Fpg enzyme and CRISPR / Cas12a combined use-based lock-type probe for G > A mutation detection in gene mutation, detection kit and detection method and application of Fpg enzyme and CRISPR / Cas12a combined use-based lock-type probe
By combining Fpg enzyme with CRISPR/Cas12a, and utilizing 8-oxoG modified lock-in probes and rolling circle amplification technology, the limitations of existing mutation detection technologies in terms of versatility and PAM site dependence are solved. This method enables efficient and sensitive detection of G>A mutations and is suitable for primary laboratories.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SOUTHWEST MEDICAL UNIV
- Filing Date
- 2026-02-26
- Publication Date
- 2026-05-12
AI Technical Summary
Existing mutation detection technologies suffer from insufficient versatility and strict dependence on PAM sites, which limits their broad-spectrum detection capabilities and sensitivity for gene mutations.
The method of combining Fpg enzyme with CRISPR/Cas12a is used to identify mutation sites by using 8-oxoG modified lock probes. Combined with rolling circle amplification and CRISPR/Cas12a cascade signal amplification system, the G>A mutation can be accurately detected.
It enables broad-spectrum and accurate detection of all G>A point mutations, simplifies the operation process, reduces reliance on complex equipment and skills, and is suitable for application in grassroots laboratories.
Smart Images

Figure CN122012715A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene detection technology, specifically to a universal detection method for G>A mutations based on the combination of Fpg enzyme and CRISPR / Cas12a. Background Technology
[0002] Gene mutation is a ubiquitous phenomenon of altered genetic material in the biological world and one of the core driving forces of biological evolution. Through base pair substitution, insertion, and deletion, it provides rich genetic diversity to biological populations, propelling species to adapt to environmental changes and achieve evolutionary iterations through long-term natural selection. In the fields of molecular biology and medicine, mutation is a key entry point for understanding the mechanisms of life activities and revealing the patterns of disease development. Under normal circumstances, stable gene expression maintains the precise regulation of physiological processes such as cell proliferation, differentiation, and apoptosis. However, abnormal mutations in specific genes often disrupt this balance, leading to changes in protein structure and function, resulting in cellular metabolic disorders, abnormal signaling pathways, and ultimately inducing various diseases. In particular, the development of major diseases such as malignant tumors and hereditary diseases is closely related to gene mutation. Furthermore, mutation provides important targets for disease diagnosis, treatment, and drug development. By analyzing the correlation between mutation types and disease phenotypes, targeted molecular diagnostic technologies, targeted therapies, and gene editing therapies can be developed, which is of irreplaceable significance for improving disease prevention and control.
[0003] The p53 gene, known as the "guardian of the genome," is a key tumor suppressor gene. Its encoded protein maintains genomic stability and inhibits tumorigenesis by regulating cell cycle checkpoints, mediating DNA damage repair, and abnormal apoptosis. This gene is one of the most frequently mutated genes in human tumors, with over a thousand mutation types identified. Missense mutations account for 50%-60% of these, making them the predominant mutation type. Among the numerous p53 missense mutations, the p53 R175H mutation (replacing arginine at position 175 with histidine) is particularly unique and significant, representing the most extensively studied and clinically relevant mutation type. Its core value is reflected in four aspects: First, it has a high mutation frequency and is widely present in common tumors such as lung cancer, breast cancer, colorectal cancer, and glioblastoma; Second, it causes significant functional impairment. This site is located in the core DNA-binding domain of the p53 protein. Mutations directly result in the loss of DNA binding ability, leading to the loss of tumor suppressor function. At the same time, it inhibits the function of wild-type p53 through dominant-negative effects and may also acquire new tumor-promoting functions, accelerating the malignant progression of tumors; Third, it has clear clinical significance. Patients carrying this mutation have a higher degree of malignancy and a worse prognosis, and are more likely to develop resistance to chemotherapy drugs such as cisplatin. It is a core target for tumor diagnosis, prognostic assessment, and targeted therapy; Fourth, it has outstanding research value. As an ideal model for elucidating the structure-function relationship of the p53 protein and the tumor-promoting mechanism of mutants, it provides important theoretical support for the development of other p53 mutation-related treatment strategies.
[0004] Sanger sequencing, the gold standard for mutation detection, offers advantages such as single-base resolution and direct visualization of mutation sites. However, it has significant limitations in practical applications: it requires specialized molecular biologists, large-scale gene sequencers, and the entire cycle from sample preparation to result interpretation typically takes 24-48 hours, making it difficult to meet the needs of rapid clinical testing. To overcome the bottlenecks of traditional sequencing technologies, researchers have developed a series of alternative detection techniques, such as allele-specific PCR (ARMS-PCR), digital PCR (dPCR), and high-resolution melting curve analysis (HRM). However, many problems still exist in the existing technology system, such as primer design limitations in ARMS-PCR and temperature sensitivity in HRM. Currently, isothermal amplification (AFA) technology, due to its simple design and high specificity, has significantly improved detection sensitivity and specificity when coupled with CRISPR / Cas systems, becoming an important direction for replacing traditional technologies. However, two core problems remain to be solved, directly restricting its widespread application: First, restriction endonuclease dependence leads to extremely poor universality, only adapting to a few mutations with corresponding cleavage sites. The vast majority of mutation sites lack matching cleavage sequences, and cleavage efficiency is easily interfered with, failing to meet the needs of broad-spectrum detection. Second, PAM sites are strictly dependent on limiting coverage. Cas proteins need to recognize specific PAM sites near the target to activate their function. A large number of mutation sites lack matching PAM sequences, leading to detection failure, and non-classical PAM sites have poor adaptability. In addition, reaction components are prone to mutual interference, step-by-step operations increase complexity and are prone to contamination, while the "one-pot" method sacrifices sensitivity and speed, further exacerbating the difficulty of technology implementation.
[0005] FPG enzyme, also known as 8-oxoguanine DNA glycosylase, is a crucial DNA repair enzyme in cells. It recognizes and removes specific damaged bases on DNA caused by oxidative damage, especially 8-oxoguanine (8-oxoG). As a bifunctional enzyme, FPG enzyme can perform a two-step reaction consecutively: first, it uses glycosylase activity to remove the damaged base to generate a base-free (AP) site; then, through AP lyase activity, it simultaneously cleaves the phosphodiester bond on both the 3'- and 5'-sides of the AP site, leaving a single nucleotide gap at the 3'- and 5'-phosphate ends. The activity level of FPG enzyme in cells or tissues can reflect the body's ability to repair oxidative damage and is associated with an individual's susceptibility to cancer and neurodegenerative diseases (such as Alzheimer's disease). Patent application number CN202111369877, entitled "A CRISPR-based fluorescent biosensor and its application in the detection of DNA glycosylase," discloses a DNA glycosylase detection system comprising a hairpin probe, a detection probe, a signal probe, and crRNA. The detection probe is labeled with an 8-oxoG lesion site specifically recognized by DNA glycosylase. When the target DNA glycosylase is present, it recognizes and cleaves this lesion site, creating a single nucleotide gap. Subsequently, a polynucleotide kinase (PNK) converts the 3'-phosphate terminus of the gap to a 3'-hydroxyl group, initiating a second-strand substitution amplification (Q-SDA) reaction. This reaction, in synergy with Nt.BbvCI restriction endonuclease and Klenow polymerase, cyclically generates a large number of short-chain DNA activators. These activators bind to the crRNA / Cas12a complex, activating the trans-cleavage activity of Cas12a, which cleaves the signal probe, producing a fluorescent signal, thus enabling the quantitative detection of DNA glycosylase activity. The purpose of this study is to detect DNA glycosylase activity at the single-cell level. Furthermore, FPG enzymes can also be used as a tool for the specific detection of DNA oxidative damage. Patent application number CN202110741221, entitled "A Fluorescent Chemical Sensor, Method, and Application for Single-Molecular Detection of DNA Damage Sites," discloses the use of FPG enzymes to specifically recognize and cleave 8-oxoG damage sites on the DNA strand. Then, PNK enzymes dephosphorylate the 3'-phosphate end at the break, generating an amplifiable 3'-OH end. Subsequently, template-free polymerization mediated by terminal deoxynucleotidyl transferase (TDT) incorporates fluorescently labeled Cy5-dUTP into the 3'-OH end, forming a signal strand. Next, a Poly A strand is introduced and hybridizes with this signal strand, initiating a new round of TDT-mediated elongation at its 3'-OH end, thus forming a cyclic hyperbranched amplification process that geometrically amplifies a single damage signal into a large number of Cy5-labeled DNA products.Finally, Cy5-dUTP single nucleotides were released by enzymatic digestion and accurately quantified using single-molecule fluorescence imaging technology. Combined with magnetic bead separation to remove background interference, the system ultimately achieved ultrasensitive and highly specific detection of extremely low abundance DNA oxidative damage.
[0006] Currently, there are no literature reports on the use of Fpg enzymes to specifically recognize and remove 8-oxoG from DNA strands, or on the use of 8-oxoG-modified probes to detect gene mutations. Summary of the Invention
[0007] The purpose of this invention is to provide a universal detection method for G>A mutations based on the combination of Fpg enzyme and CRISPR / Cas12a, in order to solve the core problems such as the insufficient universality of existing mutation detection methods and the strict dependence on PAM sites. Figure 1 This paper describes a schematic diagram of the principle of the universal detection method for G>A mutations based on the combination of Fpg enzyme and CRISPR / Cas12a. Taking the detection of the p53R175H mutation as an example, this invention establishes a universal detection method for G>A base mutations, providing technical support and application paradigm for the efficient and accurate detection of similar mutations in the p53 gene and other genes.
[0008] In a first aspect, the present invention provides a lock-lock probe for detecting G>A mutations in gene mutations. The lock-lock probe comprises a recognition sequence complementary to the target p53 R175H and a CRISPR / Cas12a recognition sequence, and is modified with 8-oxoguanine. The base sequence of the lock-lock probe is: p-GGGGGCAG / i8oxodG / GCCTCACAACCTTCTCTGCTCGACGGAAATAAGAGATAATAAGAGATCGCTCATGGT.
[0009] A second aspect of the present invention provides a universal detection kit for G>A mutation based on the combination of Fpg enzyme and CRISPR / Cas12a. The kit includes the above-mentioned lock probe, as well as a fluorescent reporter probe, primers, crRNA, T4 DNA ligase, Fpg enzyme, phi29 DNA polymerase and Cas12a protein.
[0010] The fluorescent reporter probe is modified with fluorescent and quenching groups at both ends, and can be cleaved by the trans-cleavage activity activated by Cas12a, with the sequence: HEX-TATTATT-BHQ1.
[0011] The primers described can bind to circularized lock probes, and after amplification, long repeat single-stranded DNA is obtained with the base sequence: TCCGTCGAGCAGAGAA;
[0012] The crRNA binds to the Cas12a protein to form a ribonucleoprotein complex (RNP) with the following base sequence: UAAUUUCUACUAAGUGUAGAUAAUAAGAGAUAAUAAGAGAU.
[0013] A third aspect of the present invention provides a method for detecting G>A mutations using the aforementioned universal detection kit for G>A mutations based on Fpg enzyme and CRISPR / Cas12a, comprising the following steps:
[0014] a. Extract genomic DNA from the sample to be tested as the target gene: Take 500 mL of blood into a centrifuge tube, add 3 times the volume of red blood cell lysis buffer, and then use a DNA extraction kit to extract genomic DNA from the blood as the target gene. The concentration of the extracted target gene is then measured using a NanoDrop micro spectrophotometer.
[0015] b. Cycling reaction of the locked probe and preparation of RNP: The target gene from step a and the locked probe were mixed with ddH2O, denatured at 95 °C for 5 minutes, and then slowly annealed at room temperature; 1.1 × 10⁻⁶ RNPs were added. 4 ~4×10 4 T4 DNA ligase at a concentration of 0.3 × 10⁻⁶ U / mL, T4 DNA ligase buffer. 3 ~1.3×10 3 Fpg enzyme at a concentration of U / mL and corresponding Buffer 1 were incubated at 37 °C for 20–60 minutes to obtain a circularized probe. At the same time, RNP was prepared, including ddH2O, corresponding Buffer 1, and crRNA / Cas12a protein (molar ratio 1:1), all at a concentration of 0.1–1 nM, and incubated for 30 minutes.
[0016] c. Rolling circle amplification and Cas12a cleavage reaction: The circularized probe, primers (100 nM), dNTPs (25 mM), phi29 DNA polymerase reaction buffer, and phi29 DNA polymerase (0.2 × 10⁻⁶ mM) were mixed. 3 ~1×10 3 The sample was incubated with a mixture of U / mL, fluorescent reporter probe (10 nM), and RNP at a concentration of 0.1~1 nM for 60-160 minutes.
[0017] d. Fluorescence detection: The detection results of the target gene are obtained by detecting the fluorescence signal of the ssDNA reporter molecule labeled with fluorophore-quencher.
[0018] The samples to be tested in step a include isolated blood, body fluids, tissues, or cells.
[0019] Preferably, the concentration of T4 DNA ligase in step b is 2 × 10⁻⁶. 4 U / mL, Fpg enzyme concentration is 4.4 × 10⁻⁶. 2 U / mL, incubation time is 40 minutes.
[0020] Preferably, the concentration of phi29 DNA polymerase in step c is 4 × 10⁻⁶. 2 U / mL, RNP 0.4 nM, incubation time 120 minutes.
[0021] Preferably, the incubation temperature in steps b and c is 37 °C.
[0022] A fourth aspect of the present invention provides the use of the above-described lock-in probe for detecting G>A mutations or a universal detection kit for G>A mutations based on Fpg enzymes coupled with CRISPR / Cas12a in the preparation of kits for diagnosing leukemia or tumors.
[0023] The leukemia mentioned is acute myeloid leukemia, and the tumors mentioned include lung cancer, breast cancer, colorectal cancer, and glioblastoma.
[0024] It should be noted that although this invention takes the diagnosis of human acute myeloid leukemia as an example to provide a general detection method for G>A mutations based on the combination of Fpg enzyme and CRISPR / Cas12a, based on the concept of this invention, it is obviously possible to replace the recognition sequence complementary to the target and the sequence recognized by CRISPR / Cas12a in the lock probe, and modify the 8-oxoG position to detect other diseases caused by G>A mutations, such as lung cancer, breast cancer, colorectal cancer and other common tumors, as well as malignant tumors such as glioblastoma. Therefore, it should also fall within the protection scope of this invention.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] (1) This invention innovatively integrates the specific recognition function of Fpg enzyme for 8-oxoG, and regulates the probe cyclization efficiency by the difference of target bases. It does not rely on the restriction endonuclease recognition sequence of the mutation site, and can accurately distinguish the target gene, greatly expanding the scope of detection and achieving broad-spectrum adaptation to the target gene.
[0027] (2) This invention cleverly avoids the requirement of Cas12a to recognize PAM sites by cascading reaction of probe circularization regulation mediated by Fpg enzyme and rolling circle amplification. Specific detection can be initiated without the presence of specific PAM sites near the target sequence, completely breaking the constraint of PAM sites on target selection and significantly improving the universality and application flexibility of the technology.
[0028] (3) This invention innovatively designs a "two-step" detection process, in which the amplification and detection processes are carried out under isothermal conditions at 37 ℃, eliminating the need for complex temperature control equipment. In addition, this method does not require large and expensive instruments or highly skilled sequencing personnel, and the operation process is standardized, making it easier to promote and apply to grassroots laboratories.
[0029] This invention successfully constructs a universal detection method for G>A mutations based on the combination of Fpg enzyme and CRISPR / Cas12a. By using an 8-oxoG modified lock probe to identify mutation points and combining rolling circle amplification with a cascaded signal amplification system of CRISPR / Cas12a, it breaks through the core bottlenecks of existing mutation detection technologies, such as the lack of universality due to restriction endonuclease dependence and the strict dependence of Cas protein on the target PAM site, and achieves broad-spectrum and accurate detection of all G>A point mutations. Attached Figure Description
[0030] Figure 1 This is a schematic diagram illustrating the principle of the universal detection method for G>A mutations based on the combination of Fpg enzyme and CRISPR / Cas12a according to the present invention.
[0031] Figure 2 The following diagrams are related to the principle verification in the embodiments of the present invention: Figure 2 A is a schematic diagram illustrating the principle of Fpg enzyme selectivity specificity; Figure 2 B is a PAGE electrophoresis image for Fpg enzyme selection specificity verification, with lanes 1–4 corresponding to mutations A, T, G, and C, respectively. Figure 2 C represents the fluorescence spectrum and UV visualization results with and without the p53 R175H target; Figure 2 D is a PAGE electrophoresis image of the locked probe circularization reaction, rolling circle amplification reaction, and CRISPR / Cas12a cleavage reaction. Lane 1: Locked probe template; Lane 2: Locked probe circularization product in the presence of wild-type p53 target; Lane 3: Locked probe circularization product in the presence of p53 R175H target; Lane 4: Rolling circle amplification product in the presence of p53 target; Lane 5: Rolling circle amplification product in the presence of p53 R175H target; Lane 6: CRISPR / Cas12a cleavage product in the presence of wild-type p53 target; Lane 7: CRISPR / Cas12a cleavage product in the presence of p53 R175H target.
[0032] Figure 3 The following diagrams illustrate the correlation between the two-step detection method and the three-step detection method in this embodiment of the invention: Figure 3 A is a schematic diagram illustrating the principle of rolling circle amplification coupled with CRISPR / Cas12a; Figure 3 B is adopted Figure 3 Fluorescence spectra of the method described above under the conditions of presence / absence of the p53 R175H target; Figure 3 C is a schematic diagram illustrating the principle of the stepwise reaction of rolling circle amplification of CRISPR / Cas12a; Figure 3 D is adopted Figure 3 Fluorescence spectra of the method described in C under conditions of presence / absence of the p53 R175H target.
[0033] Figure 4 The following is a diagram showing the optimized reaction conditions in an embodiment of the present invention: Figure 4 A represents the fluorescence detection results corresponding to different concentrations of T4 DNA ligase; Figure 4 B represents the fluorescence detection results corresponding to different concentrations of Fpg enzyme; Figure 4 C represents the fluorescence values detected by T4 DNA ligase at different ligation times; Figure 4 D represents the fluorescence detection results corresponding to different concentrations of phi29 DNA polymerase; Figure 4 E represents the reaction fluorescence values of different concentrations of ribonucleoprotein complex (RNP) (molar ratio 1:1); Figure 4 F represents the fluorescence values detected at different times during the rolling circle amplification coupled with Cas12a enzyme digestion reaction.
[0034] Figure 5 The following is a graph related to performance detection in an embodiment of the present invention: Figure 5 A shows the fluorescence spectra of the p53 R175H target at concentration gradients of 0.8 fM–800 pM; Figure 5 B shows the fluorescence response curves of the p53 R175H target in the concentration range of 0.8 fM–800 pM. The inset shows the linear relationship between the fluorescence intensity difference and the logarithm of the target concentration in this concentration range. Figure 5 C is Figure 5 Fitting curves for the low concentration range of 0.8 fM–8 pM in B; Figure 5 D is Figure 5 The fitting curve of the high concentration range of 8pM–800pM in B, with the error bars representing the standard deviation of the data obtained from three independent repeated experiments; Figure 5 E represents the fluorescence spectra of p53 R175H mutant and wild-type p53 at a mutation rate gradient of 0%–100%; Figure 5 F is the fitted curve of fluorescence intensity difference (ΔF) versus mutation rate within this interval; Figure 5 G represents the feasibility verification result of using real-time PCR to detect the p53 R175H target gene; Figure 5 H is the fluorescence spectrum of the p53 R175H target detected by quantitative real-time PCR at concentration gradients of 0 pM–80 pM.
[0035] Figure 6The following figures illustrate the selectivity, repeatability, and anti-interference capabilities of the detection method in this embodiment of the invention: Figure 6 A represents the fluorescence detection values of six independent experimental groups at a target concentration of 100 pM p53 R175H; Figure 6 B represents the fluorescence value detected in 5 repeated reactions at a target concentration of 100 pM p53 R175H. Figure 6 C represents a comparison of the reaction fluorescence values corresponding to different concentrations of the p53 R175H target in a normal buffer solution and a 5% serum sample system.
[0036] Figure 7 This is a comparative analysis chart showing the results of detecting clinical blood samples using the method of this invention and the standard method in an embodiment of this invention: Figure 7 A represents the fluorescence values of normal human samples and acute myeloid leukemia patient samples after reaction by the detection system of this invention (1: normal human samples; 2-7: acute myeloid leukemia patient samples). Figure 7 B is the fluorescence spectrum of a normal human sample after quantitative PCR reaction; Figure 7 C-7H is the fluorescence spectrum of a sample from an acute myeloid leukemia patient after a quantitative real-time PCR reaction. Detailed Implementation
[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0038] Example 1. Preparation of a universal detection kit for G>A mutation based on Fpg enzyme combined with CRISPR / Cas12a
[0039] This invention's kit includes: a lock probe, a fluorescent reporter probe, primers, crRNA, T4 DNA ligase, Fpg enzyme, phi29 DNA polymerase, and Cas12a protein. When the target gene is p53 R175H, due to the mutation of the base from G to A, the target gene cannot be recognized and cleaved by the Fpg enzyme, allowing the lock probe to successfully complete ligation into a circular form. The target gene binds to the complementary region of the lock probe, initiating a rolling circle amplification reaction. Under the action of phi29 DNA polymerase, using the lock probe as a template, long-chain DNA with repetitive sequences is continuously synthesized. The generated long-chain DNA contains a target sequence recognizable by the CRISPR / Cas12a system. The Cas12a / crRNA complex specifically binds to this target sequence, activating the cis and trans cleavage activities of Cas12a. The cis cleavage product can be used as a primer to further initiate cascade amplification, while the activated trans cleavage activity non-specifically cleaves surrounding fluorescent reporter molecules, separating the fluorophore from the quencher group and generating a detectable fluorescent signal, thereby achieving the detection of the G>A mutation. When the target gene is wild-type p53, the guanine (G) site in exon 5 can be recognized and cleaved by Fpg enzyme, creating a cleavage containing 3'-phosphate and 5'-phosphate. This cleavage hinders the cyclization reaction catalyzed by T4 DNA ligase, preventing the RCA template from forming a closed circular DNA, thus blocking subsequent amplification reactions. The entire process takes only 3 hours, as follows: annealing at 95℃ for 5 min, followed by ligation at 37℃ for 40 min catalyzed by T4 DNA ligase, and then inactivation at 65℃ for 15 min; the above reaction mixture is then mixed with phi29 DNA polymerase, RNP, and other components, and reacted at 37℃ for 120 min. Finally, the experimental results are detected and output using a fluorescence spectrophotometer.
[0040] The lock probe comprises a target-complementary recognition sequence and a CRISPR / Cas12a-recognized sequence, and is modified with 8-oxoguanine (8-oxoG) at the 9th nt starting from the 5' end. The fluorescent reporter probe is modified with fluorescent and quenching groups at both ends and can be cleaved by the trans-cleavage activity activated by Cas12a. The primers bind to the circularized lock probe, and amplification yields long repeat single-stranded DNA. The lock probe, primers, fluorescent reporter probe, and crRNA sequences involved in the kit of this invention are shown in Table 1 below:
[0041] Table 1. DNA sequences used in the universal detection kit for G>A mutations based on Fpg enzyme and CRISPR / Cas12a.
[0042]
[0043] Example 2. A universal detection method for G>A mutations based on the combination of Fpg enzyme and CRISPR / Cas12a.
[0044] The detection method of this invention is divided into three-step detection and two-step detection. The following detection process takes the target mutant gene p53 R175H as an example, and gene p53 as a control.
[0045] The three-step detection method includes the following steps:
[0046] (a) Mix 2 μL of lock probe SEQ ID: NO.1 (1 μM), 1 μL of ddH2O, and 2 μL of target mutant gene p53R175H SEQ ID: NO.6 (10 nM), anneal at 95 °C for 5 minutes, and slowly cool to room temperature.
[0047] (b) Add 1.5 μL of T4 DNA ligase (2 × 10⁻⁶) 4 U / mL), 1 μL T4 DNA ligase reaction buffer, 1.5 μL Fpg enzyme (4.4 × 10⁻⁶ U / mL), 2 The probe was incubated with 1 μL of the corresponding buffer 1 at 37 °C for 40 minutes and then inactivated at 65 °C for 15 minutes to obtain a closed loop locking probe.
[0048] (c) A circularized lock probe mixed with 1 μL of dNTP (25 mM), 2 μL of primer SEQ ID: NO.2 (100 nM), and 2 μL of phi29 DNA polymerase (4 × 10⁻⁶ mM). 2 Mix 2 μL of phi29 DNA polymerase reaction buffer (U / mL) and amplify at 37°C for 90 minutes to obtain a large amount of long repeat single-stranded DNA.
[0049] (d) Then add 1 μL ddH2O, 2 μL crRNA SEQ ID: NO.4 (0.4 nM), 2 μL Cas12a protein (0.4 nM), 1 μL fluorescent reporter probe SEQ ID: NO.3 (10 μM) and 2 μL corresponding Buffer 1 and mix. Incubate at 37 °C for 30 minutes.
[0050] (e) The fluorescence signal acquisition process is as follows: 170 μL of ddH2O was added to the above reaction product, and the fluorescence intensity was measured by a fluorescence spectrometer under 490 nm excitation.
[0051] Two-step detection procedure: Same as steps (a), (b), and (e) of the three-step detection procedure above, but combine steps (c) and (d): During T4 ligation, prepare the RNP simultaneously, including 1 μL ddH2O, 2 μL crRNA SEQ ID: NO.4 (0.4 nM), 2 μL Cas12a protein (0.4 nM), and 2 μL corresponding Buffer 1. Incubate at 37 ℃ for 30 minutes to obtain the RNP. Then add 1 μL dNTP (25 mM), 2 μL primer SEQ ID: NO.2 (100 nM), and 2 μL phi29 DNA polymerase (4 × 10⁻⁶ mM). 2 The sample was prepared with 2 μL of phi29 DNA polymerase reaction buffer (U / mL) and 1 μL of fluorescent reporter probe SEQ ID: NO.3 (10 μM). The sample was amplified and sheared at 37 °C for 120 minutes.
[0052] The target gene sequences involved in the detection method of this invention are shown in Table 2 below:
[0053] Table 2. DNA sequences of the target gene p53 and its mutant gene p53 R175H
[0054]
[0055] The detection method of this invention is mainly achieved by the following synergistic mechanisms: (1) The specific recognition ability of the lock probe: The probe design contains a recognition sequence that is completely complementary to p53 R175H, which can specifically bind to the target p53 R175H and start the rolling circle amplification reaction, effectively avoiding interference caused by non-specific amplification; (2) Synergistic effect of rolling circle amplification and CRISPR / Cas12a simultaneous amplification and cleavage: The rolling circle amplification reaction is started with the circular probe as a template. Under the catalysis of phi29 DNA polymerase, long single-stranded DNA containing a large number of repeating target sequence complementary sequences is continuously synthesized; at the same time, the Cas12a / crRNA complex can specifically recognize the target sequence in the long single-stranded DNA and can be activated for trans-cleavage activity without relying on the PAM site, so as to realize the synchronous operation of the amplification process and the cleavage reaction (simultaneous amplification and cleavage). (3) Secondary rolling circle amplification cycle of cleavage products: The fragments generated by Cas12a cleavage contain complementary fragments of the target sequence, which can bind to the circularized probe again or form a new circularized template, triggering a secondary rolling circle amplification reaction, further amplifying the initial signal, forming a "amplification-cleavage-re-amplification" cyclic amplification pathway, significantly improving detection sensitivity. (4) High sensitivity characteristics of signal conversion: After activation, Cas12a releases a fluorescent signal by specifically cleaving the fluorescent reporter molecule. The inherent high specificity and signal self-amplification capability of the CRISPR system further improves the sensitivity and accuracy of detection.
[0056] Example 3. Validation of the feasibility of using Fpg enzyme in combination with CRISPR / Cas12a for universal detection of G>A mutations.
[0057] 1. Feasibility verification of Fpg enzyme selectivity specificity
[0058] (1) Experimental method:
[0059] Mix 6 μL of probe-8-oxoG SEQ ID: NO.7 (2 μM) with 6 μL of mutant-G / C / A / T SEQ ID: NO.8 / NO.9 / NO.10 / NO.11 (2 μM), denature at 95 °C for 5 minutes, and anneal slowly at room temperature; add 4 μL of Fpg enzyme (3.96 × 10⁻⁶). 2 The probe sequences involved in this embodiment are shown in Table 3 below: 2 μL of Lambda exonuclease (500 U / mL) and 2 μL of the corresponding buffer were added, and the mixture was incubated at 37 °C for 1 hour, followed by inactivation at 60 °C for 20 minutes.
[0060] Table 3. Probe sequences used to verify the selectivity of Fpg enzyme
[0061]
[0062] “p” indicates phosphate group modification.
[0063] (2) Experimental results:
[0064] The feasibility of Fpg enzyme-specific selection was verified by polyacrylamide gel electrophoresis. Figure 2 A is a schematic diagram of the principle. Figure 2 B is the electrophoresis image. From Figure 2 As shown in Figure A, when Fpg enzyme acts on double-stranded DNA modified with 8-oxoG, its N-glycosylation activity first removes the damaged base, forming an apurinic site (AP site); subsequently, AP lyase activity cleaves the 3' phosphodiester bond at the AP site, producing a nicked double-stranded DNA containing a 5'-phosphate group. Because the molecular weight changes of the Fpg enzyme cleavage products are minimal, they are difficult to distinguish directly by polyacrylamide gel electrophoresis. Therefore, the specific degradation of 5'-phosphorylated DNA strands by Lambda exonuclease is utilized to digest the cleavage products into single-stranded fragments. The migration rates of the cleavage products of mutant G / C / T / A in 10% polyacrylamide gel were compared (…). Figure 2(B) This confirms that the Fpg enzyme is highly selective for mutant A. Lane 1 contains mutant A, which, after degradation by the Fpg enzyme and Lambda exonuclease, produces a relatively long single-stranded fragment that can be detected by electrophoresis. Lanes 2, 3, and 4 contain mutants T, G, and C, respectively, and their single-stranded fragments are shorter than those in lane 1.
[0065] 2. Feasibility verification of p53 R175H testing
[0066] (1) Experimental method:
[0067] Mix 2 μL of the lock probe SEQ ID: NO.1 (1 μM), 1 μL of ddH2O, and 2 μL of the target mutant gene p53 R175H SEQ ID: NO.6 (10 nM), anneal at 95 °C for 5 minutes, and slowly cool to room temperature. Add 1.5 μL of T4 DNA ligase (2 × 10⁻⁶). 4 U / mL), 1 μL T4 DNA ligase reaction buffer, 1.5 μL Fpg enzyme (4.4 × 10⁻⁶ U / mL), 2 The circular probe was incubated with 1 μL of dNTP mixture (U / mL) and 1 μL of corresponding Buffer 1 at 37 °C for 40 min, followed by inactivation at 65 °C for 15 min to obtain a closed circular probe. Simultaneously, a ribonucleoprotein complex (RNP) composed of Cas12a protein and crRNA was prepared, comprising 1 μL ddH2O, 2 μL crRNA SEQ ID: NO.4 (0.4 nM), 2 μL Cas12a protein (0.4 nM) (molar ratio 1:1), and 2 μL of corresponding Buffer 1, and incubated at 37 °C for 30 min. The circular probe was then mixed with 1 μL dNTP mixture (25 mM), 2 μL primer SEQ ID: NO.2 (100 nM), and 2 μL phi29 DNA polymerase (4 × 10⁻⁶ mM). 2 Mix 2 μL of phi29 DNA polymerase reaction buffer, RNP, and 1 μL of fluorescent reporter probe SEQ ID: NO.3 (10 μM) and react at 37 ℃ for 120 minutes. The fluorescence signal acquisition process is as follows: Add 170 μL of ddH2O to the above reaction product, and measure the fluorescence intensity using a fluorescence spectrometer under 490 nm excitation.
[0068] The reaction products were analyzed by electrophoresis using a 10% non-denaturing polyacrylamide gel. The sample was mixed with DNA loading buffer at a 5:1 volume ratio and transferred to the gel wells. The gel was then placed in TBE buffer (1×) and incubated at 120V for 40 minutes. Finally, the gel was immersed in nucleic acid dye for 15 minutes, and images were collected using a DNA scanner.
[0069] (2) Experimental results:
[0070] The universal detection method for G>A mutations based on the combination of Fpg enzyme and CRISPR / Cas12a was validated by polyacrylamide gel electrophoresis and fluorescence detection. Figure 2 C is the fluorescence detection image. Relying on the target signal amplification effect of Fpg enzyme-Cas12a combined rolling circle amplification, wild-type and mutant targets can be induced to produce fluorescence spectral characteristics with significant differences. Through quantitative analysis of the spectral peak intensity, the wild-type p53 and mutant p53 R175H can be rapidly distinguished. Figure 2 D is the electrophoresis image. From Figure 2 Lane D verifies whether the lock probe paired with the target gene is successfully ligated into a closed lock probe by T4 DNA ligase, whether the product can undergo rolling circle amplification, and whether the rolling circle amplification product can be recognized and cleaved by the CRISPR / Cas12a system. Lane 1 is the lock probe template, which is a lock probe template band that has not undergone circularization and maintains a linear state. Because it is mostly a linear small fragment, its conformation is extended, and its migration rate is relatively slow. Lanes 2 and 3 are the products inactivated after ligation with T4 DNA ligase using lock probes in the presence of target p53 and target p53 R175H, respectively. In lane 3, the band with a faster migration rate than the linear lock probe in lane 1 corresponds to a closed circular lock probe; while the band with a faster migration rate in lane 2 corresponds to a circular probe with a notch. Lanes 4 and 5 show the products after rolling circle amplification using closed locking probes in the presence of target p53 and target p53 R175H, respectively. The faster-moving electrophoretic bands are similar to those in lane 1, indicating a locking probe. No long-chain bands were observed at the sample loading well in lane 4, but a clear band was observed at the sample loading well in lane 5, indicating that the target mutant gene p53 R175H successfully triggered the rolling circle amplification reaction. Lanes 6 and 7 show the products after Cas12a cleavage in the presence of target p53 and target p53 R175H, respectively. Only the locking probe band was observed in lane 6, with no diffuse small fragment bands. The long-chain bands near the sample loading well in lane 7 disappeared, while diffuse small-fragment bands appeared on the gel bottom, which contrasted sharply with lane 6. This proved that rolling circle amplification was successful when the target p53 R175H was present, and the band diffusion phenomenon was observed. This indicates that the cis and trans cleavage activities of Cas12a were effectively activated, producing a large number of small-fragment nucleic acids.
[0071] 3. Optimization of the testing process
[0072] like Figure 3 As shown, the present invention can detect G>A mutations using two-step and three-step methods. Figure 3 A is a schematic diagram illustrating the principle of rolling circle amplification coupled with CRISPR / Cas12a (two-step method). Figure 3C represents a schematic diagram of the rolling circle amplification CRISPR / Cas12a stepwise reaction (three-step method). This invention optimizes the detection process and innovatively designs a "two-step" detection procedure. Amplification and detection are performed under isothermal conditions at 37 °C, eliminating the need for complex temperature control equipment. The entire process takes only 3 hours, as follows: annealing at 95 °C for 5 min, followed by ligation at 37 °C using T4 DNA ligase for 40 min, and then inactivation at 65 °C for 15 min; the above reaction mixture is then mixed with phi29 DNA polymerase, RNP, and other components, and reacted at 37 °C for 120 min. Finally, the results are detected and output using a fluorescence spectrophotometer. Figure 3 B shows the fluorescence spectrum of the p53 R175H target detected using a two-step method; Figure 3 D shows the fluorescence spectrum of the p53 R175H target detected using a three-step method. Combined with... Figure 3 The experimental results of B and 3D show that the fluorescence intensity of the two-step method is significantly higher than that of the three-step method, indicating that it has a stronger detection signal and better sensitivity. In addition, this method does not require large and expensive instruments and highly skilled sequencing personnel. The operation process is standardized and easier to promote and apply to grassroots laboratories. Therefore, the two-step method was finally determined as the optimal detection process.
[0073] 4. Optimization of experimental parameters
[0074] To improve the sensitivity of the CRISPR / Cas12a detection method, this study systematically optimized key reaction parameters, including T4 DNA ligase concentration, Fpg enzyme concentration, T4 ligation time, phi29 DNA polymerase concentration, RNP concentration, and the reaction time for rolling circle amplification coupled with Cas12a digestion. Among these, T4 DNA ligase concentration, Fpg enzyme concentration, and T4 ligation time significantly affected probe circularization efficiency. Figure 4 As shown in Figure A, the T4 DNA ligase was set to 1.1 × 10⁻⁶. 4 ~4×10 4 A concentration gradient of U / mL, when the concentration is 2×10⁻⁶ 4 The fluorescence response reached saturation at a concentration of U / mL. Therefore, we chose 2×10⁻⁶. 4 The optimal conditions are T4 DNA ligase at a concentration of U / mL. For example... Figure 4 As shown in Figure B, the Fpg enzyme was set to 0.3 × 10⁻⁶. 3 ~1.3×10 3 A concentration gradient of U / mL resulted in a fluorescence response at 4.4 × 10⁻⁶. 2 The concentration reaches its maximum at 4.4 × 10⁻⁶ U / mL. Therefore, we chose 4.4 × 10⁻⁶. 2 The optimal conditions are Fpg enzyme at U / mL. For example... Figure 4As shown in Figure C, with a time gradient of 20-60 minutes for T4 ligation, the fluorescence response reached kinetic equilibrium at 40 minutes. Extending the time to 60 minutes yielded no significant gain; therefore, 40 minutes was determined to be the optimal reaction time. The concentrations of phi29 DNA polymerase, RNP concentration, and the reaction time of rolling circle amplification coupled with Cas12a digestion directly affect the cascade amplification efficiency. Figure 4 As shown in Figure D, the phi29 DNA polymerase was set to 0.2 × 10⁻⁶. 3 ~1×10 3 A concentration gradient of U / mL resulted in a fluorescence response at a range of 4 × 10⁻⁶. 2 The strongest concentration was reached at 4 × 10⁻⁶ U / mL. Therefore, we chose 4 × 10⁻⁶. 2 The optimal conditions are φ29 DNA polymerase at a concentration of U / mL. For example... Figure 4 As shown in Figure E, with a fixed molar ratio of Cas12a to crRNA of 1:1 and a crRNA concentration gradient of 0.1–1 nM (corresponding to the same Cas12a concentration), RNPs of different concentrations were assembled. The fluorescence response saturated at 0.4 nM. Therefore, we selected 0.4 nM RNPs as the optimal condition. Figure 4 As shown in F, the reaction time gradient of rolling circle amplification coupled with Cas12a digestion was set to 60-160 minutes. The fluorescence response reached its strongest at 120 minutes. Therefore, the optimal reaction time for rolling circle amplification coupled with Cas12a digestion was determined to be 120 minutes.
[0075] 5. Investigation of the detection performance of the reaction system
[0076] (1) Experimental method:
[0077] Sensitivity test: The target mutant gene p53 R175H SEQ ID: NO.6 was serially diluted (from 0.8 fM to 800 pM). 2 μL of each concentration of target solution was mixed with 2 μL of the lock probe SEQ ID: NO.1 (1 μM) and 1 μL of ddH2O, annealed at 95 °C for 5 minutes, and then slowly cooled to room temperature. 1.5 μL of T4 DNA ligase (2 × 10⁻⁶) was added. 4 U / mL), 1 μL T4 DNA ligase reaction buffer, 1.5 μL Fpg enzyme (4.4 × 10⁻⁶ U / mL), 2The probe was incubated with 1 μL of dNTP mixture (U / mL) and 1 μL of the corresponding Buffer 1 at 37 °C for 40 min, then inactivated at 65 °C for 15 min to obtain a closed circular lock probe. Simultaneously, a ribonucleoprotein complex (RNP) was prepared, consisting of 1 μL ddH2O, 2 μL crRNA SEQ ID: NO.4 (0.4 nM), 2 μL Cas12a protein (0.4 nM) (molar ratio 1:1), and 2 μL of the corresponding Buffer 1, and incubated at 37 °C for 30 min. The circularized probe was then mixed with 1 μL dNTP mixture (25 mM), 2 μL primer SEQ ID: NO.2 (100 nM), and 2 μL phi29 DNA polymerase (4 × 10⁻⁶ mM). 2 Mix 2 μL of phi29 DNA polymerase reaction buffer, RNP, and 1 μL of fluorescent reporter probe SEQ ID: NO.3 (10 μM) and react at 37 °C for 120 minutes. Acquire fluorescence signals as described above.
[0078] Mutation rate experiment: Seven gradient mixtures were set up (mutation rate range from 0.1% to 100%), and the experimental method is as above.
[0079] (2) Experimental results:
[0080] In the sensitivity and detection range study, the experimental results showed that within the concentration range of 0.8 fM to 800 pM, the fluorescence response of the system gradually increased with the increase of p53 R175H concentration. Figure 5 A). Further analysis showed that the fluorescence intensity difference (ΔF, i.e., the fluorescence intensity of the experimental group minus the fluorescence intensity of the blank group) and the logarithm of the p53 R175H concentration exhibited a good linear relationship in the range of 0.8 fM to 8 pM. Figure 5 (Illustration B) Its linear fitting equation is ΔF = 239.43 + 551.79x (R²) 2 =0.98), where x is the p53 R175H concentration (fM). Similarly, in the concentration range of 8 pM to 800 pM, the fluorescence response of the system gradually increases with the increase of p53 R175H concentration. Figure 5 C), the linear fitting equation for the p53R175H detection is ΔF = -14992.83 + 4424.93x (R 2 =0.99), where x is the p53 R175H concentration (fM) ( Figure 5(D illustration). The theoretical detection limit of this method is as low as 0.29 fM. Compared with existing p53 R175H detection techniques, the p53 R175H detection method based on rolling circle amplification coupled with CRISPR / Cas12a established in this invention has a lower detection limit and a wider detection range.
[0081] Based on this, the method's ability to identify samples with different mutation rates was further explored. The results showed that, within the mutation rate range of 0.1% to 100%, the fluorescence response of the system gradually increased with increasing mutation rate. Figure 5 E). Further analysis showed that the fluorescence intensity difference and mutation rate exhibited a good linear relationship within the range of 0.1% to 100%. Figure 5 The linear fitting equation for F is ΔF = 2540.43326X + 165.99369 (R² = 0.99), where (X is the p53 R175H mutation rate). Through the investigation of the identification ability of samples with different mutation rates, it is demonstrated that the detection method of this invention has excellent resolution and accuracy in complex and realistic gene variation scenarios, and has clinical application value.
[0082] 6. Comparison with standard testing methods and other testing methods
[0083] (1) Experimental method:
[0084] The real-time PCR (RT-qPCR) reaction system was as follows: 12.5 μL TB Green Premix EXTaqII, 1 μL front primer SEQ ID: NO.12 (10 μM), 1 μL back primer SEQ ID: NO.13 (10 μM), 2.5 μL p53 sequence (plasmid) SEQ ID: NO.14 / 2.5 μL p53 R175H sequence (plasmid) SEQ ID: NO.15, and 8 μL ddH2O. The PCR program was as follows: 95 ℃ for 30 seconds; 40 cycles: 95 ℃ for 3 seconds each, followed by 60 ℃ for 30 seconds each. The primer sequences used for RT-qPCR are shown in Table 4 below.
[0085] Table 4. Target genes and primer sequences used in RT-qPCR
[0086]
[0087] (2) Experimental results:
[0088] Figure 5 The G fluorescence spectrum showed that RT-qPCR could amplify p53 R175H but not p53, indicating the feasibility of RT-qPCR in detecting the p53 R175H target gene. Figure 5As shown in H, the actual detection limit of RT-qPCR for p53 R175H is 8 fM, while the actual detection limit of the method described in this invention is 0.8 fM. Compared to the method described in this invention, the high detection limit of RT-qPCR may be due to its reliance on conventional PCR cycle amplification for signal amplification. The efficiency of this amplification method is limited by multiple factors such as primer specificity, annealing temperature, and enzyme activity, and the amount of amplified product is linearly correlated with the initial template amount, resulting in weak signal amplification ability. In contrast, the actual detection limit of the method described in this invention is an order of magnitude higher than that of RT-qPCR. Compared with other reported methods (Table 5), the proposed strategy also shows superior performance in terms of detection limit and detection range.
[0089] Table 5. Comparison with other p53 detection methods
[0090]
[0091] [1]S. Zhou, L. Deng, J. Dong, et al. Electrochemical detection of thep53 gene using exponential amplification reaction (EXPAR) and CRISPR / Cas12areactions. Microchim Acta. 190 (2023) 113.
[0092] [2]Y. Jia, F. Sun, N. Na, et al. Detection of p53 DNA using commercially available personal glucose meters based on rolling circleamplification coupled with nicking enzyme signal amplification. AnalyticaChimica Acta. 1060 (2019) 64-70.
[0093] [3]H. Li, Z. Wu, L. Qiu, et al. Ultrasensitive label-free amplifiedcolorimetric detection of p53 based on G-quadruplex MBzymes. Biosensors andBioelectronics. 50 (2013) 180-185.
[0094] [4]Z. Lin, W. Yang, G. Zhang, et al. An ultrasensitive colorimeterassay strategy for p53 mutation assisted by nicking endonuclease signalamplification. Chem. Commun. 47 (2011) 9069-9071.
[0095] [5]L. Wang, Y. Han, S. Xiao, et al. Reverse strand-displacementamplification strategy for rapid detection of p53 gene. Talanta. 187 (2018)365-369.
[0096] [6]S. Zhou, J. Ran, S. Man, et al. Exploring the Effect of StericHindrance on Trans-cleavage Activity of CRISPR-cas12a for Ultrasensitive SERSDetection of P53 DNA. Analytical Chemistry. 26 (2024) 10654-10661.
[0097] 7. Selective and Repeated Inquiry
[0098] (1) Experimental method:
[0099] Selectivity assay: Mix 2 μL of other genes (SEQ ID: NO.5 / NO.6 / NO.9 / NO.11 / NO.16 / NO.17, 100 pM) with 2 μL of lock probe SEQ ID: NO.1 (1 μM) and 1 μL of ddH2O, anneal at 95 °C for 5 minutes, and slowly cool to room temperature. Add 1.5 μL of T4 DNA ligase (2 × 10⁻⁶). 4 U / mL), 1 μL T4 DNA ligase reaction buffer, 1.5 μL Fpg enzyme (4.4 × 10⁻⁶ U / mL), 2The probe was incubated with 1 μL of dNTP mixture (U / mL) and 1 μL of corresponding Buffer 1 at 37 °C for 40 min, then inactivated at 65 °C for 15 min to obtain a closed circular lock probe. Simultaneously, a ribonucleoprotein complex (RNP) was prepared, consisting of 1 μL ddH2O, 2 μL crRNA SEQ ID: NO.4 (0.4 nM), 2 μL Cas12a protein (0.4 nM) (molar ratio 1:1), and 2 μL of corresponding Buffer 1, and incubated at 37 °C for 30 min. The circularized probe was then mixed with 1 μL dNTP mixture (25 mM), 2 μL primer SEQ ID: NO.2 (100 nM), and 2 μL phi29 DNA polymerase (4 × 10⁻⁶ mM). 2 Mix 2 μL of phi29 DNA polymerase reaction buffer, RNP, and 1 μL of fluorescent reporter probe SEQ ID: NO.3 (10 μM) and incubate at 37 °C for 120 minutes. Acquire fluorescence signals as described above. The interference gene E545K and its mutant sequence used in this example are shown in Table 6 below:
[0100] Repeatability experiment: Five parallel experimental groups and a control group were set up, and the experimental method was as described above.
[0101] Table 6. E545K and E545K mutant gene sequences
[0102]
[0103] (2) Experimental results
[0104] Selectivity and reproducibility are crucial for sensing systems. Therefore, this invention first investigates the selectivity of the method described herein for site-specific p53 R175H detection using wild-type p53 and E545K DNA as interfering agents. Figure 6 As can be seen, a significant fluorescence signal only appeared in the presence of p53R175H, while the fluorescence values of other interfering substances at the same concentration were weaker. The repeatability of the method was then assessed by testing the fluorescence responses of five parallel experimental groups and a control group. Figure 6 (B) There was no significant fluctuation in fluorescence values among the groups, and the relative standard deviation (RSD) was 2.6%. The above results indicate that the detection method described in this invention has good selectivity and repeatability.
[0105] 8. Serum spiked detection
[0106] (1) Experimental method:
[0107] The target p53 R175H SEQ ID: NO.6 was serially diluted 20-fold with fetal bovine serum and normal buffer (concentrations of 10 pM, 100 pM, and 1 nM). 2 μL of each target gene solution was mixed with 2 μL of the lock probe SEQ ID: NO.1 (1 μM) and 1 μL of ddH2O, annealed at 95 °C for 5 minutes, and then slowly cooled to room temperature. 1.5 μL of T4 DNA ligase (2 × 10⁻⁶) was added. 4 U / mL), 1 μL T4 DNA ligase reaction buffer, 1.5 μL Fpg enzyme (4.4 × 10⁻⁶ U / mL), 2 The probe was incubated with 1 μL of dNTP mixture (U / mL) and 1 μL of corresponding Buffer 1 at 37 °C for 40 min, then inactivated at 65 °C for 15 min to obtain a closed circular lock probe. Simultaneously, a ribonucleoprotein complex (RNP) was prepared, consisting of 1 μL ddH2O, 2 μL crRNA SEQ ID: NO.4 (0.4 nM), 2 μL Cas12a protein (0.4 nM) (molar ratio 1:1), and 2 μL of corresponding Buffer 1, and incubated at 37 °C for 30 min. The circularized probe was then mixed with 1 μL dNTP mixture (25 mM), 2 μL primer SEQ ID: NO.2 (100 nM), and 2 μL phi29 DNA polymerase (4 × 10⁻⁶ mM). 2 Mix 2 μL of phi29 DNA polymerase reaction buffer, RNP, and 1 μL of fluorescent reporter probe SEQ ID: NO.3 (10 μM) and react at 37 °C for 120 minutes. Acquire fluorescence signals as described above.
[0108] (2) Experimental results:
[0109] The results show that ( Figure 6 C) The fluorescence detection differences of different target concentrations were all within a reasonable range (<15%). This result indicates that even in the complex fetal bovine serum matrix, the signal sensing platform can effectively resist matrix interference and achieve specific detection of p53 R175H, verifying its reliability in real sample analysis.
[0110] Example 4. Detection of clinical samples
[0111] The development and progression of acute myeloid leukemia (AML) are closely related to abnormal activation of oncogenes and inactivation of tumor suppressor genes. Among these, the p53 R175H mutation is a significant driving factor in AML, caused by a G>A base transition in exon 5. The p53 R175H mutation directly disrupts the tumor suppressor function of the p53 protein, is a frequent hotspot mutation in AML, and is significantly associated with poor patient prognosis. The probe designed in this invention can achieve precise and specific matching with the G>A target sequence of the p53 R175H mutation. After binding to the mutant sequence, the probe can initiate a rolling circle amplification reaction, achieving efficient amplification of low-abundance mutant target signals, thereby providing technical support for the precise clinical detection of AML.
[0112] Therefore, this study aims to verify the clinical applicability of a universal detection method for G>A mutations based on the combination of Fpg enzyme and CRISPR / Cas12a. The method was used to conduct actual sample testing and compared with the commonly used clinical p53 R175H mutation RT-qPCR detection method to comprehensively evaluate its detection performance.
[0113] (1) Experimental method:
[0114] Extracting the target gene from the sample to be tested: Take 500 mL of blood into a centrifuge tube, add 3 times the volume of red blood cell lysis buffer, and then use a DNA extraction kit to extract genomic DNA from the blood as the target gene. The concentration of the extracted target gene is then measured using a NanoDrop micro spectrophotometer.
[0115] Clinical sample testing: 4 μL of clinical sample DNA from leukemia patients and normal individuals was mixed with 2 μL of lock probe SEQ ID: NO.1 (1 μM) and 1 μL of ddH2O. The mixture was annealed at 95 °C for 5 minutes and then slowly cooled to room temperature. 1.5 μL of T4 DNA ligase (2 × 10⁻⁶) was added. 4 U / mL), 1 μL T4 DNA ligase reaction buffer, 1.5 μL Fpg enzyme (4.4 × 10⁻⁶ U / mL), 2The probe was incubated with 1 μL of dNTP mixture (U / mL) and 1 μL of corresponding Buffer 1 at 37 °C for 40 min, then inactivated at 65 °C for 15 min to obtain a closed circular lock probe. Simultaneously, a ribonucleoprotein complex (RNP) was prepared, consisting of 1 μL ddH2O, 2 μL crRNA SEQ ID: NO.4 (0.4 nM), 2 μL Cas12a protein (0.4 nM) (molar ratio 1:1), and 2 μL of corresponding Buffer 1, and incubated at 37 °C for 30 min. The circularized probe was then mixed with 1 μL dNTP mixture (25 mM), 2 μL primer SEQ ID: NO.2 (100 nM), and 2 μL phi29 DNA polymerase (4 × 10⁻⁶ mM). 2 Mix 2 μL of phi29 DNA polymerase reaction buffer, RNP, and 1 μL of fluorescent reporter probe SEQ ID: NO.3 (10 μM) and react at 37 °C for 120 minutes. Acquire fluorescence signals as described above.
[0116] RT-qPCR reaction: 12.5 μL TB Green Premix EX TaqII, 1 μL front primer SEQ ID: NO.12 (10 μM), 1 μL back primer SEQ ID: NO.13 (10 μM), genomic DNA extraction (280 ng), 8.5 μL ddH2O. The PCR program was as follows: 95 ℃ for 30 seconds; 40 cycles: 95 ℃ for 3 seconds each, followed by 60 ℃ for 30 seconds. The primer sequences used for RT-qPCR are shown in Table 4.
[0117] (2) Experimental results:
[0118] The experimental results of the detection method of this invention show that ( Figure 7 A) The fluorescence intensity of healthy control samples remained at a low baseline level, below the preset positive threshold, indicating that the p53 R175H mutation was not detected. In 6 AML patient samples, 6 samples were positive for the p53 R175H mutation. The fluorescence signal intensity of these samples was significantly higher than the baseline level of healthy control samples, and all exceeded the preset positive threshold, exhibiting clear positive detection characteristics. Compared with the standard clinical sample detection method (RT-qPCR), the results of this invention are as follows: Figure 7As shown in B-7H, the mutation detection results of the two methods are completely consistent, with both the positive and negative concordance rates being 100%. This confirms that the universal detection method for G>A mutations based on the combination of Fpg enzyme and CRISPR / Cas12a constructed in this invention has high accuracy in detecting target mutations. This invention can accurately and efficiently identify patients with acute myeloid leukemia and precisely distinguish them from the normal population, meeting the practical application needs of clinical diagnosis and large-scale population screening. It provides a reliable technical means for early screening, disease monitoring, and population triage of acute myeloid leukemia, and has significant clinical application value and promising prospects for promotion.
[0119] In summary, this invention successfully constructed and validated a universal detection method for G>A mutations based on the combination of Fpg enzyme and CRISPR / Cas12a. The core innovation lies in the specific recognition of 8-oxoguanine by Fpg enzyme and the probe circularization regulation mechanism, combined with rolling circle amplification and the cascade signal amplification system of CRISPR / Cas12a. This breakthrough solves the core bottlenecks of existing mutation detection technologies, such as the lack of universality due to restriction endonuclease dependence and the strict dependence of Cas protein on the target PAM site, achieving broad-spectrum and accurate detection of all G>A point mutations.
[0120] Performance validation results show that this method detects p53 R175H mutations in a range from 0.8 fM to 800 pM, with a theoretical detection limit as low as 0.29 fM, significantly outperforming existing quantitative real-time PCR (detection limit 8 fM) and other reported techniques. Within the 0.1% to 100% mutation rate range, the fluorescence intensity difference exhibits an excellent linear relationship with the mutation rate (R² = 0.99), enabling accurate quantification of samples with low mutation rates. Furthermore, the method demonstrates excellent selectivity, repeatability (relative standard deviation RSD = 2.6%), and resistance to interference, maintaining stable detection even in complex matrices containing 5% serum. Most importantly, clinical sample validation results further confirm that this method can effectively differentiate between clinically diagnosed patients with tumor-associated G>A mutations and healthy individuals who are mutation-negative, enabling early screening and accurate differentiation of diseased individuals. This addresses the critical issue of difficulty in accurately distinguishing early-stage tumor patients from healthy individuals, leading to frequent missed diagnoses and misdiagnoses.
[0121] In summary, the method of this invention innovatively avoids restriction endonuclease and PAM site dependence, possessing high sensitivity, high specificity, wide detection range, and strong anti-interference ability. It can accurately distinguish between clinically ill and healthy individuals, offering high detection efficiency, low operating costs, and wide applicability. It provides an efficient and reliable technical tool for the precise clinical diagnosis of tumor-related G>A mutation genes, demonstrating significant clinical translational value and broad application prospects. Future research can further optimize the reaction system, develop portable detection devices by combining microfluidic chips and lateral flow chromatography test strips, explore its performance in liquid biopsies (such as cell-free DNA detection in blood), and promote the translation of this technology towards point-of-care testing (POCT).
[0122] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit the technical solutions. Those skilled in the art should understand that any modifications or equivalent substitutions to the technical solutions of the present invention without departing from the spirit and scope of the present invention should be covered within the scope of the claims of the present invention.
Claims
1. A latching probe for detecting G>A mutations in gene mutations, characterized in that: The lock probe contains a recognition sequence complementary to the target p53 R175H and a sequence recognized by CRISPR / Cas12a, and is modified with 8-oxoguanine.
2. The locking probe according to claim 1, characterized in that: The base sequence of the lock-in probe is: p-GGGGGCAG / i8oxodG / GCCTCACAACCTTCTCTGCTCGACGGAAATAAGAGATAATAAGAGATCGCTCATGGT.
3. A universal detection kit for G>A mutation based on the combination of Fpg enzyme and CRISPR / Cas12a, characterized in that: Includes the lock-type probe as described in claim 1 or 2, as well as a fluorescent reporter probe, primers, and crRNA; wherein the fluorescent reporter probe is modified with fluorescent groups and quenching groups at both ends, and can be cleaved by the trans-cleavage activity activated by Cas12a, with the sequence: HEX-TATTATT-BHQ1. The primers described can bind to circularized lock probes, and after amplification, long repeat single-stranded DNA is obtained with the base sequence: TCCGTCGAGCAGAGAA; The crRNA binds to the Cas12a protein to form a ribonucleoprotein complex with the following base sequence: UAAUUUCUACUAAGUGUAGAUAAUAAGAGAUAAUAAGAGAU.
4. The universal detection kit for G>A mutation based on the combination of Fpg enzyme and CRISPR / Cas12a according to claim 3, characterized in that: It includes T4 DNA ligase, Fpg enzyme, phi29 DNA polymerase, and Cas12a protein.
5. A method for detecting G>A mutations, characterized in that: It is detected using the universal detection kit for G>A mutation based on Fpg enzyme and CRISPR / Cas12a as described in claim 3 or 4, and includes the following steps: a. Extract genomic DNA from the sample to be tested as the target gene to be tested; b. Circularization reaction of the lock probe and preparation of ribonucleoprotein complex: The target gene from step a is mixed with the lock probe, T4 DNA ligase, and Fpg enzyme, and incubated after denaturation and annealing to obtain the circularized probe; at the same time, crRNA and Cas12a protein are mixed and incubated to obtain the ribonucleoprotein complex. c. Rolling circle amplification reaction and Cas12a cleavage reaction: The circularized probe prepared in step b is mixed with primers, dNTPs, phi29 DNA polymerase, fluorescent reporter probe, and ribonucleoprotein complex and incubated. d. Fluorescence detection: The detection results of the target gene are obtained by detecting the fluorescence signal of the fluorophore-quencher labeled ssDNA reporter molecule.
6. The G>A mutation detection method according to claim 5, characterized in that: The samples to be tested in step a include isolated blood, body fluids, tissues, or cells; the incubation temperature in steps b and c is 37 ℃.
7. The G>A mutation detection method according to claim 5 or 6, characterized in that: Step b describes the cyclization reaction of the lock probe and the preparation of the ribonucleoprotein complex as follows: The target gene, lock probe, and ddH2O are mixed, denatured at 95 °C for 5 minutes, and then slowly annealed at room temperature; a concentration of 1.1 × 10⁻⁶ is added... 4 ~4×10 4 T4 DNA ligase at a concentration of 0.3 × 10⁻⁶ U / mL, T4 DNA ligase buffer. 3 ~1.3×10 3 Incubate with Fpg enzyme at a concentration of U / mL and corresponding Buffer 1 for 20-60 minutes to obtain a circular probe; simultaneously prepare the Cas12a ribonucleoprotein complex, including ddH2O, corresponding Buffer 1, and crRNA / Cas12a protein (molar ratio 1:1), all at a concentration of 0.1-1 nM, and incubate for 30 minutes to obtain the ribonucleoprotein complex. Step c: Rolling circle amplification and Cas12a cleavage reaction: The circularized probe is reacted with 100 nM primers, 25 mM dNTPs, phi29 DNA polymerase reaction buffer, and a concentration of 0.2 × 10⁻⁶ mM. 3 ~1×10 3 Incubate a mixture of U / mL phi29 DNA polymerase, 10 nM fluorescent reporter probe, and 0.1–1 nM ribonucleoprotein complex for 60–160 minutes.
8. The G>A mutation detection method according to claim 7, characterized in that: The concentration of T4 DNA ligase in step b is 2 × 10⁻⁶. 4 U / mL, Fpg enzyme concentration is 4.4 × 10⁻⁶. 2 U / mL, incubation time 40 minutes; The concentration of phi29 DNA polymerase in step c is 4 × 10⁻⁶. 2 U / mL, ribonucleoprotein complex 0.4 nM, incubation time 120 minutes.
9. The use of the lock-in probe for detecting G>A mutations in gene mutations as described in claim 1 or 2, and the universal detection kit for G>A mutations based on Fpg enzyme combined with CRISPR / Cas12a as described in claim 3 or 4, in the preparation of kits for diagnosing leukemia or tumors.
10. The use according to claim 9, characterized in that: The leukemia mentioned is acute myeloid leukemia, and the tumors mentioned include lung cancer, breast cancer, colorectal cancer, and glioblastoma.