat plasmid.

[0101] 4.2 The engineered strain Po1g N7 was constructed using the lithium acetate conversion method. The steps are as follows: (1) Using the method for preparing competent cells of Yersinia lipophila Po1gΔKU70 in 1.2, the engineered strain Po1g N6 was prepared into competent cells.

[0102] (2) After linearizing the pYLEX1-NMCH-ATR1-6'OMT-4'OMT-CNMT-4'OMT-nat plasmid obtained in step 4.1, the plasmid was purified and recovered. It was then transformed into competent cells of the engineered strain Po1g N6 using the lithium acetate conversion method, spread on YPD-nat plates, and inverted in a 30℃ incubator.

[0103] (3) After single bacteria have grown, recombinants were randomly selected and PCR verification was performed using the following primers (JP-ATR1-F (SEQ ID NO.84): CACCACCATTGACATCCACC, JP-CYNMCH-R (SEQ ID NO.85): TCATTTCGGCAGATCCTCCC, JP-4OMT-F (SEQ ID NO.86): AGACCCTCATTGAAGATTGC, JP-6OMT-R (SEQ ID NO.87): ACACTCATTGGCAAGAGCAG, JP-CNMT-F (SEQ ID NO.88): TGTTCGGAGCCAATAAATTC, JP-4OMT-R (SEQ ID NO.89): GCAATCTTCAATGAGGGTCT, JP-FSPAI-F (SEQ ID NO.90): TATCGGTGATTCATTCTGCT, JP-FSPAI-R (SEQ ID NO.91): AGAACATATCCATCGCGTCC). The resulting fragment size was 2100bp. Figure 7 As shown, the band size is consistent with the theoretical expectation, indicating that the target gene has been successfully integrated into the *Yersinia lipolytica* genome. Sequencing further verified whether the pYLEX1-NMCH-ATR1-6'OMT-4'OMT-CNMT-4'OMT-nat plasmid digestion fragment was integrated into the genome. The *Yersinia lipolytica* strain producing the benzyl isoquinoline alkaloid *Yersinia lipolytica* with the gene *NMCH-ATR1-6'OMT-4'OMT-CNMT-4'OMT-nat* was named Po1gN7, with the genotype Po1gΔKU70 NMCH-ATR1-6'OMT-4'OMT-CNMT-4'OMT-nat.

[0104] Example 5 Promoter engineering optimizes NMCH and ATR1 expression to increase (S)-oxheart alkaloid yield. 5.1 Construction of expression vector Following the same method as in 4.1, pYLEX1-6'OMT-4'OMT-CNMT-4'OMT was first constructed. Subsequently, Php4d-NMCH, Php4d-ATR1, Ptdh-NMCH, Ptdh-ATR1, Ptin-NMCH, and Ptin-ATR1 were constructed using the promoter plasmids Php4d, Ptdh, and Ptin stored in the laboratory. Six plasmids were combined and constructed into pYLEX1-6'OMT-4'OMT-CNMT-4'OMT to obtain nine plasmids: pYLEX1-6'OMT-4'OMT-CNMT-4'OMT-(Php4d-NMCH-Php4d-ATR1, Php4d-NMCH-Ptdh-ATR1, Php4d-NMCH-Ptin-ATR1, Ptdh-NMCH-Php4d-ATR1, Ptdh-NMCH-Ptdh-ATR1, Ptdh-NMCH-Ptin-ATR1, Ptin-NMCH-Php4d-ATR1, Ptin-NMCH-Ptdh-ATR1, Ptin-NMCH-Ptin-ATR1, Ptin-NMCH-Php4d-ATR1, Ptin-NMCH-Ptdh-ATR1, Ptin-NMCH-Ptin-ATR1). The nat expression cassette was then constructed into these nine plasmids using the same method as in method 4.1.

[0105] 5.2 The engineered strain Po1g N8 was constructed using the lithium acetate conversion method. The steps are as follows: (1) Using the method for preparing competent cells of Yersinia lipophila Po1gΔKU70 in 1.2, the engineered strain Po1g N6 was prepared into competent cells.

[0106] (2) After linearizing the nine plasmids obtained in step 5.1, the plasmids were purified and recovered, and transformed into competent cells of the engineered strain Po1g N6 using the lithium acetate conversion method. The plasmids were then spread on YPD-nat plates and inverted in a 30°C incubator.

[0107] (3) After single bacteria have grown, recombinants are randomly selected and PCR verification is performed using the following primers (JP-ATR1-F (SEQ ID NO.92): CACCACCATTGACATCCACC, JP-CYNMCH-R (SEQ ID NO.93): TCATTTCGGCAGATCCTCCC, JP-4OMT-F (SEQ ID NO.94): AGACCCTCATTGAAGATTGC, JP-6OMT-R (SEQ ID NO.95): ACACTCATTGGCAAGAGCAG, JP-CNMT-F (SEQ ID NO.96): TGTTCGGAGCCAATAAATTC, JP-4OMT-R (SEQ ID NO.97): GCAATCTTTCAATGAGGGTCT, JP-FSPAI-F (SEQ ID NO.98): TATCGGTGATTCATTCTGCT, JP-FSPAI-R (SEQ ID NO.99): AGACATATCCATCGCGTCC). The obtained fragment size was 2100 bp, and the band size was consistent with the theoretical expectation, indicating that the target gene was successfully integrated into the Yersinia lipophila genome.

[0108] To identify suitable promoters for expressing NMCH and ATR1, NMCH and ATR1 were expressed under three different promoter strengths: Php4d, Ptdh, and Ptin. Ultimately, the highest yield of (S)-oxocarpine was achieved under the Ptdh-ATR1 and Php4d-NMCH promoters.

[0109] Example 6 Fermentation detection of (S)-caryophylline and (S)-norcodonine in benzyl isoquinoline alkaloid-producing strains of Yersinia lipolytica. The benzyl isoquinoline alkaloid-producing strains of Yersinia lipophila are Po1g NOR, Po1g N1, Po1g N2, Po1g N3, Po1g N4, and Po1g N5.

[0110] Yersinia lipolyticis Po1g N1, Po1g N2, Po1g N3, Po1g N4, Po1g N5, Po1g N6, Po1g N7, and Po1g N8, preserved in cryogenic glycerol tubes, were streaked onto YPD solid plates and incubated at 30°C for 30 h.

[0111] Colonies of Po1g N1, Po1g N2, Po1g N3, Po1g N4, Po1g N5, Po1g N6, Po1g N7, and Po1g N8 grown on YPD solid plates were inoculated into test tubes containing 5 mL of YPD liquid medium (20 g / L peptone, 10 g / L yeast extract, and 20 g / L glucose) and incubated at 30°C with shaking at 220 rpm for 15 h to activate the culture.

[0112] Seed culture of any strain from the activated benzyl isoquinoline alkaloid-producing *Yarrowia lipolytica* strains Po1g P1-Po1g P9 was inoculated into 50 mL of YPD medium at a 1% inoculation rate and cultured at 30°C and 220 rpm for 15 h. Then, 1 mL of the bacterial culture was transferred to another 50 mL of YPD medium and fermented at 30°C and 220 rpm for 120 h. 5 mM ascorbic acid was added before fermentation to prevent alkaloid oxidation during fermentation.

[0113] Samples were taken after 120 hours of fermentation, and the absorbance of the bacterial solution was measured at a wavelength of 600 nm. Specifically, 1 mL of the bacterial solution was centrifuged at 12000 rpm for 2 minutes. The supernatant was discarded, and the solution was resuspended in an equal volume of ddH2O, diluted to a suitable factor of 2, and then the absorbance was measured using a spectrophotometer.

[0114] Methods for determining the content of (S)-caine and (S)-norcodine: Metabolites were extracted from the culture medium containing cells and growth medium. 7 μL of culture medium was mixed with 27 μL of 100% acetonitrile (ACN). After shaking for 5 minutes at room temperature, 146 μL of 0.123% formic acid was added to obtain a final concentration of 15% ACN and 0.1% formic acid.

[0115] For the separation and analysis of the processed samples, 5 μL was injected into a 1290 Infinity II LC system (Agilent Technologies) equipped with a Zorbax Rapid Resolution HT C18 column (100 × 2.1 mm, 1.8 μm; Agilent Technologies). Separation of (S)-norcodone was performed using 0.1% formic acid as solvent A and acetonitrile-0.1% formic acid as solvent B at a flow rate of 0.3 mL / min: 0–0.1 min, 7% B; 0.1–5 min, 10–20% B; 5–5.5 min, 20–90% BB; 5.5–7 min, 90% BB; 7–7.01 min, 7% BB; followed by equilibration in 7% solvent B for 3 min. To separate (S)-caesarein, the following method was used: 0–0.1 min, 7% B; 0.1–5 min, 10–35% B; 5–5.5 min, 35–90% B; 5.5–7 min, 90% B; 7–7.01 min, 7% B; followed by equilibration for 3 min in 7% solvent B. The system was operated in electrospray ionization (ESI+) mode with a fragmenter voltage of 150 V. The (S)-(S)-norcodine precursor ion [M+H]+ was observed and separated at m / z 272.1. Quantification was performed by monitoring the fragmentation of the precursor ion at m / z 107.049 by LC-MS / MS, with an m / z of 272.1. The (S)-(S)-caesarein precursor ion [M+H]+ was observed and separated at m / z 330.1. Quantification was performed by monitoring the fragmented precursor ion at an m / z of 137.058 (m / z 330.1) using LC-MS / MS. The quantitative LC-MS / MS data were analyzed using an Agilent MassHunter, and the integrated LC-MS / MS peak areas were calculated.

[0116] The final engineered strains Po1g N1, Po1g N2, Po1g N3, Po1g N4, Po1g N5, and Po1g N6 were fermented for 120 h according to the method described in Example 6. After fermentation, the synthesis of norcodine was detected according to the detection method described in Example 6. The final (S)-norcodine contents in the fermentation broths of Po1g N1, Po1g N2, Po1g N3, Po1g N4, Po1g N5, and Po1g N6 reached 111.3 μg / L, 155.1 μg / L, 465.9 μg / L, 1101.5 μg / L, 910 μg / L, 972.5 μg / L, and 1193.9 μg / L, respectively (see Example 6). Figure 3 , Figure 8 ).

[0117] The final engineered strains Po1g N7 and Po1g N8 were fermented for 120 h according to Example 6. After fermentation, the synthesis of sinomenine was detected according to the detection method in Example 6. The final (S)-sinomenine contents in the fermentation broths of Po1g N7 and Po1g N8 reached 1112.5 μg / L and 1332.5 μg / L, respectively (see Example 6). Figure 9 ).

[0118] Fermentation conditions for Po1g N8 were optimized by selecting different pH gradients in shake flasks (pH=3, 4, 5, 6, 7) for fermentation testing. The final fermentation results showed that the contents of (S)-caryophylline at pH=3, 1528.5 μg / L, 890 μg / L, 825.9 μg / L, and 779.1 μg / L, respectively. Based on this, pH=4 was selected as the optimal pH for the fermentation medium (see...). Figure 10 ).

[0119] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention. Improvements and modifications such as strain modification based on the method of the present invention or based on the method are all considered to be within the scope of protection of the present invention.

Claims

1. A benzyl isoquinoline alkaloid-producing *Yersinia lipophila* strain, characterized in that: The strain was Yersinia lipolytica Po1gΔku70 and was modified to overexpress the phenylpyruvate decarboxylase gene ARO1 and the branching acid synthase gene ARO2; and to overexpress the 3-deoxy-D-arabino-heptanulose-7-phosphate synthase mutant Aro4. K221L and the cladistic acid dismutase mutant Aro7 G139S Overexpression of the codon-optimized phenylpyruvate decarboxylase gene ARO10 from *Saccharomyces cerevisiae*; heterologous introduction from beetroot. Beta vulgaris Tyrosine hydroxylase CYP76AD5 and Pseudomonas putida from Pseudomonas putida DODC (dopa decarboxylase gene); heterologously introduced from Coptis chinensis in Japan Coptis japonica (S)-norcodonine synthase gene NCS 35.

2. The benzyl isoquinoline alkaloid-producing *Yersinia lipophila* strain according to claim 1, characterized in that: The strain obtained by modifying the benzyl isoquinoline alkaloid-producing *Yersinia lipophila* strain according to claim 1 is: overexpressing one or two NCSs on the basis of Po1gN1.

35.

3. The benzyl isoquinoline alkaloid-producing *Yersinia lipophila* strain according to claim 2, characterized in that: The strain of *Yersinia lipophila* producing benzyl isoquinoline alkaloids as described in claim 2 was modified by knocking out the 4-hydroxyphenylpyruvate dioxygenase gene 4-HPPD.

4. The benzyl isoquinoline alkaloid-producing *Yersinia lipophila* strain according to claim 3, characterized in that: The strain of *Yersinia lipophila* producing benzyl isoquinoline alkaloids as described in claim 3 was modified by knocking out the catechol-O-methyltransferase gene COMT.

5. The *Yersinia lipophila* strain producing benzyl isoquinoline alkaloids according to claim 4, characterized in that: The strain obtained by modifying the benzyl isoquinoline alkaloid-producing Yersinia lipophila strain according to claim 4 is: the potential aldehyde reductase gene ADH2 from the substrate 4-hydroxyphenylacetaldehyde is knocked out; or the potential dehydrogenase gene PAR4 from the substrate 4-hydroxyphenylacetaldehyde is knocked out.

6. The *Yersinia lipophila* strain producing benzyl isoquinoline alkaloids according to claim 4, characterized in that: The strain obtained by modifying the benzyl isoquinoline alkaloid-producing Yersinia lipophila strain described in claim 4 was obtained by simultaneously knocking out the potential dehydrogenase gene PAR4 from the substrate 4-hydroxyphenylacetaldehyde and the potential aldehyde reductase gene ADH2 from the substrate 4-hydroxyphenylacetaldehyde.

7. The benzyl isoquinoline alkaloid-producing *Yersinia lipophila* strain according to claim 6, characterized in that: The strain of *Yersinia lipophila* producing benzyl isoquinoline alkaloids as described in claim 6 was modified by introducing heterologous 6'OMT 6-O-methyltransferase gene from poppy, CNMT linderaine N-methyltransferase gene from poppy, NMCH 3'-hydroxylase gene from California poppy, ATR1 cell p450 chaperone from Arabidopsis thaliana, and 4'OMT 4'OMT 4'OMT from poppy, wherein the 4'O-methyltransferase gene 4'OMT is a double copy.

8. The *Yersinia lipophila* strain producing benzyl isoquinoline alkaloids according to claim 6, characterized in that: The strain obtained by modifying the benzyl isoquinoline alkaloid-producing Yersinia lipolytica strain according to claim 6 is as follows: heterologous introduction of the 6'OMT gene from poppy, the CNMT gene from poppy, the N'-hydroxylase gene from California poppy, the N'-methylcorydaline 3'-hydroxylase gene from California poppy, the ATR1 cell p450 chaperone from Arabidopsis thaliana, and the 4'OMT gene from poppy, while replacing the original promoter of NMCH with Php4d and the original promoter of ATR1 with Ptdh.

9. The *Yersinia lipophila* strain producing benzyl isoquinoline alkaloids according to any one of claims 1-8, characterized in that: The nucleotide sequence of the tyrosine hydroxylase CYP76AD5 is shown in SEQ ID NO.1 of the sequence listing, the nucleotide sequence of the dopa decarboxylase gene DODC is shown in SEQ ID NO.2 of the sequence listing, and the (S)-norcodonine synthase gene NCS The nucleotide sequence of 35 is shown in SEQ ID NO.3 of the sequence listing; the nucleotide sequence of the phenylpyruvate decarboxylase gene ARO1 is shown in SEQ ID NO.4 of the sequence listing; the nucleotide sequence of the branched acid synthase gene ARO2 is shown in SEQ ID NO.5 of the sequence listing; and the 3-deoxy-D-arabino-heptanulose-7-phosphate synthase mutant Aro4 is shown. K221L The nucleotide sequence is shown in SEQ ID NO.6 of the sequence listing, the branched acid dismutase mutant Aro7. G139S The nucleotide sequences of the following gene are shown in SEQ ID NO.7: phenylpyruvate decarboxylase gene ARO10 from *Saccharomyces cerevisiae*, as shown in SEQ ID NO.8; 4-hydroxyphenylpyruvate dioxygenase 4-HPPD, as shown in SEQ ID NO.14; catechol-O-methyltransferase COMT, as shown in SEQ ID NO.15; alcohol dehydrogenase ADH2, as shown in SEQ ID NO.16; dehydrogenase gene PAR4, as shown in SEQ ID NO.17; 6-O-methyltransferase gene 6'OMT, as shown in SEQ ID NO.9; linalool N-methyltransferase gene CNMT, as shown in SEQ ID NO.10; N-methyllinalool 3'-hydroxylase gene NMCH, as shown in SEQ ID NO.11; and cell p450 chaperone ATR1, as shown in SEQ ID NO.

8. NO.12, The nucleotide sequence of the 4'-O-methyltransferase gene 4'OMT is shown in the sequence listing SEQ ID NO.

13.

10. The use of the benzyl isoquinoline alkaloid producing strain of Yersinia lipophila according to any one of claims 1-9 in the fermentation production of (S)-norcodonine and (S)-caryophylline.

Citation Information

Patent Citations

  • Engineering strain for producing (S)-higenamine, method and application

    CN120384011A

  • Biosynthesis of benzylisoquinoline alkaloids and benzylisoquinoline alkaloid precursors

    US20190338255A1