Composition for detecting respiratory tract infection pathogenic microorganisms, kit and application
By optimizing the composition of reverse transcription primers and linear amplification primers and using a high-throughput sequencing platform, the sensitivity and timeliness issues of pathogen detection in existing technologies have been resolved, enabling rapid, accurate, and low-cost detection of multiple respiratory pathogens, making it suitable as a first-line screening tool.
Patent Information
- Application Number
- CN202511698618.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-19
- Publication Date
- 2026-03-31
AI Technical Summary
Existing methods for detecting pathogenic microorganisms are inadequate in terms of sensitivity, specificity, timeliness, and coverage, making it difficult to meet clinical needs. In particular, isolation and culture methods are time-consuming, smear microscopy methods have low sensitivity, PCR technology has limited throughput, and metagenomic sequencing is costly and complex, making it difficult to detect respiratory pathogens quickly and accurately.
Optimized design of reverse transcription and linear amplification primers, combined with a high-throughput sequencing platform, was employed. The entire process, from sample processing, reverse transcription, linear amplification, adapter ligation, library construction, and sequencing, was optimized. This included reverse transcription primers with a length of 20–35 bases and an annealing temperature of 55–65°C, linear amplification primers with 3' end blocking and thiolation modifications, single-primer linear amplification using Apo-Enchanted DNA polymerase I, construction of sequencing libraries, and high-throughput sequencing.
It significantly shortens the detection time, improves the detection sensitivity to 10 copies/mL, can simultaneously detect 6 common bacteria and 4 RNA viruses, reduces costs, is easy to operate and the results are easy to interpret, making it suitable as a first-line screening tool and meeting the rapid diagnostic needs of acute respiratory infections.
Smart Images

Figure CN121759619A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of pathogen detection technology, specifically to a composition, kit, and application for detecting respiratory tract infection pathogens. Background Technology
[0002] Respiratory tract infections are a common type of clinical disease, caused by a wide variety of pathogens, including bacteria, viruses, fungi, and atypical pathogens. Rapid and accurate detection of pathogenic microorganisms is crucial for guiding clinical treatment and improving patient prognosis. However, existing pathogen detection methods have significant shortcomings in terms of sensitivity, specificity, timeliness, and coverage, making it difficult to meet clinical needs.
[0003] While isolation and culture is considered the "gold standard" for microbiological diagnosis, providing reliable pathogen identification and drug susceptibility testing results, its procedures are complex and time-consuming, typically requiring several days to complete. Furthermore, this method demands high sample quality and is susceptible to factors such as antibiotic pretreatment, limitations in fastidious bacteria growth conditions, and improper transportation and storage, leading to decreased sensitivity and increased false negative rates. Additionally, isolation and culture cannot directly detect drug resistance genes and cannot cover viruses and certain specific pathogens, further limiting its application.
[0004] Smear microscopy is a traditional method for pathogen screening, characterized by its simplicity and speed. However, its sensitivity is low, capable of detecting only high concentrations of pathogens and unable to distinguish between pathogens and colonizing bacteria. Because it relies on morphological characteristics for preliminary assessment, smear microscopy has poor specificity and is easily influenced by the operator's experience and skill level, potentially leading to misdiagnosis or missed diagnosis. Furthermore, this method is completely incapable of detecting cell wall-deficient microorganisms, obligate intracellular bacteria, and all viruses, making it unsuitable for handling complex respiratory infection scenarios.
[0005] PCR and its derivative technologies, such as digital PCR, have demonstrated high sensitivity and specificity in pathogen nucleic acid detection. However, their throughput is limited; traditional multiplex PCR detection typically covers only a dozen to several dozen common pathogens, and is prone to missed detections when faced with unknown or rare pathogens. Furthermore, PCR technology relies on pre-designed primers and probes, which introduces pre-design bias, making it difficult to detect emerging pathogens or those undergoing significant mutations. Although multiplex PCR technology has improved, as the number of targets increases, primer interference becomes increasingly prominent, leading to decreased sensitivity and more complex result interpretation.
[0006] Antigen-antibody testing methods indirectly determine infection status by detecting specific antigens of pathogens or specific antibodies produced by the body, but their sensitivity and specificity are both low. Antigen tests are easily affected by pathogen load, often resulting in false negatives in the early stages of infection; antibody tests have a "window period" problem, making them difficult to use for acute-phase diagnosis. Furthermore, antigen-antibody testing methods cannot provide quantitative information or drug resistance gene analysis, and their coverage is limited to known pathogens, making them insufficient for diagnosing complex infections.
[0007] Metagenomic next-generation sequencing (mNGS), as an unbiased exploratory technique, can theoretically overcome many limitations of the methods mentioned above, but its practical application still faces numerous challenges. First, mNGS is expensive; the costs of sequencing and data analysis make it difficult to widely adopt as a first-line screening tool. Second, the high content of host nucleic acids in respiratory samples (95%–99.9%) severely interferes with pathogen signal capture; deep sequencing is necessary to achieve sufficient detection sensitivity, further increasing costs. Furthermore, the mNGS testing process is complex, typically requiring 24–48 hours from sample processing to data analysis, which is insufficient for the rapid diagnosis of acute infections. More importantly, mNGS results are complex to interpret, requiring comprehensive judgment based on multiple indicators, and its detection capabilities for drug resistance and virulence genes are limited, making it difficult to accurately locate specific pathogens. Summary of the Invention
[0008] (a) Technical problems to be solved To address the shortcomings of existing technologies, this invention provides a composition, kit, and application for detecting respiratory tract infection pathogens, solving the problem of "complex and inefficient detection methods" in the aforementioned background technologies.
[0009] (II) Technical Solution To achieve the above objectives, the present invention provides the following technical solution: a composition for detecting respiratory tract infection pathogens, comprising reverse transcription primers and linear amplification primers, wherein: The reverse transcription primers are used for reverse transcription of RNA viruses. The design principle is that the primers are 20 to 35 bases in length and the annealing temperature is between 55 and 65°C.
[0010] Preferably, the linear amplification primers contain the common sequence "5'-GGCAGCGTCAGATGTGTATAAGAGACAG-3'" and have a 3' end blocking modification and a thio modification. The 3' end blocking modification can be any one or more of a phosphate group, a biotin group, a C6 spacer group, or an NH2-C6 group to prevent nonspecific ligation and reduce background signal. The thio modification is located near the 3' end to reduce the occurrence of nonspecific amplification.
[0011] Preferably, the technical solution of the present invention includes the following steps: S1: Sample Processing: Nucleic acids, including DNA and RNA, are extracted from respiratory samples. Nucleic acids are fragmented using ultrasound to ensure efficient subsequent amplification.
[0012] S2: Double-stranded cDNA generation: For RNA virus nucleic acids, double-stranded cDNA is generated using gene-specific reverse transcription primers under the action of specific reverse transcriptases, and then purified using nucleic acid purification reagents.
[0013] S3: Single-primer linear amplification: Linear amplification of the target pathogen nucleic acid is performed using a specific single-primer combination with Apo-Enchanted DNA polymerase I. The linear amplification reaction conditions have been optimized to improve amplification efficiency and specificity.
[0014] S4: Adapter ligation: The amplification product is ligated to the adapter sequence containing the sample tag to form a single-stranded library molecule.
[0015] S5: Library construction: Perform PCR amplification on the adapter ligation products to construct sequencing libraries.
[0016] S6: Sequencing: Sequencing the library using a high-throughput sequencing platform to generate sequencing data. The sequencing platform can be Illumina Novaseq 6000 or other compatible platforms.
[0017] S7: Data Analysis: Based on the alignment of sequencing data with the pathogen reference genome, the number of specific reads is counted, and the number of pathogen reads per million sequencing data (PRPM) is calculated to ultimately determine the types of pathogens present in the sample.
[0018] (III) Beneficial Effects This invention provides a composition, kit, and application for detecting respiratory tract infection pathogens. It offers the following advantages: (1) This invention significantly shortens the detection time by optimizing the entire process from sample processing, reverse transcription, linear amplification, adapter ligation, library construction to sequencing. Compared with isolation culture and metagenomic sequencing, this method can efficiently complete the detection from sample to pathogen type identification, effectively solving the problem of poor timeliness of existing methods, providing rapid support for clinical treatment decisions for patients with acute respiratory infections, and helping to improve patient prognosis.
[0019] (2) The reverse transcription primers and linear amplification primers of the present invention have been screened and optimized, and the linear amplification reaction conditions have been optimized. Combined with a high-throughput sequencing platform, the detection sensitivity reaches 10 copies / mL, which is significantly better than the smear microscopy method and the antigen-antibody detection method. In addition, this scheme can detect 6 common bacteria and 4 RNA viruses at the same time. Through specific primer design and sequencing data analysis, non-specific amplification and background interference are avoided, which solves the problems of limited throughput of PCR technology and large interference of host nucleic acid in metagenomic sequencing. At the same time, it overcomes the defects of isolation culture method inability to detect viruses and poor specificity of smear microscopy method, and realizes accurate detection of a variety of common respiratory pathogens.
[0020] (3) This invention avoids the high cost problem caused by the need for deep sequencing in metagenomic sequencing by using single primer linear amplification and optimized library construction, thus reducing the economic threshold for detection. At the same time, the entire process is clearly defined and does not require a complicated result interpretation process. Compared with metagenomic sequencing and isolation culture methods, this method is simpler to operate, easier to interpret results, and has a lower detection cost. It solves the problem that existing detection methods are difficult to popularize as first-line screening tools, making it easier to promote and apply in clinical practice and providing reliable pathogen detection services for a large number of patients with respiratory infections. Attached Figure Description Figure 1 This is a schematic diagram showing the relationship between the DNA copy number and the number of sequencing reads in Staphylococcus aureus. Figure 2 A schematic diagram showing the relationship between the DNA copy number and the number of sequencing reads of Streptococcus pneumoniae; Figure 3 A schematic diagram showing the relationship between the DNA copy number and the number of sequencing reads of Klebsiella pneumoniae; Figure 4 A schematic diagram showing the relationship between Acinetobacter baumannii DNA copy number and sequencing read count; Figure 5 A schematic diagram showing the relationship between the DNA copy number and the number of sequencing reads in Pseudomonas aeruginosa; Figure 6 A schematic diagram showing the relationship between the number of Haemophilus influenzae DNA copies and the number of sequencing reads; Figure 7 A schematic diagram showing the relationship between SARS-CoV-2 RNA copy number and sequencing read count; Figure 8 This is a schematic diagram showing the relationship between rhinovirus A RNA copy number and sequencing read count. Figure 9 A schematic diagram showing the relationship between human metapneumovirus RNA copy number and sequencing read count; Figure 10 A schematic diagram showing the relationship between the number of RNA copies of human coronavirus NL63 and the number of sequencing reads; Figure 11This is a schematic diagram comparing the detection of multiple pathogen infections using the OPERA®-tNGS method, culture method, and PCR multiplex detection method. Detailed Implementation
[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0022] Please see Figure 1 - Figure 11 The present invention provides a composition for detecting respiratory tract infection pathogens, comprising reverse transcription primers and linear amplification primers, wherein the reverse transcription primers are used for reverse transcription of RNA viruses, and are designed to be 20-35 bases in length, with an annealing temperature between 55-65°C, and sequences with high homology to the human genome are removed. Furthermore, the linear amplification primers contain the common sequence 5'-GGCAGCGTCAGATGTGTATAAGAGACAG-3', and have a 3' end blocking modification and a thio modification. The 3' end blocking modification can be any one or more of a phosphate group, a biotin group, a C6 spacer group, or an NH2-C6 group to prevent non-specific ligation and reduce background signal. The thio modification is located near the 3' end to reduce the occurrence of non-specific amplification.
[0023] This invention applies to the detection of 10 common respiratory pathogens, including six bacteria: Acinetobacter baumannii, Haemophilus influenzae, Pseudomonas aeruginosa, Klebsiella pneumoniae, Staphylococcus aureus, and Streptococcus pneumoniae; and four RNA viruses: novel coronavirus, rhinovirus A, human metapneumovirus, and human coronavirus NL63. The detection process includes optimized nucleic acid extraction, reverse transcription, linear amplification, adapter ligation, library construction, and sequencing analysis. Specifically: Step 1: Sample processing. First, nucleic acids, including DNA and RNA, are extracted from respiratory samples. The sample type can be sputum or bronchoalveolar lavage fluid. The extracted nucleic acids need to be fragmented by ultrasound to ensure the efficiency of subsequent amplification. The purpose of ultrasound fragmentation is to break the nucleic acids into a length range suitable for amplification, usually 100-500 bp. This process is completed by an ultrasound machine. The parameter settings can be adjusted according to the specific equipment, but the consistency of the fragmentation effect must be ensured. The fragmented nucleic acids can be used for subsequent reverse transcription and linear amplification steps.
[0024] Step 2: For RNA virus nucleic acids, gene-specific reverse transcription primers are used to generate double-stranded cDNA. These reverse transcription primers are designed to be between 20 and 35 bases in length, with an annealing temperature set between 55 and 65°C. Sequences with high homology to the human genome must be avoided. The reverse transcription reaction is carried out under the action of a specific reverse transcriptase. The reaction system includes an RNA template, reverse transcription primers, a dNTP mixture, a buffer, and reverse transcriptase. The reaction procedure includes incubation at 65°C for 10 minutes, incubation at 4°C for 5 minutes, and then incubation at 50°C for 30 minutes. The generated double-stranded cDNA is purified using nucleic acid purification reagents, and unreacted primers and other impurities are removed using magnetic beads.
[0025] Step 3: Single-primer linear amplification: A specific single-primer combination is used to amplify the target pathogen's nucleic acid. These primers contain the common sequence 5'-GGCAGCGTCAGATGTGTATAAGAGACAG-3', with blocking and thiomodification at the 3' end. The blocking modification can be any one or more of phosphate groups, biotin groups, C6 spacer groups, or NH2-C6 groups to prevent non-specific ligation and reduce background signal. The thiomodification is located near the 3' end to reduce non-specific amplification. The linear amplification reaction is carried out by Apo-Enchanted DNA polymerase I, which has primer activation function. Under optimized conditions, it can remove primer end modifications and activate the primer, thereby initiating linear amplification. The amplification conditions are optimized, including adjustments to the annealing temperature and cycle number, to improve amplification efficiency and specificity. The amplification product is purified using SA magnetic beads to remove unbound primers and other impurities.
[0026] Step 4: Adapter ligation. The purified amplification product is ligated with the adapter sequence containing the sample tag to form a single-stranded library molecule. The adapter sequence contains IndexAdapter NP701 to NP724. The ligation reaction is carried out by ssDNA ligase. The reaction conditions include incubation at 60°C for 60 minutes, followed by heating at 90°C for 3 minutes to terminate the reaction.
[0027] Step 5: Library Construction. The adapter ligation products are subjected to PCR amplification to construct a sequencing library. Pre-PCR amplification uses OPERA® library amplification reagent and pre-amplification tag primers. Amplification conditions include 95°C pre-denaturation for 3 minutes, followed by a 12-cycle amplification program, each cycle consisting of 95°C denaturation for 10 seconds, 60°C annealing for 30 seconds, and 72°C extension for 30 seconds, with a final extension at 72°C for 2 minutes to complete amplification. The amplified products are purified using NA magnetic beads to remove unamplified DNA fragments and other impurities. The library is then subjected to another PCR reaction using OPERA® library amplification reagent and universal amplification primers. Amplification conditions include 95°C pre-denaturation for 3 minutes, followed by a 23-cycle amplification program, each cycle consisting of 95°C denaturation for 10 seconds, 70°C annealing for 10 seconds, and 70°C extension for 30 seconds, with a final extension at 72°C for 2 minutes to complete amplification. After amplification, further purification is performed using magnetic beads to remove unligated adapters and other impurities.
[0028] Step Six: Perform sequencing. Specifically, use a high-throughput sequencing platform to sequence the libraries and generate sequencing data. In this example, the Illumina Novaseq 6000 sequencer is used, along with PE150 sequencing reagents and chips. Approximately 1M of data is allocated to each library.
[0029] Step 7: After sequencing is completed, the generated data undergoes quality control and data analysis. The data analysis process includes comparing the sequencing data with the pathogen reference genome, counting the number of specific reads, and calculating the pathogen reads per million sequencing data (PRPM). Finally, the types of pathogens present in the sample are determined based on the PRPM value.
[0030] Furthermore, the kit in this invention is configured as a genomic DNA extraction kit.
[0031] To verify the technical effects of this invention, several experiments were conducted, specifically: Example 1: By screening different reverse transcription primers, linear amplification primers, and primer concentrations, their specific reads / M (the number of specific reads detected per M of data) was compared. The 2-3 primers with the highest values and their corresponding working concentrations were selected for subsequent experiments. See Tables 1, 2, and 3 below for details: Table 1: Primer Screening Results Table 2: Comparison Results of Specific Gene Primer Sequence Screening Table 3: Comparison Results of Specific Gene Primer Concentration Screening The results showed that the detection ability of the screened primers was improved by 148% to 214% compared with that before screening, with an average improvement of 171%; while the detection ability of the primers after concentration screening was improved by 219% to 294% compared with that before screening, with an average improvement of 245%. This fully demonstrates the importance of optimizing primer design and concentration.
[0032] Example 2: In this example, multiple pathogen reference samples were prepared, including Haemophilus influenzae, Staphylococcus aureus, Streptococcus pneumoniae, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, novel coronavirus, rhinovirus A, human metapneumovirus, and human coronavirus NL63. Three gradients were set up: 10, 100, and 1000 copies / test. Each test was repeated 3 times, as shown in Tables 4, 5, and 6 below: Table 4: Reference Group Settings Table 5: Sensitivity Analysis Results of Bacterial Reference Samples Table 6: Sensitivity Analysis Results of RNAome Reference Standards Experimental results show that the detection sensitivity of this invention reaches 10 copies / mL, exhibiting extremely high detection sensitivity. Furthermore, through the addition of... Figure 1 To be continued Figure 10 The results of 10 pathogen detections were presented in RPM (number of specific reads detected per megabyte of data), which intuitively reflects the detection performance.
[0033] Example 3: In this example, 96 qualified sputum samples and 10 bronchoalveolar lavage fluid samples were collected, totaling 106 clinical samples, to evaluate the performance of the present invention in practical application scenarios, as shown in Tables 7 and 8 below: Table 7: Comparison of Consistency between Culture Method Detection Results and OPERA-tNGS Detection Results Table 8: Comparative Analysis of Bacterial Detection between OPERA®-tNGS and Culture Methods The experimental results showed that the culture method detected 57 pathogenic bacteria, while the OPERA®-tNGS method detected 120 pathogenic bacteria. Furthermore, the PCR multiplex detection method detected 2 positive RNA virus samples, while the OPERA®-tNGS method detected 42 positive RNA virus samples. Additionally, through the attachment... Figure 11 The study compared the OPERA®-tNGS method with culture and PCR multiplex detection methods in the detection of multiple pathogen infections. The results showed that the median number of pathogens detected by the OPERA®-tNGS method was 2, which was significantly higher than that of traditional methods.
[0034] Table 9 also includes a list of reverse transcription primers: Table 9: List of Reverse Transcription Primers Furthermore, Table 10 includes the linear amplification primer sequences: Table 10: Linear Amplification Primer Sequences Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
Claims
1. A composition for detecting respiratory tract infection pathogens, characterized in that, The reverse transcription primer and the linear amplification primer, wherein the reverse transcription primer is used for nucleic acid reverse transcription of the RNA virus, the length of the reverse transcription primer is 20-35 bases, and the annealing temperature is 55-65℃; The linear amplification primer comprises a common sequence 5'-GGCAGCGTCAGATGTGTATAAGAGACAG-3', and has 3' end blocking modification and thio modification, the 3' end blocking modification is selected from any one or more of a phosphate group, a biotin group, a C6 Spacer group or an NH2-C6 group, and the thio modification is near the 3' end.
2. The composition for detecting a pathogenic microorganism of respiratory infection according to claim 1, characterized in that: The detection is applied to 10 respiratory tract infection pathogens, including Acinetobacter baumannii, Haemophilus influenzae, Pseudomonas aeruginosa, Klebsiella pneumoniae, Staphylococcus aureus, Streptococcus pneumoniae, and four RNA viruses of novel coronavirus, rhinovirus A, human metapneumovirus and human coronavirus NL63.
3. The composition for detecting pathogenic microorganisms of respiratory infection according to claim 1, characterized in that: The reverse transcription primer is selected from one of the following sequences or a combination thereof: GTAAGACGGGCTGCACTTACACCGCA, ACCAGACATTTTGCTCTCAAGCTTG, CGGAGGAAGCACACTGAGCACACG, GCTAGATCCATTGCTCACTGAATTTTG, CTGTCATCACTAGGTCTTTTATTATC, AACAAATAGACTTTCTGCTTTGCTGC, GACTTGTCTTTGTTCTGCTTGCGCTTG, GGCAATTGCAACACCTGCTGTAACTGC, GGCAAATCAACACGTTGCCCCCTG, GGATTAAAAGCCCAAAAAGTTTTAACAC, TAGACATTTAGTACTTCAGCTGGAAC.
4. The composition for detecting a pathogenic microorganism of respiratory infection according to claim 1, characterized by: The linear amplification primer is selected from one of the following sequences or a combination thereof: GGCAGCGTCAGATGTGTATAAGAGACAGCAAGCCGTACGTATTATTAGGTGCTGGTCACT, GGCA GCGTCAGATGTGTATAAGAGACAGATCTGTCACTATACTTCGGTGGAACAAGGTTGT, GGCA GCGTCAGATGTGTATAAGAGACAGCTGGGTATTGGCTGAGCTGCAAAAAACTCT, GGCA GCGTCAGATGTGTATAAGAGACAGGGCATTCCAAGGCAGCTTAACAGGGATGT, GGCA GCGTCAGATGTGTATAAGAGACAGCACCTCAGTTAAGCCTATTACTCGCATTTATGATCT, GGCA GCGTCAGATGTGTATAAGAGACAGCTGTGTAGATGATGGTTCAGTAGATGACTCAGCT, GGCA GCGTCAGATGTGTATAAGAGACAGTCAACCTGTCGCGCTACTACATGCGTCCT, GGCA GCGTCAGATGTGTATAAGAGACAGTTACAGCGGCACAGCCTGTTCGTCGT, GGCA GCGTCAGATGTGTATAAGAGACAGCGTCGACCCGAACGCAGGCTATGGCT, GGCA GCGTCAGATGTGTATAAGAGACAGCAACGGCGTGCGCTTTGAGAACCTGCT, GGCA GCGTCAGATGTGTATAAGAGACAGCTGGCTTATACCGATAGAGAACTCGAACTGCTT, GGCA GCGTCAGATGTGTATAAGAGACAGCGTTCCTCAGAAAACACCGAGAGCCGT, GGCA GCGTCAGATGTGTATAAGAGACAGCGGTGATAAATTGCCAAGCGTGACGCAATTT, GGCA GCGTCAGATGTGTATAAGAGACAGGCGAAGACGTTAAACTATCGATTAGCTAGTGAAGAT, GGCA GCGTCAGATGTGTATAAGAGACAGCGCAAGTAGGTGCGATTTCAGCAGCAGATGT, GGCA GCGTCAGATGTGTATAAGAGACAGCATCAGATTTAAACGCTTTAGCTATGGGTGATGAAATGT,GGCAGCGTCAGATGTGTATAAGAGACAGGGTAGCCTTGGAGCAGCTACATTATCTTCTATATCT, GGCAGCGTCAGATGTGTATAAGAGACAGCGATTGTGCATCAGCTGACTGAAGCATGGT, GGCAGCGTCAGATGTGTATAAGAGACAGCAATCTGTCAAGCAGCAGCAAAGCAAGAGCT, GGCAGCGTCAGATGTGTATAAGAGACAGCGCGGCTCTTCACACCTTGTCAATAATTAGGT, GGCAGCGTCAGATGTGTATAAGAGACAGGTGTGGAGTGTGTCCCAACATTTTGTCTAGT, GGCAGCGTCAGATGTGTATAAGAGACAGCACTAGATGTCCGTGATGGTACTACTTCTCTACCTT, GGCAGCGTCAGATGTGTATAAGAGACAGCCTGTAGATGATGAGCCTAATGCTTTGCCATACTCT, GGCAGCGTCAGATGTGTATAAGAGACAGTGGTGGTGTTGTGTGTGTGTCGACGAAGGT, GGCAGCGTCAGATGTGTATAAGAGACAGGCTGCAGTTGCAACACCGAGTGCTATTGCTCCTT, GGCAGCGTCAGATGTGTATAAGAGACAGCGCATACGCCAACGCTCTTGAACATTCCAATAACCT, GGCAGCGTCAGATGTGTATAAGAGACAGACACGGCGCCAAAGTCTGAAACTATTAACAAAATACT, GGCAGCGTCAGATGTGTATAAGAGACAGCAGGTGCTATTTGCATATAATCTTGGTAAGCAAGAT., 5. The composition for detecting a pathogenic microorganism of respiratory infection according to claim 4, wherein: The concentration of the linear amplification primer is 25-150nM.
6. The method for detecting the pathogenic microorganism of respiratory infection according to any one of claims 1-5, characterized in that, The method comprises the following steps: S1: sample processing: extracting nucleic acids, including DNA and RNA, in a respiratory sample, using ultrasonic fragmentation to process the nucleic acids to ensure subsequent amplification efficiency; S2: double-stranded cDNA generation: generating double-stranded cDNA from RNA virus nucleic acids using gene-specific reverse transcription primers under the action of a specific reverse transcriptase, and purifying by a nucleic acid purification reagent; S3: single primer linear amplification: using a specific single primer combination to linearly amplify target pathogen nucleic acids under the action of Apo-Enchanted DNA Polymerase I, and the linear amplification reaction conditions are optimized to improve amplification efficiency and specificity; S4: linker ligation: ligating the amplification product with a linker sequence containing a sample tag to form a single-stranded library molecule; S5: library construction: PCR amplifying the linker ligation product to construct a sequencing library; S6: Sequencing: The library is sequenced using high-throughput sequencing platform, which can be Illumina Novaseq6000 or other compatible platforms, to generate sequencing data; S7: Data analysis: According to the alignment of sequencing data and pathogen reference genome, the number of specific reads is counted, and the number of pathogen reads per million sequencing data (PRPM) is calculated to finally determine the types of pathogens present in the sample.
7. The method of claim 6, wherein the method is for detecting a pathogenic microorganism of respiratory infection. The respiratory tract sample is sputum or alveolar lavage fluid, and the ultrasonic fragmentation treatment breaks the nucleic acid to the length range of 100-500 bp.
8. The method of claim 6, wherein the method is for detecting a pathogenic microorganism of respiratory infection. The reverse transcription reaction is incubated at 65°C for 10 minutes, 4°C for 5 minutes, and then 50°C for 30 minutes, and purified using a magnetic bead method, and the linear amplification reaction is performed using Apo-Enchanted DNA polymerase I, and purified using a SA magnetic bead.
9. The method of claim 6, wherein the method is for detecting a pathogenic microorganism of respiratory infection. The linker connection uses ssDNA ligase to incubate at 60°C for 60 minutes, and then heated at 90°C for 3 minutes to terminate the reaction; the PCR amplification uses library amplification reagents and pre-library tag primers, and performs 12 cycles of amplification program, and then performs 23 cycles of PCR amplification, and the final library is obtained by magnetic bead purification; the high-throughput sequencing uses Illumina NovaSeq 6000 sequencer, adopts PE150 sequencing reagent, and the data analysis includes alignment with pathogen reference genome, and calculation of the number of pathogen reads per million sequencing data (PRPM).
10. A kit for detecting a pathogenic microorganism of respiratory infection, characterized by, The composition of claim 1 is included, and a genomic DNA extraction kit. The composition of claim 1 is included, and a genomic DNA extraction kit.