Method for improving genetic stability of PolyA tail of mRNA
By designing and selecting host cells for the three-segmented PolyA polynucleotide sequence A1-G-A2-G-A3, the product heterogeneity and high cost of mRNA PolyA tails were solved, achieving genetic stability and applicability for large-scale production of PolyA tails.
Patent Information
- Application Number
- CN202511766656.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-27
- Publication Date
- 2026-04-07
AI Technical Summary
Existing technologies for preparing polyA tails for mRNA suffer from product heterogeneity, high costs, cumbersome enzymatic tailing steps, and are not suitable for large-scale production. The continuous adenine tailing strategy encoded by the plasmid template is prone to sequence mutations and length heterogeneity.
The design employs a three-segmented PolyA polynucleotide sequence A1-G-A2-G-A3. By dividing the PolyA tail sequence into three segments and using specific host cells such as DH5a, Stbl3, and JM109, combined with enzyme digestion linearization and transcription processes, the genetic stability of the PolyA tail is ensured.
It achieves high-efficiency PolyA tail genetic stability, significantly reduces preparation costs, is suitable for GMP production, and does not affect the scale-up of Oligo-dT binding and mRNA vaccine production.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to a method for preparing mRNA containing a PolyA tail, which can improve the genetic stability of the PolyA tail in mRNA, and belongs to the field of molecular biology technology. Background Technology
[0002] In eukaryotes, polyadenylation (PolyA tail) of mRNA is present on almost every mRNA. The PolyA tail contributes to the translational state and stability of mRNA, playing a major regulatory role in gene expression in the cytoplasm. The average length of the PolyA tail in mammals is approximately 200 nt, while in yeast it is approximately 70 nt.
[0003] In the in vitro production of mRNA, post-transcriptional enzymatic tailing is one of the ways mRNA forms a PolyA tail. Post-transcriptional enzymatic tailing relies on E. coli Poly(A) Polymerase (PAP) to convert free ATP in the reaction system into AMP, which is added to the 3' end of the mRNA, extending it into a PolyA tail, without relying on DNA or RNA templates. In the PolyA tailing reaction, the tail length depends on the molar concentration of the RNA 3'-OH terminus, reaction time, enzyme quantity, and ATP concentration. The tail length can be adjusted by changing one or more of these factors. However, the final product of enzymatic tailing cannot guarantee tails of uniform length; therefore, the resulting final product is a mixture of mRNAs with tails of varying lengths, resulting in heterogeneous mRNA, which clearly fails to meet the quality control requirements of GMP-level production. Furthermore, E. coli PolyA polymerase requires an alkaline environment to function (pH > 7.5), and mRNA is easily hydrolyzed under alkaline conditions, especially transcripts longer than 3kb. Therefore, enzymatic tailing will cause a certain degree of mRNA degradation. In addition to the problem of product heterogeneity, enzymatic tailing is cumbersome and costly, making it unsuitable for large-scale GMP-level production.
[0004] The plasmid template-encoded continuous adenine tail strategy is another common method for forming a PolyA tail from mRNA. This involves inserting 120 consecutive adenine (A) bases into the 3' end of the target gene sequence in a plasmid vector using molecular cloning technology to construct a recombinant plasmid template containing this sequence. In vitro transcription mediated by T7 RNA polymerase can then generate an RNA transcript with a PolyA tail consisting of 120 adenine bases at the 3' end in one step. However, this method is difficult to implement. The long, continuous A base sequence is prone to forming secondary structures such as hairpins during gene synthesis, making gene synthesis and sequencing identification challenging. The template plasmid also suffers from poor stability and is prone to mutation. The 120 consecutive adenine (A) sequence is susceptible to mutation during plasmid passage due to polymerase slippage during DNA replication. Mismatches between the template strand and the nascent strand are also common during replication fork passage, leading to insertion or deletion of A bases, resulting in increased heterogeneity in the length of the target PolyA tail, and even the loss of some sequence. Summary of the Invention
[0005] One object of the present invention is to provide a technique for improving the genetic stability of the PolyA tail of mRNA.
[0006] This invention provides a strategy for maintaining the genetic stability of the plasmid PolyA sequence, including the selection of bacterial strains and the design of the PolyA tail sequence, which can achieve high genetic stability of the plasmid PolyA tail sequence.
[0007] Specifically, on the one hand, the present invention provides a method for preparing mRNA containing a PolyA tail, the method comprising: The plasmid vector containing the three-segmented PolyA polynucleotide was transferred into the host cell and cultured to obtain the culture. Plasmid vectors containing PolyA polynucleotides were isolated and / or recovered from the culture and linearized by enzyme digestion to form mRNA transcription templates; The mRNA transcription template was transcribed to obtain mRNA containing a PolyA tail; The nucleotide sequence of the three-segmented PolyA polynucleotide is: A1-G-A2-G-A3, wherein A1, A2, and A3 are each independently a polynucleotide fragment composed of 30-45 consecutive nucleotides A. The host cell is selected from one or more of DH5a, Stbl3, and JM109.
[0008] In the nucleotide sequence of this invention, nucleotide A is adenosine monophosphate and G is guanosine monophosphate.
[0009] The method of this invention achieves high genetic stability of the plasmid PolyA tail sequence, providing a way to improve the genetic stability of the PolyA tail during the preparation of PolyA-tailed mRNA. This method avoids expensive enzymatic tailing methods, significantly reducing preparation costs. Furthermore, the genetic stability of the PolyA tail facilitates the construction of GMP-compliant tertiary strain libraries. In addition, the PolyA tail of this invention binds stably to Oligo-dT, without affecting the Oligo-dT process, which is beneficial for the scale-up preparation of mRNA vaccines and related products.
[0010] According to some specific embodiments of the present invention, in the method for preparing mRNA containing a PolyA tail, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, A1, A2, and A3 are each independently a polynucleotide fragment composed of 35, 36, 37, 38, 39, 40, 41, or 42 consecutive nucleotides A.
[0011] According to some specific embodiments of the present invention, in the method for preparing mRNA containing a PolyA tail, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, A1, A2, and A3 are each independently selected from a polynucleotide fragment composed of 35, 38, or 42 consecutive nucleotides A.
[0012] According to some specific embodiments of the present invention, in the method for preparing mRNA containing a PolyA tail, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, at least two segments of A1, A2, and A3 are polynucleotide fragments composed of continuous nucleotide A of the same length.
[0013] According to some specific embodiments of the present invention, in the method for preparing mRNA containing a PolyA tail, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, A1, A2, and A3 are polynucleotide fragments composed of consecutive nucleotides A of the same length.
[0014] According to some specific embodiments of the present invention, in the method for preparing mRNA containing a PolyA tail, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, A1, A2, and A3 are polynucleotide fragments composed of 35 consecutive nucleotides A.
[0015] According to some specific embodiments of the present invention, in the method for preparing mRNA containing a PolyA tail, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, A1, A2, and A3 are polynucleotide fragments composed of 38 consecutive nucleotides A.
[0016] According to some specific embodiments of the present invention, in the method for preparing mRNA containing a PolyA tail, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, A1 is a polynucleotide fragment composed of 36 consecutive nucleotide A, A2 is a polynucleotide fragment composed of 37 consecutive nucleotide A, and A3 is a polynucleotide fragment composed of 38 consecutive nucleotide A.
[0017] According to some specific embodiments of the present invention, in the method for preparing mRNA containing a PolyA tail, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, A1, A2, and A3 are polynucleotide fragments composed of 42 consecutive nucleotides A.
[0018] According to some specific embodiments of the present invention, in the method for preparing mRNA containing a PolyA tail, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, A1 is a polynucleotide fragment composed of 40 consecutive nucleotides A, A2 is a polynucleotide fragment composed of 42 consecutive nucleotides A, and A3 is a polynucleotide fragment composed of 42 consecutive nucleotides A.
[0019] According to some specific embodiments of the present invention, in the method for preparing mRNA containing a PolyA tail, the host cell is JM109.
[0020] According to some specific embodiments of the present invention, the method for preparing mRNA containing a PolyA tail further includes inserting the sequence of the triplet PolyA polynucleotide or an mRNA transcription template construct containing it into a plasmid to obtain a plasmid vector containing the triplet PolyA polynucleotide. The specific operation of this process can be performed with reference to conventional procedures in the art. According to specific embodiments of the present invention, the plasmid can be one or more of, but not limited to, PUC57-KAN, pUC57-GW-KAN, pUC57-GW-AMP, and PUC57-AMP.
[0021] On the other hand, the present invention also provides a three-segmented PolyA polynucleotide with the following nucleotide sequence: A1-G-A2-G-A3, wherein A1, A2, and A3 are each independently a polynucleotide fragment composed of 30-45 consecutive nucleotides A, and A1, A2, and A3 are not simultaneously 40.
[0022] According to some specific embodiments of the present invention, the three-segmented PolyA polynucleotide A1-G-A2-G-A3 of the present invention, wherein A1, A2, and A3 are each independently a polynucleotide fragment composed of 35, 36, 37, 38, 39, 40, 41, or 42 consecutive nucleotides A. According to some specific embodiments of the present invention, the three-segmented PolyA polynucleotide A1-G-A2-G-A3 of the present invention, wherein A1, A2, and A3 are each independently a polynucleotide fragment composed of 35, 38, or 42 consecutive nucleotides A. According to some specific embodiments of the present invention, the three-segmented PolyA polynucleotide A1-G-A2-G-A3 of the present invention, wherein at least two segments of A1, A2, and A3 are polynucleotide fragments composed of consecutive nucleotides A of the same length. According to some specific embodiments of the present invention, the three-segmented PolyA polynucleotide A1-G-A2-G-A3 of the present invention, wherein A1, A2, and A3 are polynucleotide fragments composed of consecutive nucleotides A of the same length, for example, A1, A2, and A3 are all 35, 38, or 42 A's in length.
[0023] On the other hand, the present invention also provides an mRNA transcription template construct having the structure of Formula I: L1-L2-L3-L4-L5-L6-L7 Formula I Wherein, L1 and L7 are restriction enzyme sites or are absent; L2 is a promoter element or internal ribosome entry site sequence IRES, or is absent; L3 is a 5' UTR element, the 5' end of which may be modified with a Cap structure; L4 is a replaceable coding region; L5 is a 3' UTR element; and L6 is the nucleotide sequence of the three-segmented PolyA polynucleotide described above according to the present invention.
[0024] According to some specific embodiments of the present invention, in Formula I, the enzyme cleavage site is a restriction enzyme cleavage site, for example, it may be selected from one or more of EcoRI, HindIII, XbaI, BamHI, AccI, SalI, Acc65I, etc.
[0025] According to some specific embodiments of the present invention, in Formula I, the promoter element can be, for example, but not limited to, one or more of T7, etc.
[0026] According to some specific embodiments of the present invention, in Formula I, the 5' UTR element may be selected from, but is not limited to, one or more of the following: 5'UTR HBB (ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC), 5'UTR HBA (ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC), 5'UTR hACTB (ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCCGCCGCCAGCTCAC), and 5'UTR TEV (GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC).
[0027] According to some specific embodiments of the present invention, in Formula I, the Cap structure modification can be, but is not limited to, a Cap1 structure of m7G-PPPNm or a Cap2 structure of m7G-PPPNmNm.
[0028] According to some specific embodiments of the present invention, in Formula I, the 3' UTR element may be selected from, for example, but not limited to, one or more of 3'UTR HBB, 3'UTR HBA, 3'UTR DEN2, etc.Specifically, the sequence information is as follows: 3'UTR HBBs - GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA; 3'UTR HBA - CTGGAGCCTCGGTAGCCGTTCCTCCTGCCCGCTGGGCCTCCCAACGGGCCCTCCTCCCCTCCTTGCACCGGCCCTTCCTGGTCTTTGAATAAAGTCTGAGTGGGCAGCA; 3'UTR DEN2 - AAAGCAAAACTAACATGAAACAAGGCTAGAAGTCAGGTCGGATTAAGCCATAGTACGGAAAAAACTATGCTACCTGTGAGCCCCGTCCAAGGACGTTAAAAGAAGTCAGGCCATCATAAATGCCATAGCTTGAGTAAACTATGCAGCCTGTAGCTCCACCTGAGAAGGTGTAAAAAATCCGGGAGGCCACAAACCATGGAAGCTGTACGCATGGCGTAGTGGACTAGCGGTTAGAGGAGACCCCTCCCTTACAAATCGCAGCAACAATGGGGGCCCAAGGCGAGATGAAGCTGTAGTCTCGCTGGAAGGACTAGAGGTTAGAGGAGACCCCCCCGAAACAAAAAACAGCATATTGACGCTGGGAAAGACCAGAGATCCTGCTGTCTCCTCAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAATGGTGCTGTTGAATCAACAGGTTCT; 3'UTR HBB - GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATTGCCATGTGTATGTGGGTTCGCCCACATACTCTGATGATCCCCAATCGTGGCGTGTCGGCCTGCTTCGGCAGGCACTGGCGCCGGGATCATTCATGGCAA。
[0029] According to some specific embodiments of the present invention, in Formula I, the alternative coding region may be selected from one or more of reporter genes (such as Luciferase, GFP, mCheery), antigens, cytokines, etc.
[0030] On the other hand, the present invention also provides a plasmid vector containing the trisemiconductor PolyA polynucleotide according to the present invention or the mRNA transcription template construct according to the present invention. The trisemiconductor PolyA polynucleotide or the mRNA transcription template construct according to the present invention can be inserted into the plasmid vector using any feasible method in the art, thereby constructing the plasmid vector of the present invention containing the trisemiconductor PolyA polynucleotide. Specifically, restriction enzyme sites can be added to the ends of the trisemiconductor PolyA polynucleotide as needed during construction.
[0031] On the other hand, the present invention also provides a host cell into which a plasmid vector containing a three-segmented PolyA polynucleotide is introduced, wherein the nucleotide sequence of the three-segmented PolyA polynucleotide is: A1-G-A2-G-A3, wherein A1, A2, and A3 are each independently a polynucleotide fragment composed of 30-45 consecutive nucleotides A; the host cell is selected from one or more of DH5a, Stbl3, and JM109.
[0032] According to some specific embodiments of the present invention, in the host cell of the present invention, there are three polyA polynucleotide segments A1-G-A2-G-A3, wherein A1, A2, and A3 are each independently a polynucleotide fragment composed of 35, 36, 37, 38, 39, 40, 41, or 42 consecutive nucleotides A. Preferably, A1, A2, and A3 are each independently a polynucleotide fragment composed of 35, 38, or 42 consecutive nucleotides A. Preferably, at least two or three of A1, A2, and A3 are polynucleotide fragments composed of consecutive nucleotides A of the same length, for example, A1, A2, and A3 are all 35, 38, or 42 A's in length. In some specific embodiments of the present invention, the host cell of the present invention is JM109.
[0033] On the other hand, the present invention also provides an mRNA containing a PolyA tail, wherein the mRNA comprises: (1) mRNA with a PolyA tail having the nucleotide sequence A1-G-A2-G-A3, wherein A1, A2, and A3 are each independently a polynucleotide fragment consisting of 30-45 consecutive A nucleotides, provided that A1, A2, and A3 are not simultaneously 40; and / or (2) mRNA prepared according to the method for preparing mRNA containing PolyA tail described above in this invention.
[0034] According to some specific embodiments of the present invention, the mRNA of the present invention has a structure of Formula II: L3'-L4'-L5'-L6' Form II Wherein, L3' is a 5' UTR element, and the 5' end of the 5' UTR element may be modified with a Cap structure; L4' is a replaceable coding region; L5' is a 3' UTR element; L6' is the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide according to the present invention.
[0035] On the other hand, the present invention also provides a lipid nanoparticle encapsulating the mRNA described in the present invention.
[0036] According to some specific embodiments of the present invention, the lipid nanoparticles of the present invention may contain ionizable cationic lipids, PEG-modified lipids, sterols and cofactor phospholipids, etc., wherein the sterols may be steroids, cholesterol, etc.
[0037] On the other hand, the present invention also provides a pharmaceutical composition comprising the mRNA or lipid nanoparticles described herein, and further comprising pharmaceutically acceptable excipients.
[0038] On the other hand, the present invention also provides one or more of the following uses for the said mRNA or the said lipid nanoparticles: (1) Uses in the preparation of mRNA drugs; (2) Use in in vitro expression of the target protein.
[0039] According to some specific embodiments of the present invention, the mRNA drug comprises the mRNA or lipid nanoparticles described in this invention, and further comprises pharmaceutically acceptable excipients. The preparation of the mRNA drug mainly involves mixing the mRNA or lipid nanoparticles with necessary excipients, and preparing the mRNA drug as needed.
[0040] According to some specific embodiments of the present invention, the use of the mRNA or the lipid nanoparticles in the preparation of mRNA drugs, i.e., a method for preparing mRNA drugs, includes: The mRNA transcription template was transcribed according to the method for preparing polyA-tailed mRNA according to the present invention to obtain a transcription product. The transcript was purified using Oligo-dT to obtain purified mRNA; Optionally, the purified mRNA is combined with lipids to prepare lipid nanoparticles encapsulating the mRNA; The purified mRNA or the lipid nanoparticles are combined with pharmaceutically acceptable excipients (e.g., sucrose, trehalose, maltose, etc.) to prepare mRNA drugs.
[0041] According to some specific embodiments of the present invention, the mRNA drug is an mRNA vaccine.
[0042] According to some specific embodiments of the present invention, the use of the mRNA or the lipid nanoparticles in the in vitro expression of a target protein, i.e., a method for in vitro expression of a target protein, includes: The mRNA transcription template was transcribed according to the method for preparing polyA-tailed mRNA according to the present invention to obtain a transcription product. The transcript was purified using Oligo-dT to obtain purified mRNA; Optionally, the purified mRNA is combined with lipids to prepare lipid nanoparticles encapsulating the mRNA; The purified mRNA or the lipid nanoparticles were transfected into cells (including but not limited to cell lines such as 293T, HeLa, B16-F10, 3T3-L1, TC1, Raw264.7, THP1, and primary cells such as bone marrow-derived macrophages, bone marrow-derived dendritic cells, peritoneal macrophages, and peripheral blood mononuclear cells), and cultured in vitro to produce the target protein.
[0043] The technology of this invention, through PolyA tail sequence design and host cell screening, can maintain the stability of the PolyA tail during plasmid amplification and recovery, significantly reducing industrial production costs. This invention achieves over 90% genetic stability of the plasmid PolyA tail sequence and over 90% recovery stability, without affecting the stability of the mRNA itself, mRNA protein translation efficiency, or Oligo dT chromatography purification process. The genetic stability of the PolyA tail in this invention facilitates the construction of GMP-compliant tertiary bacterial strain libraries and is also suitable for antigen or protein expression and animal efficacy studies involved in mRNA vaccine or mRNA drug development. The stable binding of the PolyA tail to Oligo-dT in this invention is beneficial for the scale-up preparation of mRNA vaccines and products. Attached Figure Description
[0044] Figure 1 The carrier and PolyA tail designed in a specific embodiment of the present invention are shown.
[0045] Figure 2 This is a schematic diagram of the PUC57-KAN plasmid backbone structure.
[0046] Figure 3 A schematic diagram of the T7-PolyA expression backbone structure.
[0047] Figure 4 This demonstrates the stability of L120-Luc in amplification cultures of different strains.
[0048] Figure 5 The PolyA tail sequence of the present invention can significantly improve the genetic stability of the PolyA tail in DH5a strain.
[0049] Figure 6 The PolyA tail sequence of the present invention can significantly improve the genetic stability of the PolyA tail in the Stbl3 strain.
[0050] Figure 7 The PolyA tail sequence of the present invention can significantly improve the genetic stability of the PolyA tail in strain JM109.
[0051] Figure 8 This demonstrates the stability of the strain's recovery.
[0052] Figures 9-13 This demonstrates that the PolyA tail sequence of the present invention does not affect Oligo-dT binding.
[0053] Figure 14 The results of agarose gel electrophoresis show the polyA tail sequence mRNA sample of the present invention purified and recovered by Oligo-dT.
[0054] Figure 15 This demonstrates that the PolyA tail sequence of the present invention does not affect the stability of the mRNA molecule itself in vitro.
[0055] Figure 16 This demonstrates that the PolyA tail sequence of the present invention does not affect the stability of the mRNA molecule itself in vitro.
[0056] Figure 17 This demonstrates that the PolyA tail sequence of the present invention does not affect the in vitro protein expression of mRNA transfected using the Lipo3000 transfection reagent.
[0057] Figure 18 This demonstrates that the PolyA tail sequence of the present invention does not affect the in vitro protein expression of mRNA-LNP.
[0058] Figures 19-21 This demonstrates that the PolyA tail sequence of the present invention does not affect the in vivo protein expression of mRNA-LNP administered via intramuscular, intraperitoneal, or intravenous injection.
[0059] Figure 22 This presents experimental results demonstrating the applicability of the PolyA tail sequence of this invention with different vector backbones.
[0060] Figure 23This invention demonstrates experimental results on the applicability of the PolyA tail sequence to different ORFs and its compatibility with commonly used pharmaceutical excipients. Detailed Implementation
[0061] To provide a clearer understanding of the technical features, objectives, and beneficial effects of this invention, the technical solution of this invention is described in detail below, but this should not be construed as limiting the scope of implementation of this invention. All original reagents and materials used in the experiments described below are commercially available. Experimental methods without specific conditions are conventional methods and conditions well-known in the art, or according to the conditions recommended by the instrument manufacturer.
[0062] Unless otherwise specifically defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art in the relevant field.
[0063] Design of three-segmented PolyA polynucleotide
[0064] This invention provides a trisemiconductor polyA polynucleotide with the following nucleotide sequence: A1-G-A2-G-A3, wherein A1, A2, and A3 are each independently a polynucleotide fragment composed of 30-45 consecutive nucleotides A. Specifically, this invention provides trisemiconductor polynucleotides as shown in SEQ ID No. 2-SEQ ID No. 5 in Table 1.
[0065] Table 1
[0066] Figure 1 The vector and PolyA tail designed in this embodiment are shown. In the original vector, the polyA tail sequence consists of 120 consecutive adenosine A nucleotides (abbreviated as A120, SEQ ID No. 1). This vector is defined as L120-Luc, where Luc represents the Luciferase gene in the ORF region.
[0067] The basic design strategy of this invention for the three-segmented PolyA polynucleotide is to use a spacer sequence G to divide the conventional polyA tail sequence (A120) into three segments (A120, A ... n _spacer_A n _spacer_An), the spacer sequence is selected with a single base G, and each segment of A n Composed of 35-42 consecutive adenosine nucleotides, this strategy is simply referred to as the "three-segment double-G interval" (A... n _G_A n _G_A n (n=35~42) strategy. When n=35, it represents each segment An Composed of 35 consecutive adenosine nucleotides (abbreviated as A35), with a polytail sequence of A35_G_A35_G_A35, this vector is defined as L35-Luc, where Luc represents the Luciferase gene in the ORF region. When n=38, it represents each A segment n Composed of 38 consecutive adenosine nucleotides (abbreviated as A38), with a polytail sequence of A38_G_A38_G_A38, this vector is defined as L38-Luc, where Luc represents the Luciferase gene in the ORF region. When n=40, it represents each A segment n Composed of 40 consecutive adenosine nucleotides (abbreviated as A40), with a polytail sequence of A40_G_A40_G_A40, this vector is defined as L40-Luc, where Luc represents the Luciferase gene in the ORF region. When n=42, it represents each A segment n Composed of 42 consecutive adenosine nucleotides (abbreviated as A40), with a polytail sequence of A42_G_A42_G_A42, this vector is defined as L42-Luc, where Luc represents the Luciferase gene in the ORF region.
[0068] PolyA-tail design and strain screening to improve the genetic stability of PolyA tails during plasmid amplification.
[0069] Referring to the table above, this invention investigated the genetic stability of the conventional PolyA tail (L120-Luc) and the "three-segment double-G interval" PolyA tail in DH5a, JM109, and Stbl3 bacterial strains. Specifically, the process involved transfecting DH5a and JM109 competent cells with a sequencing-quality-tested plasmid, selecting single colonies for amplification in culture medium, and then extracting the plasmid for Sanger sequencing to assess the stability of the polytail. Given that the PolyA tail consists of a continuous large A fragment, plasmid gene replication and sequencing technologies present a challenge. Therefore, a variation within ±5 bp of the standard PolyA tail sequence length was defined as acceptable and met the stability criteria.
[0070] Validation of the "three-segment double-G spacer" PolyA tail sequence in mRNA preparation and purification, mRNA molecule stability, and protein expression.
[0071] In the preparation and purification of mRNA, the reaction mixture of mRNA obtained by in vitro transcription (IVT) contains not only the desired mRNA product, but also proteins (T7 RNA polymerase, inorganic pyrophosphatase), NTPs, template DNA, salt ions, various additives, and mRNA byproducts formed during IVT (dsRNA, truncated RNA fragments), etc. The presence of these impurities can adversely affect the function of mRNA. The mainstream method for industrial-grade mRNA purification is Oligo dT affinity chromatography. This invention compares the affinity of conventional PolyA tail and "three-segment double G spacer" PolyA tail for Oligo-dT by measuring the absorption peak at 260 in the chromatogram. By calculating the mRNA content before and after chromatography and comparing the difference in recovery rates, the invention demonstrates the compatibility of its design strategy with the subsequent Oligo-dT purification process.
[0072] Regarding the stability of the mRNA molecule itself, given that the PolyA tail affects the entire half-life of the mRNA molecule, the absolute mRNA molecule content of conventional PolyA tail and "three-segment double G spacer" PolyA tail was compared under the same transfection conditions using real-time PCR technology, thus demonstrating that the design strategy of this invention is non-inferior in terms of the stability of the mRNA molecule itself.
[0073] Regarding in vitro cell and in vivo animal protein expression, this invention uses two forms: mRNA + Lipo3000 transfection reagent (cell experiments only) and mRNA-LNP. It compares the protein expression of mRNA with conventional PolyA tail and "three-segment double G spacer" PolyA tail under the same transfection amount, thereby demonstrating that the design strategy of this invention is non-inferior in in vitro cell and in vivo animal protein translation.
[0074] Example 1: Genetic stability of the PolyA tail during plasmid amplification.
[0075] 1. Plasmid construction
[0076] (1) Plasmid backbone information
[0077] In this embodiment, the vector used is PUC57-KAN; plasmid backbone information can be found here. Figure 2 .
[0078] The T7-PolyA expression backbone was cloned into PUC57-KAN using the restriction enzyme sites EcoRI and HindIII.
[0079] (2) T7-PolyA expression backbone
[0080] The T7-PolyA expression backbone structure is shown below. Figure 3 .
[0081]
[0082] (3) PolyA sequence information
[0083] In this invention, the experimental plasmids (L35-LUC, L38-LUC, L40-LUC, L42-LUC) were all synthesized by GenScript on the original control plasmid (L120-LUC).
[0084] The "three-segment double-G interval" PolyA tail sequence of this invention, when used in conjunction with the JM109 strain, can significantly improve genetic stability (including transformation stability and recovery stability).
[0085] 2. Plasmid transformation stability
[0086] (1) Transformation: Take 100 μL of competent cell suspension from a -80 ℃ freezer, add 10 μL of recombinant product to the 100 μL of competent cells, shake gently, and place on ice for 20-30 minutes; heat shock in a 42 ℃ water bath for 90 seconds, do not move the centrifuge tube during the heat shock, and immediately place on ice to cool for 2 minutes after the heat shock; add 400 μL of LB liquid medium (antibiotic-free) to the tube, mix well, and incubate at 37 ℃ and 200 rpm for 60 minutes to allow the bacteria to recover to normal growth and express the antibiotic resistance gene encoded by the plasmid; collect the bacterial cells at 3000 rpm for 5 minutes, discard 300 μL of supernatant, resuspend the bacterial cells with the remaining medium, and gently spread them evenly on a plate containing KANA resistance using a sterile spreader. Invert the culture dish and incubate at 37 ℃ for 18 hours.
[0087] (2) Picking single colonies and shaking culture: Add 500 μL of LB liquid medium containing antibiotic (Kana resistant) to a sterile 1.5 ml centrifuge tube; remove the LB plate from the incubator, pick single colony clusters and place them in LB liquid medium containing Kana resistant, one colony per centrifuge tube, and pick 10 single colonies per plate. Incubate at 37℃ and 220 rpm for 6 h, then transfer to 5 ml / 15 ml centrifuge tubes for expansion culture.
[0088] (3) Preservation of bacteria: Preservation of bacteria 1-10: Under aseptic conditions, add 250 μL of overnight culture and 250 μL of 50% glycerol solution to each sterilized 2 mL cryovial, mix gently, and preserve 10 tubes of each type of bacteria; label the name of the culture and the time on the wall of the cryovial, and then store in a freezer at -80℃. The remaining culture solutions are centrifuged and then frozen at -80℃.
[0089] (4) Plasmid extraction: Plasmid extraction was performed on bacterial cultures 1-10 according to the Tiangen plasmid mini-prep kit (DP103), followed by Sanger sequencing.
[0090]
[0091] The L120-Luc plasmid was transformed into JM109, DH5a, and Stbl3 competent cells, respectively. After plating and culturing for 18 hours, single colonies were picked and amplified in liquid LB medium for 18 hours. The bacterial cells were then collected, and plasmids were extracted for PolyA sequencing identification. Figure 4 It can be seen that the PolyA tail of L120-Luc was 100% unstable in the amplification culture of DH5a and Stbl3 strains, but the stability of the PolyA tail was increased to 60% when using the JM109 strain.
[0092]
[0093] Plasmids L120-Luc, L35-Luc, L38-Luc, L40-Luc, and L42-Luc were transformed into DH5α competent cells, plated, and cultured for 18 hours. Single colonies were picked and amplified in liquid LB medium for 18 hours. Plasmids were then extracted from the bacterial cells and identified using PolyA sequencing. Figure 5 It can be seen that, compared with the stability of L120-Luc in DH5a strain (0% transformation stability), the transformation stability of plasmids with PolyA tails of L35-Luc, L38-Luc, L40-Luc, and L42-Luc ranged from 30% to 67%. This indicates that the PolyA tail sequence has a "three-segment double G spacer" (A... n _G_A n _G_A n The design strategy (n=35~42) significantly improves the genetic stability of PolyA tails by 30~67%.
[0094]
[0095] Plasmids L120-Luc, L35-Luc, L38-Luc, L40-Luc, and L42-Luc were transformed into Stbl3 competent cells, plated, and cultured for 18 hours. Single colonies were picked and amplified in liquid LB medium for 18 hours. The bacterial cells were then collected, plasmids were extracted, and PolyA sequencing was performed for identification. Figure 6 It can be seen that, compared with the stability of L120-Luc in the Stbl3 strain (0% transformation stability), the transformation stability of the PolyA tail plasmids L35-Luc, L38-Luc, L40-Luc, and L42-Luc ranged from 0% to 60%. This indicates that the "three-segment double G interval" (An_G_An_G_An, n=35~42) design strategy of the PolyA tail sequence significantly improves the genetic stability of the PolyA tail, with an improvement range of 0% to 60%.
[0096]
[0097] Plasmids L120-Luc, L35-Luc, L38-Luc, L40-Luc, and L42-Luc were transformed into JM109 competent cells, plated, and cultured for 18 hours. Single colonies were picked and amplified in liquid LB medium for 18 hours. The bacterial cells were collected, plasmids were extracted, and PolyA sequencing was performed for identification. Figure 7 As can be seen, compared with the stability of L120-Luc in the JM109 strain (60% transformation stability), the transformation stability of the L35-Luc, L38-Luc, L40-Luc, and L42-Luc plasmids with PolyA tails increased to 90-100%, which is roughly consistent with the previous results. JM109 contributed about 60% of the transformation stability, and the "three-segment double G interval" (An_G_An_G_An, n=35-42) PolyA tail design strategy contributed about 30% of the transformation stability. The combination of the two can achieve 90-100% transformation stability.
[0098] 3. Stability of strain recovery
[0099] Bacterial resuscitation: Add 5 ml of LB liquid medium containing antibiotics (Kana resistant) to a sterile 15 ml centrifuge tube, and transfer the frozen bacterial culture from the -80°C freezer into the 15 ml centrifuge tube for incubation. Incubate at 37°C and 220 rpm for 18 h; then perform Sanger sequencing for identification.
[0100] Sequencing confirmed that the PolyA tail was normal. Bacterial cultures of L120-Luc, L35-Luc, L38-Luc, L40-Luc, and L42-Luc were revived and cultured, and plasmids were extracted from the collected cells for PolyA sequencing identification. Figure 8 It can be seen that when using JM109 competent cells, the PolyA recovery stability of the L120-Luc plasmid is approximately 70%, while the recovery stability of the L35-Luc, L38-Luc, L40-Luc, and L42-Luc plasmids is 100%. In industrial production, a 70% recovery stability poses a significant challenge to constructing a three-tiered strain library. However, the "three-segment double-G interval" (An_G_An_G_An, n=35, 38, 42) PolyA tail design strategy, combined with the JM109 strain, can achieve 100% recovery stability, which is highly beneficial for industrialization.
[0101] Example 2: mRNA preparation, purification, and mRNA-LNP preparation study
[0102] (1) mRNA preparation: Preparation of transcription system: Different templates were prepared into in vitro co-transcription systems for the corresponding mRNA preparation. The specific reaction system is as follows (taking a 15ug plasmid as an example):
[0103] After preparing the above system, place it in a PCR instrument and set the program to react at 37°C for 3.5 hours. Then, add 4 μl of DNase I enzyme to the reaction system and continue to react at 37°C for 15 minutes to digest the residual DNA template.
[0104] (2) mRNA purification
[0105] The L120-Luc-mRNA, L35-Luc-mRNA, L38-Luc-mRNA, L40-Luc-mRNA, and L42-Luc-mRNA samples obtained in step (1) were directly diluted in high-salt loading buffer (10mM Tris-HCl + 1mM EDTA + 0.8M NaCl) and loaded into a POROS™ Oligo (dT)25 pre-packed column. Elution was performed using 10mM Tris-HCl + 1mM EDTA + 0.1M NaCl. NaCl elution removed proteins and small nucleic acid fragments. Finally, the samples were eluted with sterile, enzyme-free water, and the elution peaks were collected to obtain highly pure L120-Luc-mRNA, L35-Luc-mRNA, L38-Luc-mRNA, L40-Luc-mRNA, and L42-Luc-mRNA samples.
[0106] (3) mRNA-LNP preparation
[0107] The mass ratio of mRNA to lipid nanoparticles is 1:25.
[0108] Ionizable cationic lipids SM102, DSPC, cholesterol, and DMG-PEG2000 (molar ratio 50:10:38.5:1.5) were dissolved in anhydrous ethanol to form an organic phase with a total lipid concentration of 10 mg / mL. The mRNA sample obtained in step (2) was dissolved in 50 mM sodium acetate buffer (pH=4) to form an aqueous phase with a mRNA concentration of 0.13 mg / mL. The organic phase and aqueous phase were mixed at a volume ratio of 1:3 using a microfluidic device, and the flow rates of the organic phase and aqueous phase were controlled at 3 mL / min and 9 mL / min, respectively, during mixing. Use 1 to mix the solution PBS was used for dialysis for 2-6 hours, with the dialysate being replaced every 2 hours to remove solvent and unbound mRNA, resulting in mRNA lipid nanoparticle formulation. The particle size and polydispersity were determined by dynamic light scattering, and the mRNA-LNP particle size was 100-150 nm with a polydispersity index of less than 0.2.
[0109] The results of this embodiment show that the "three-segment double G interval" PolyA tail sequence does not affect Oligo-dT binding and purification.
[0110] (1) The "three-segment double-G interval" design strategy of the PolyA tail sequence of the present invention does not affect the Oligo-dT binding.
[0111] The L120-Luc, L35-Luc, L38-Luc, L40-Luc, and L42-Luc mRNA samples obtained after purification with magnetic beads were directly diluted in high-salt (10mM Tris-HCl + 1mM EDTA + 0.8 M NaCl) loading buffer and loaded onto an Oligo-dT chromatography column. Elution was performed using 10mM Tris-HCl + 1mM EDTA + 0.1 M NaCl. NaCl elution removed proteins and small nucleic acid fragments. Finally, sterile, enzyme-free water was used for elution, and the elution peak was collected to obtain highly pure mRNA-Luc samples. Figures 9-13 As can be seen, impurities flow through the column and mRNA can be adsorbed onto the Oligo-dT chromatography column, indicating that the "three-segment double G spacer" design strategy of the PolyA tail sequence does not affect Oligo-dT binding.
[0112] (2) The PolyA tail sequence “three-segment double G interval” design strategy of the present invention, the mRNA sample is purified and recovered by Oligo-dT, and identified by agarose gel, the band is single and correct ( Figure 14 ).
[0113] (3) The “three-segment double G interval” design strategy of the PolyA tail sequence of the present invention does not affect the purification and recovery efficiency of Oligo-dT.
[0114]
[0115] Example 3: Study on the stability of mRNA molecules themselves
[0116] (1) mRNA / mRNA-LNP transfection: HEK293T cells were cryopreserved and passaged 3-4 times before the transfection experiment. Cells were plated one day in advance (12-well plate). When the cell confluence reached about 85%, cell transfection was performed. 1 μg of mRNA / mRNA-LNP was transfected into each well, and 3 replicates were set up for each sample. mRNA-LNP transfection: The mRNA-LNP complex was directly added to the cells. mRNA transfection: The procedure was performed according to the Lipofectamine 3000 reagent instructions. mRNA and Lipofectamine 3000 liposomes were added to the cells. The cell pellet was harvested by centrifugation 24 h after transfection.
[0117] (2) qPCR quantification: RNA extraction from 293T cells was performed using the Easy Fast Animal Tissue / Cell Total RNA Extraction Kit (DP451). The extracted total RNA was reverse transcribed using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper). After reverse transcription, all PCR tubes were removed from the PCR instrument for further experiments or frozen at -20°C for later use. The obtained cDNA was then used for qPCR quantification. Specific procedures and qPCR reaction protocols were referenced from the ChamQ Universal SYBR qPCR Master Mix (2X) kit. The solution preparation system is shown in the table below.
[0118] The primers and sequences involved are as follows:
[0119] After the reaction, data analysis was performed. The internal reference genes of each sample were normalized, and the relative expression levels of mRNA / mRNA-LNP were analyzed.
[0120] The experiments in this embodiment demonstrate that when using the Lipo3000 transfection reagent to transfect cells, the "double G" design strategy of the PolyA tail sequence does not affect the stability of the mRNA molecules themselves in vitro. Equal amounts of L120-Luc, L35-Luc, L38-Luc, L40-Luc, and L42-Luc mRNA were transfected into 293T cells with Lipo3000. After 24 hours, the cell pellet was collected, total mRNA molecules were extracted, and cDNA was reverse transcribed for qPCR quantification. See the experimental results below. Figure 15 The results show that the mRNA expression levels of L35-Luc, L38-Luc, L40-Luc, and L42-Luc are not inferior to those of L120-Luc. This indicates that the "three-segment double G interval" (An_G_An_G_An, n=35, 38, 42) design strategy of PolyA tail sequence does not affect the stability of the mRNA molecule itself and is suitable for in vitro cell transfection studies.
[0121] The experiments in this embodiment demonstrate that the "double G" design strategy of the PolyA tail sequence does not affect the stability of the mRNA molecules themselves when mRNA molecules are encapsulated into mRNA-LNP transfection cells. The mRNAs of L120-Luc, L35-Luc, L38-Luc, L40-Luc, and L42-Luc were encapsulated into mRNA-LNP vaccines. After transfecting 293T cells with equal amounts of mRNA-LNP vaccines for 24 hours, the cell pellet was collected, total mRNA molecules were extracted, and cDNA was reverse transcribed for qPCR quantification. See the experimental results below. Figure 16 This indicates that the mRNA expression levels of L35-Luc, L38-Luc, L40-Luc, and L42-Luc are not inferior to those of L120-Luc. This demonstrates that the "three-segment double G interval" (An_G_An_G_An, n=35, 38, 42) design strategy for PolyA tail sequences does not affect the stability of the mRNA molecule itself and is suitable for in vitro cell experiments of vaccines adapted to mRNA-LNP.
[0122] Example 4: Study on mRNA and mRNA-LNP protein expression
[0123] 1. Study on in vitro expression of mRNA and mRNA-LNP proteins
[0124] mRNA / mRNA-LNP transfection: HEK293T cells were cryopreserved and passaged 3-4 times before transfection. Cells were plated one day in advance (in 12-well plates). When cell confluence reached approximately 85%, transfection was performed, transfecting 1 μg of mRNA / mRNA-LNP into each well, with 3 replicates per sample. mRNA-LNP transfection: The mRNA-LNP complex was directly added to the cells. mRNA transfection: Following the Lipofectamine 3000 reagent instructions, mRNA and Lipofectamine 3000 liposomes were added to the cells.
[0125] 24 hours after transfection, the cells were resuspended by pipetting with 1 ml PBS. 100 μl of the cell suspension was placed in a 96-well plate, and an equal volume of luciferin working solution was added for in vitro bioluminescence detection of Luciferin protein expression.
[0126] The experiments in this embodiment demonstrate that when mRNA is transfected into cells using the Lipo3000 transfection reagent, the "three-segment double-G spacer" design strategy for the PolyA tail sequence does not affect the in vitro protein expression of mRNA-LNP. Equal amounts of L120-Luc, L35-Luc, L38-Luc, L40-Luc, and L42-Luc mRNA were transfected into 293T cells with Lipo3000 for 24 hours. Cell pellets were collected, lysed using RIPA, and Luciferase expression levels were detected using a luciferin potassium substrate. See the experimental results below. Figure 17 The results show that the expression levels of Luciferase protein in L35-Luc, L38-Luc, L40-Luc, and L42-Luc are at the same level as those in L120-Luc. This indicates that the "three-segment double G interval" design strategy of PolyA tail sequence does not affect the translation efficiency of mRNA molecules and is suitable for in vitro cell transfection studies.
[0127] The experiments in this embodiment demonstrate that the PolyA tail sequence "double G" design strategy does not affect the in vitro protein expression of mRNA-LNP when mRNA molecules are encapsulated into mRNA-LNP for transfection into cells. The mRNAs of L120-Luc, L35-Luc, L38-Luc, L40-Luc, and L42-Luc were encapsulated into mRNA-LNP vaccines. After transfecting 293T cells with equal amounts of mRNA-LNP, the cell pellet was collected 24 hours later, lysed with RIPA, and the expression level of Luciferase was detected using a fluorescein potassium substrate. See the experimental results below. Figure 18 The results show that the expression of Luciferase protein in L35-Luc, L38-Luc, L40-Luc, and L42-Luc is at the same level as that in L120-Luc. This indicates that the "three-segment double G interval" design strategy of PolyA tail sequence does not affect the translation efficiency of mRNA molecules and is suitable for in vitro cell mRNA-LNP vaccine research experiments.
[0128] 2. Study on in vivo protein expression of mRNA-LNP
[0129] C57BL / 6 mice (SPF grade) weighing 18-22g were used to observe the in vivo protein expression of L120-Luc-LNP, L35-Luc-LNP, L38-Luc-LNP, L40-Luc-LNP, and L42-Luc-LNP using different injection methods (intraperitoneal injection, intramuscular injection, and intravenous injection). The injection dose for each mouse was 25ug. Four hours later, fluorescein substrate was injected intraperitoneally. In vivo imaging of mice was performed within 10-15 minutes to analyze the differences in in vivo protein expression of different mRNA-LNPs.
[0130] The results of this embodiment indicate that intramuscular injection is the administration route for mRNA-LNP, and the "double G" design strategy for the PolyA tail sequence does not affect the in vivo protein expression of mRNA-LNP. Figure 19 The mRNA-LNP is administered via intraperitoneal injection. The "three-segment double-G interval" design strategy of the PolyA tail sequence does not affect the in vivo protein expression of mRNA-LNP. Figure 20 The mRNA-LNP is administered intravenously. The PolyA tail sequence employs a "three-segment double-G interval" design strategy, which does not affect the in vivo protein expression of mRNA-LNP. Figure 21 ).
[0131] Example 5: Applicability of the Dual-G Strategy PolyA Tail with Different Carrier Frames
[0132] In this embodiment, the plasmid backbone used is PUC57-GW-KAN, and PolyA is A42-G-A42-G-A42 (actually A40-G-A42-G-A42). The T7-PolyA sequence is inserted using restriction enzyme sites, and the expression of Luciferase under the PUC57-KAN backbone and the PUC57-GW-KAN backbone is compared.
[0133] mRNA-LNP transfection experiments showed that the A42-G-A42-G-A42 PolyA tail can adapt to the PUC57-GW-KAN backbone, enabling the expression of the target gene, and the PUC57-GW-KAN backbone has a stronger expression capacity. Figure 22 ).
[0134] Example 6: Applicability of the dual-G strategy PolyA tail with different ORFs and compatibility with common pharmaceutical excipients
[0135] Using the PUC57-GW-KAN plasmid backbone, PolyA was applied using A42-G-A42-G-A42 (actually A40-G-A42-G-A42). The ORF was replaced with IL-12 instead of Luciferase. After transfection with 2.5 μg mRNA-LNP, IL-12 expression in the precipitate and supernatant was quantified using ELISA. Furthermore, after mRNA-LNP preparation, the compatibility with commonly used pharmaceutical excipients was assessed by comparing IL-12 expression levels with and without the addition of the cryoprotectant sucrose.
[0136] mRNA-LNP transfection experiments demonstrated that the A42-G-A42-G-A42 PolyA tail adapted to the PUC57-GW-KAN backbone could achieve the expression of the target gene IL-12; the addition of the cryoprotectant sucrose did not affect the expression of IL-12 with or without the addition of the cryoprotectant sucrose. Figure 23The dual-G strategy PolyA tail of this invention can be adapted to different ORFs to achieve the expression of the target gene; the mRNA-LNP prepared by the dual-G strategy PolyA tail can be used with commonly used pharmaceutical excipients.
[0137] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method for preparing mRNA containing a PolyA tail, the method comprising: The plasmid vector containing the three-segmented PolyA polynucleotide was transferred into the host cell and cultured to obtain the culture. Plasmid vectors containing PolyA polynucleotides were isolated and / or recovered from the culture and linearized by enzyme digestion to form mRNA transcription templates; The mRNA transcription template was transcribed to obtain mRNA containing a PolyA tail; The nucleotide sequence of the three-segmented PolyA polynucleotide is: A1-G-A2-G-A3, wherein A1, A2, and A3 are each independently a polynucleotide fragment composed of 30-45 consecutive nucleotides A. The host cell is selected from one or more of DH5a, Stbl3, and JM109.
2. The method according to claim 1, wherein, In the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, A1, A2, and A3 are each independently a polynucleotide fragment composed of 35, 36, 37, 38, 39, 40, 41, or 42 consecutive nucleotides A. Optionally, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, A1, A2, and A3 are each independently selected from a polynucleotide fragment composed of 35, 38, or 42 consecutive nucleotides A. Optionally, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, at least two segments of A1, A2, and A3 are polynucleotide fragments composed of consecutive nucleotides A of the same length. Optionally, in the nucleotide sequence A1-G-A2-G-A3 of the three-segmented PolyA polynucleotide, A1, A2, and A3 are polynucleotide fragments composed of consecutive nucleotides A of the same length; Preferably, the host cell is JM109.
3. The method according to claim 1 or 2, further comprising inserting the sequence of the three-segmented PolyA polynucleotide or an mRNA transcription template construct containing it into a plasmid to obtain a plasmid vector containing the three-segmented PolyA polynucleotide.
4. A trisemiconductor polyA nucleotide with the nucleotide sequence: A1-G-A2-G-A3, wherein, A1, A2, and A3 are each independently a polynucleotide fragment composed of 30-45 consecutive nucleotides A, and A1, A2, and A3 are not all 40 at the same time.
5. An mRNA transcription template construct having the structure of Formula I: L1-L2-L3-L4-L5-L6-L7 Formula I in, L1 and L7 are enzyme cleavage sites or are absent; L2 is a promoter element or internal ribosome entry site sequence IRES, or it may not exist; L3 is a 5' UTR element, and the 5' end of the 5' UTR element can be decorated with a Cap cap structure; L4 is the replaceable coding area; L5 is a 3' UTR element; L6 is the nucleotide sequence of the trisaturated PolyA polynucleotide according to claim 4.
6. A plasmid vector containing the three-segmented PolyA polynucleotide according to claim 4 or the mRNA transcription template construct according to claim 5.
7. A host cell, wherein a plasmid vector containing a triplylated PolyA polynucleotide is introduced, wherein, The nucleotide sequence of the three-segmented PolyA polynucleotide is: A1-G-A2-G-A3, wherein A1, A2, and A3 are each independently a polynucleotide fragment composed of 30-45 consecutive nucleotides A; The host cell is selected from one or more of DH5a, Stbl3, and JM109.
8. An mRNA containing a PolyA tail, wherein the mRNA comprises: (1) mRNA with a PolyA tail having the nucleotide sequence A1-G-A2-G-A3, wherein A1, A2, and A3 are each independently a polynucleotide fragment consisting of 30-45 consecutive A nucleotides, provided that A1, A2, and A3 are not simultaneously 40; and / or (2) mRNA prepared according to any one of claims 1-3.
9. A lipid nanoparticle encapsulating the mRNA of claim 8.
10. One or more of the following uses of the mRNA of claim 8 or the lipid nanoparticles of claim 9: (1) Uses in the preparation of mRNA drugs; Optionally, the mRNA drug comprises the mRNA of claim 8 or the lipid nanoparticles of claim 9, and further comprises pharmaceutically acceptable excipients; Optionally, the uses include: The mRNA transcription template is transcribed according to any one of claims 1-3 to obtain a transcription product; The transcript is purified by Oligo-dT to obtain purified mRNA; optionally, the purified mRNA is combined with pharmaceutically acceptable excipients to prepare an mRNA drug. (2) Use in in vitro expression of the target protein; Optionally, the use includes: transfecting cells with the mRNA of claim 8 or the lipid nanoparticles of claim 9, culturing them in vitro, and producing the target protein.