IKBKG gene mutation detection probe set and kit for liquid phase hybridization capture of Pacbio sequencing platform
By utilizing the liquid-phase hybridization capture technology of the PacBio sequencing platform, combined with specific probe sets and Tn5 transposase, efficient and low-cost detection of the IKBKG gene has been achieved. This solves the problems of limited detection types and pseudogene interference in existing technologies, making it suitable for large-scale clinical screening.
Patent Information
- Application Number
- CN202512036926.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-04-03
AI Technical Summary
Existing technologies are difficult to use efficiently and at low cost to detect point mutations, insertions, deletions, and large-fragment structural variations in the IKBKG gene. They are also susceptible to pseudogene interference and have long detection cycles, which cannot meet clinical needs.
Using the liquid-phase hybridization capture technology of the PacBio sequencing platform, specific probe sets and kits were designed. DNA fragmentation was performed by combining Tn5 transposase, and biotin-labeled probes were used for targeted enrichment and capture. Combined with the long read advantage of PacBio HiFi mode, high-precision gene mutation detection was achieved.
It enables simultaneous detection of point mutations, insertions, deletions, and large-fragment structural variations in the IKBKG gene, avoiding pseudogene interference, shortening the detection cycle, reducing costs, and improving detection efficiency and throughput, making it suitable for large-scale clinical screening.
Smart Images

Figure CN121780673A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene detection technology, specifically to a probe set and kit for detecting IKBKG gene mutations using liquid-phase hybridization capture on the PacBio sequencing platform. Background Technology
[0002] The IKBKG gene encodes a core regulatory factor in the nuclear factor κB (NF-κB) signaling pathway.
[0003] Mutations in the IKBKG gene can lead to dysfunction of the NF-κB signaling pathway, resulting in various diseases such as pigmentary disorders (IP), anhidrotic ectodermal dysplasia with immunodeficiency (EDA-ID), and IKBKG exon 5 deletion autoinflammatory syndrome (NDAS). Approximately 30% of patients with pigmentary disorders also experience neurological damage, manifesting as epilepsy and psychomotor developmental delays. Patients with EDA-ID are prone to severe infections due to immunodeficiency, which can be life-threatening. Therefore, accurate detection of IKBKG gene mutations is crucial for disease diagnosis and treatment planning.
[0004] The IKBKG gene (Inhibitor of κB Kinase Gamma Subunit Gene), also known as the NEMO gene, is located in the q28 region of the human X chromosome. Its genome is approximately 41 kb in length and contains 12 exons (exon 1 is a non-coding region). A highly homologous IKBKG pseudogene (IKBKGP, also known as ΔNEMO) exists, sharing 99% homology with the IKBKG gene. However, due to key exon deletions (such as exon 3-10 deletions) and point mutations, it cannot encode the functional NEMO protein. Because of the high sequence similarity, conventional PCR amplification is prone to pseudogene interference, leading to missed or misdiagnosed mutations.
[0005] IKBKG gene mutations are primarily X-linked recessive. Male patients, possessing only one X chromosome, exhibit significant clinical manifestations; females are mostly carriers, but may also present with some symptoms if there is an X chromosome inactivation shift. IKBKG gene mutations closely related to immunodeficiency mainly include large deletions, missense mutations, nonsense mutations, splice site mutations, and mosaic mutations. Large deletions and missense mutations are the most common. Large deletions are the most prevalent mutation type in immunodeficiency patients, accounting for approximately 60%-70% of all mutations, and are mostly caused by homologous recombination between the IKBKG gene and the pseudogene IKBKGP. The most typical deletion types are exon 4-10 deletions, exon 2-10 deletions / complete gene deletions, and partial exon deletions (such as exon 5-7 deletions).
[0006] Existing detection technologies have significant limitations: traditional PCR can only effectively detect 1KBKG exon 4-
[0007] 10 deletions (accounting for 70% of IP cases) have low detection rates for microdeletions and point mutations; Sanger sequencing requires supplementary testing after a negative PCR result, which is cumbersome and only improves sensitivity by about 9%; next-generation sequencing (NGS) has a high false positive rate because IKBKG and the pseudogene IKBKGp1 (99% homology) are prone to mismatches; and current technologies cannot simultaneously detect point mutations and structural variations, resulting in long testing cycles (7-10 days) and high costs, which are difficult to meet clinical needs. Summary of the Invention
[0008] To address the shortcomings of existing technologies, this invention aims to provide a probe set and kit for detecting IKBKG gene mutations using liquid-phase hybridization capture on the PacBio sequencing platform. This enables the detection of point mutations, insertions and deletions, large-fragment structural variations, and unknown mutations in the IKBKG gene, overcoming pseudogene interference, shortening the detection cycle, reducing costs, and providing an efficient and reliable detection method for non-disease diagnostic purposes in clinical settings.
[0009] To solve the above problems, the present invention adopts the following technical solution:
[0010] In a first aspect, the present invention provides a probe set for detecting IKBKG gene mutations using liquid-phase hybridization capture on a PacBio sequencing platform, the probe set comprising sequences as shown in SEQ ID NO.1-SEQ ID NO.329.
[0011] Secondly, the present invention provides a liquid-phase hybridization capture IKBKG gene mutation detection kit for the PacBio sequencing platform, comprising the aforementioned probe set.
[0012] Furthermore, it also includes Tagment buffer, Tagment enzyme, and enzyme-free water, wherein the volume ratio of the Tagment enzyme to the DNA mass is 3 μL: 4 μg.
[0013] Thirdly, the present invention provides an IKBKG gene mutation detection system for liquid phase hybridization capture on the Pacbio sequencing platform, comprising a sample processing and DNA extraction module, a DNA fragmentation module, a liquid phase hybridization capture module, a sequencing library construction module, a Pacbio sequencing module, and a data analysis module.
[0014] The sample processing and DNA extraction module is used to collect peripheral blood or tissue samples and extract genomic DNA.
[0015] The DNA fragmentation module is used to randomly cut DNA into 10 kb pieces using transposase, and simultaneously insert primer binding sequences at both ends.
[0016] The liquid-phase hybridization capture module is used to perform long-fragment PCR amplification of DNA fragmentation products before capture, mix the biotin-labeled probe set with the long-fragment PCR amplification products before capture, target enrichment, capture library PCR amplification and purification to obtain the capture library.
[0017] The sequencing library construction module is used to perform end repair and sequencing adapter ligation on the captured library to obtain the sequencing library.
[0018] The Pacbio sequencing module is used to load sequencing libraries onto the Pacbio Revio platform, perform HiFi sequencing, and obtain sequencing data for the target region.
[0019] The data analysis module is used to split and analyze the sequencing data of the target region. After quality control, cleanreads are aligned to the hg38 genome, and IKBKG and pseudogene differential site correction are combined to detect and annotate variant types.
[0020] Furthermore, the target area capture range of the probe group is: hg38chrX:154546457-154569107.
[0021] The beneficial effects of this invention are as follows: It simultaneously detects point mutations, insertions / deletions, and large-fragment structural variations, covering the entire IKBKG genome region, thus solving the problem of limited detection types in existing technologies; it designs probes based on differentially expressed sites between IKBKG and pseudogenes, combining the advantages of PacBio's long reads to effectively avoid pseudogene interference; leveraging the advantages of the third-generation PacBio HiFi mode—long reads, high precision, and high uniformity—this invention accurately identifies the number of repetitive units, providing patients with a basis for precise treatment; this method can simultaneously detect IKBKG gene mutations in multiple samples in a single experiment, improving detection efficiency, increasing throughput, and reducing costs, making it suitable for large-scale clinical screening and research. Attached Figure Description
[0022] Figure 1 This is a quality control map of the length distribution of the captured library fragments in this invention; where Migration time represents the migration time, LM20 represents a 20 bp DNA band in the quality control marker, and LM1000 represents a 1000 bp DNA band in the quality control marker.
[0023] Figure 2 This is the detection result of a deletion of one copy each in the IKBKG gene and IKBKGP1 gene in this invention. Detailed Implementation
[0024] The present invention will be further described in detail below with reference to specific embodiments.
[0025] It should be noted that these embodiments are only used to illustrate the present invention and are not intended to limit the present invention. Simple improvements to the method under the premise of the present invention are all within the scope of protection claimed by the present invention.
[0026] Example 1: Optimal conditions for enzyme digestion and fragmentation of DNA were tested.
[0027] Compared to existing DNA mechanical fragmentation methods, this invention employs Tn5 transposase-mediated restriction enzyme digestion for DNA fragmentation. The sequencing libraries constructed using both fragmentation methods exhibit essentially the same effectiveness. However, Tn5 transposase can introduce specific sequences at both ends of each DNA fragment. These specific sequences can directly bind to primers for pre-capture PCR, thus eliminating the need for end repair, A-tail addition, and adapter ligation. Considering both time and cost, this invention ultimately chooses restriction enzyme digestion for DNA fragmentation.
[0028] To optimize the DNA fragmentation system, a gradient test of the tagment enzyme dosage was conducted. Each reaction system contained 4 μg gDNA, 10 μL tagment buffer, and nuclease-free water. The total volume was brought to 50 μL by adding 1 μL, 1.5 μL, 2 μL, 2.5 μL, 3 μL, and 5 μL tagment enzyme. The results showed that the DNA fragment length decreased with increasing tagment enzyme concentration. The optimal dosage of 3 μL tagment enzyme for each reaction was determined (see Table 1).
[0029] Table 1. Length of fragmented DNA at different enzyme concentrations
[0030]
[0031] Example 2: Construction of the IKBKG Gene Mutation Detection Procedure
[0032] 1. Collect 10 mL of peripheral blood from the subject using an EDTA-anticoagulated vascular bag.
[0033] 2. Genomic DNA extraction.
[0034] Peripheral blood from the subjects was used to extract high molecular weight gDNA using a dedicated high molecular weight DNA extraction kit. The concentration was measured and the integrity of the genomic DNA was detected by agarose gel electrophoresis.
[0035] 3. Disrupt high molecular weight gDNA
[0036] (1) Add the following reagents to a 200 μl PCR tube:
[0037] Table 2. Preparation of Reagents for Enzyme Digestion and Fragmentation Reaction
[0038]
[0039] (2) Gently blow and aspirate the above solution with the pipette tip to mix it, cover the tube, and centrifuge briefly to collect all components at the bottom of the tube;
[0040] (3) Place the above PCR tubes in the PCR instrument, open the hot cap (hot cap temperature set to 95℃), and the reaction program is as follows:
[0041] Table 3. Enzyme digestion and fragmentation reaction procedure
[0042]
[0043] (4) After the reaction is complete, place it on ice immediately for subsequent experiments.
[0044] 4. Fragment screening of fragmented DNA
[0045] (1) Dilute AmpureXP beads (Beckman, A63881) with 1 mM Tris-HCl pH 8 at a ratio of 2×.
[0046] (2) Mix the fragmented DNA to be screened with the diluted fragment screening magnetic beads in a ratio of 1:4.
[0047] (3) Briefly centrifuge the centrifuge tube to concentrate the magnetic bead / DNA mixture at the bottom of the tube. Place the centrifuge tube on a magnetic rack for 5-10 minutes or until the magnetic beads gather to the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid interfering with the magnetic beads.
[0048] (4) Clean the magnetic beads twice with fresh 80% ethanol. After 30 seconds, use a pipette to remove the 80% ethanol.
[0049] (5) The cleaned magnetic beads are eluted to obtain fragmented DNA after fragment screening.
[0050] 5. Use the dedicated S3 card holder (Bioptic, c105106) for large fragment detection to perform Qsep100 quality control on the fragmented DNA after fragment screening. The proportion of fragments below 6 kbp should be less than 10%, otherwise it is considered unqualified fragmented DNA.
[0051] 6. Long fragment PCR amplification before capture
[0052] (1) Use a high-fidelity enzyme specifically designed for long-fragment amplification to perform pre-capture long-fragment PCR amplification on fragmented DNA containing primer binding sequences. Prepare the amplification system according to Table 4:
[0053] Table 4. Reagent list for long-fragment PCR amplification before capture
[0054] Tag primer sequence:
[0055] Sequence 1:
[0056] CAAGCAGAAGACGGCATACGAGATNNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (SEQ ID NO. 330);
[0057] Sequence 2:
[0058] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNAACACTCTTTCCCTACACGACGCCTTCCGATCT (SEQ ID NO. 331).
[0059] N can be any base of A, T, C, or G.
[0060] Different tags can be single nucleotide sequences of lengths such as 8 nt, 10 nt, and 12 nt.
[0061] Perform the PCR reaction according to Table 5.
[0062] Table 5 Long Fragment PCR Amplification Procedure
[0063]
[0064] (2) Screening of long-fragment PCR amplification fragments before capture
[0065] ① Dilute AmpureXP beads (Beckman, A63881) with 1 mM Tris-HCl pH 8 at a ratio of 2×.
[0066] ② Mix the connector ligation product to be screened with the diluted fragment screening magnetic beads at a ratio of 1:4.
[0067] ③ Perform a brief centrifugation to concentrate the magnetic bead / DNA mixture at the bottom of the tube. Place the centrifuge tube on a magnetic rack for 5-10 minutes or until the magnetic beads gather to the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid interfering with the magnetic beads.
[0068] ④ Clean the magnetic beads twice with fresh 80% ethanol. After 30 seconds, remove the 80% ethanol with a pipette.
[0069] ⑤ Elute the cleaned magnetic beads to obtain the pre-capture PCR product after fragment screening.
[0070] 7. Hybridize the pre-capture PCR product with a biotin-labeled double-stranded DNA probe.
[0071] The capture kit components used in this embodiment are based on patent ZL202011284834.1
[0072] (1) In this embodiment, the GRCh38 / hg38 gene sequence is used as the reference genome sequence. The target capture region is selected as the target gene and its upstream and downstream regions. Continuous probe design is carried out in this region. The coding and non-coding regions of the target gene are required to be fully covered. The target region capture range is: hg38, chrX:154546457-154569107. The capture probe used to enrich the target gene and its flanking regions is a biotin-labeled DNA double-stranded probe. The probe sequence is shown in Table 6.
[0073] Table 6 Probe Sequence List
[0074] (2) Hybridization reactions can be performed as single-hybrid or multiple-hybrid; for multiple-hybrid, multiple Y-shaped pre-libraries need to be mixed at equal molecular weights according to the following formula: fmol = (concentration * 10) 6 ) / [650*length (bp)].
[0075] (3) Vacuum concentrate the individual libraries or libraries mixed with equal molecular weight to dry powder, and resuspend the libraries according to the components in Table 7.
[0076] Table 7. Resuspension Reagents for Library
[0077] (4) Denature the resuspended library and probe: 95℃ for 5 min.
[0078] (5) Add 20 μl of hybridization buffer preheated at 65°C for at least 5 min to the denatured pre-library and probe mixture, and heat the cap at 85°C for 60°C for 16 h.
[0079] 8. Targeted enrichment
[0080] (1) Preheat the streptavidin magnetic beads at 65°C for at least 10 min, and then transfer the hybridization product directly from the 65°C condition to the 65°C streptavidin magnetic beads.
[0081] (2) After the hybridization product has been bound to the streptavidin magnetic beads, the hybridization product and the streptavidin magnetic beads are rinsed and eluted.
[0082] (3) The elution products were captured and amplified by PCR using a long-fragment-specific amplification enzyme. The amplification system was prepared according to Table 8.
[0083] Table 8. Configuration of PCR amplification system for capture library
[0084] Universal primer sequence:
[0085] AATGATACGGCGACCACCGAG (SEQ ID NO. 332); CAAGCAGAAGACGGCATACGA (SEQ ID NO. 333).
[0086] Perform amplification according to the amplification procedure in Table 9.
[0087] Table 9 Capture Library Amplification Procedure Table
[0088] (4) The PCR product was purified using 0.8* purification magnetic beads to obtain the capture library.
[0089] (5) The captured library was subjected to quality control for concentration and fragment length distribution using Qubit and Qsep100. The captured library length should be 6k-10k. See [link to documentation]. Figure 1 .
[0090] 9. Construction of PacBio third-generation libraries (reagent from PacBio, PN: 103-381-200)
[0091] (1) DNA damage repair
[0092] Configure the DNA damage repair system according to Table 10.
[0093] Table 10 Damage Repair System
[0094] Shake the prepared reaction solution to mix well. Reaction conditions: 37℃, 20min; maintain at 4℃.
[0095] (2) End repair and purification
[0096] Configure the end-repair and purification reaction system according to Table 11.
[0097] Table 11 End-of-phase repair and purification reaction system
[0098] Shake the prepared reaction solution to mix well. Reaction conditions: 25℃, 5 min; maintain at 4℃.
[0099] (3) Connector connection
[0100] Configure the connectors to connect the reaction system according to Table 12.
[0101] Table 12 Joint Connection Reaction System Table
[0102] PacBio platform sequencing adapters are provided on the PacBio website, and those skilled in the art can synthesize them themselves or purchase them directly as needed.
[0103] Shake the prepared reaction solution to mix well. Reaction conditions: 25℃, 24h; 65℃, 10min; maintain at 4℃.
[0104] (4) Digest the DNA and adapter sequences that failed to connect.
[0105] Configure the reaction system according to Table 13:
[0106] Table 13 Digestion Reaction System
[0107] Shake the prepared reaction solution to mix well. Reaction conditions: 37℃, 1h; maintain at 4℃.
[0108] 10. Sequencing and Result Analysis
[0109] The prepared library was sequenced using a third-generation single-molecule sequencer (PacBio Revio), resulting in an average sequencing depth of over 50× for the target region.
[0110] The obtained data was then broken down and analyzed. The specific analysis methods are as follows:
[0111] The sample data was split using LIMA software, basic quality control statistical analysis was performed using nanoplot, the sample data was aligned to the hg38 genome using minimap2, and the coverage of the target region was checked to see if it met the requirements for subsequent analysis (>50X). The sample BAM file was genotyped using paraphase, SNV analysis was performed using deepvariant, and SV analysis was performed using cutSV to determine the IKBKG gene mutation type.
[0112] Example 3
[0113] The IKBKG gene mutation detection system in Example 2 was used to perform the experiment. Six positive samples of tandem repeat related genes were tested, and the results are shown in Table 14.
[0114] Table 14 Test Sample Detection Results
[0115] In summary, this invention can detect mutations in IKBKG gene-positive samples. Compared to conventional qPCR and Sanger assays, this invention can distinguish between true and false gene mutations, and also differentiate between different haplotypes of true and false genes. (See below) Figure 2 This invention eliminates the need for family verification and negative sample controls, is simple to operate, and has a much higher throughput than qPCR and Sanger multiplex reactions. It provides guidance for clinical medication based on the severity of the disease.
[0116] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described with reference to preferred embodiments, those skilled in the art should understand that various changes in form and detail can be made without departing from the spirit and scope of the invention as defined in the appended claims.
Claims
1. A probe set for detecting IKBKG gene mutations using liquid-phase hybridization capture on the PacBio sequencing platform, characterized in that, The probe set comprises sequences as shown in SEQ ID NO.1-SEQ ID NO.
329.
2. A kit for detecting IKBKG gene mutations using liquid-phase hybridization capture on the PacBio sequencing platform, characterized in that, Includes the probe set as described in claim 1.
3. The reagent kit according to claim 2, characterized in that, It also includes Tagment buffer, Tagment enzyme, and enzyme-free water, wherein the volume ratio of the Tagment enzyme to the DNA mass is 3 μL: 4 μg.
4. The reagent kit according to claim 2, characterized in that, It also includes a pre-capture long fragment PCR amplification reagent comprising 100 volumes of 2×PCR Buffer for KOD FX Neo, 40 volumes of 2 mM dNTPs, 6 volumes of tag primers as shown in SEQ ID NO.330-SEQ ID NO.331, 4 volumes of KOD FXNeo, and enzyme-free water.
5. A liquid-phase hybridization capture IKBKG gene mutation detection system for the PacBio sequencing platform, characterized in that, It includes modules for sample processing and DNA extraction, DNA fragmentation, liquid phase hybridization capture, sequencing library construction, PacBio sequencing, and data analysis. The sample processing and DNA extraction module is used to collect peripheral blood or tissue samples and extract genomic DNA. The DNA fragmentation module is used to randomly cut DNA into 10 kb pieces using transposase, and simultaneously insert primer binding sequences at both ends. The liquid-phase hybridization capture module is used to perform long-fragment PCR amplification of DNA fragmentation products before capture, mix the biotin-labeled probe set as described in claim 1 with the long-fragment PCR amplification products before capture, target enrichment, capture library PCR amplification and purification to obtain the capture library. The sequencing library construction module is used to perform end repair and sequencing adapter ligation on the captured library to obtain the sequencing library. The Pacbio sequencing module is used to load sequencing libraries onto the Pacbio Revio platform, perform HiFi sequencing, and obtain sequencing data for the target region. The data analysis module is used to split and analyze the sequencing data of the target region. After quality control, cleanreads are aligned to the hg38 genome, and IKBKG and pseudogene differential site correction are combined to detect and annotate variant types.
6. The system according to claim 5, characterized in that, The procedure for pre-capture long fragment PCR amplification was as follows: 94℃, 2 min; 98℃, 10 s; 58.8℃, 30 s; 68℃, 15 min, repeated 6 times; 68℃, 10 min; and held at 4℃.
7. The system according to claim 5, characterized in that, The mutation types include point mutations, insertions and deletions, large-fragment structural variations, and unknown mutations.
8. The system according to claim 5, characterized in that, The target area capture range of the probe group is: hg38chrX:154546457-154569107.