Application and method of vietnamese sophora root DNA methylase gene in improvement of cadmium stress tolerance of plants

By screening and verifying the overexpression of the DNA methyltransferase gene StCMT1 in Sophora tonkinensis, the problem of tolerance of medicinal plants under cadmium stress was solved, and the cadmium stress tolerance in tobacco was enhanced. This also provides a technical solution for improving the production safety and stress resistance of other crops and medicinal plants in cadmium-polluted environments.

CN121825922APending Publication Date: 2026-04-10GUANGXI BOTANICAL GARDEN OF MEDICINAL PLANTS
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610081093.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-21
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

In existing technologies, the functional verification and application pathways of key genes related to DNA methylation in medicinal plants such as Sophora tonkinensis under cadmium stress are unclear, which limits cadmium-tolerant molecular breeding and germplasm innovation.

Method used

A DNA methyltransferase gene StCMT1 derived from Sophora tonkinensis is provided. Its expression is induced under cadmium stress, and it is overexpressed in plants through genetic transformation. An overexpression vector is constructed and transformed into the plants to be improved, thereby enhancing the plants' tolerance to cadmium stress.

Benefits of technology

The results of StCMT1 overexpression in tobacco have demonstrated that it can enhance the plant’s tolerance to cadmium stress. This has clear reproducibility and application value, and can be extended to other crops or medicinal plants to improve production safety and stress resistance in cadmium-polluted environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121825922A_ABST
    Figure CN121825922A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of plant molecular biology, and relates to application and a method of a vietnamese sophora root DNA methylase gene in improving cadmium stress tolerance of plants. The invention provides a DNA methylase gene StCMT1 from vietnamese sophora root, the nucleotide sequence of the DNA methylase gene StCMT1 is shown as SEQ ID No.2, and the amino acid sequence of an encoded protein is shown as SEQ ID No.1. According to the invention, by combining transcriptome screening with qRT-PCR verification, StCMT1 is determined as a key candidate gene for continuous inducible expression under cadmium stress; functional verification is carried out in tobacco, it is proved that overexpression of StCMT1 can enhance cadmium resistance under the stress conditions of 100 [mu] M and 200 [mu] M CdCl2, and definite repeatability and application value are achieved. The method can be used for constructing cadmium-resistant plant materials and cultivating cadmium-resistant varieties, and a new molecular target and technical scheme are provided for safe production of cadmium-contaminated soil and quality improvement of medicinal plants.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant molecular biology, and relates to application of epigenetic regulation and stress resistance breeding technology in Sophora tonkinensis cultivation. BACKGROUND

[0002] Cadmium (Cd) is one of the common heavy metal pollution elements, which can significantly inhibit plant growth and affect the quality and safety of agricultural products or medicinal materials. The response of plants to cadmium stress involves multiple levels such as ion homeostasis, antioxidant system and transcriptional regulation. DNA methylation is an important epigenetic modification, which can affect gene expression by changing chromatin state and plays a key role in plant stress response and adaptation. Under heavy metal stress conditions, epigenetic regulation can be an important mechanism connecting environmental stimuli and changes in gene expression. CN104673803A points out that cold-resistant plants can be cultivated by regulating the methylation of genes. However, the role of DNA methylation-related key genes in Sophora tonkinensis and other medicinal plants in cadmium tolerance is still lack of clear functional verification and transformable technical solutions, which limits its application in cadmium tolerance molecular breeding and germplasm innovation. SUMMARY

[0003] To solve the above technical problems, the application provides an application and method of Sophora tonkinensis DNA methylation enzyme StCMT1 in improving plant cadmium tolerance, which solves the problems of insufficient cadmium tolerance molecular targets, unclear related gene function verification and application approach in the prior art.

[0004] The technical solution of the application is as follows:

[0005] On the one hand, the application provides a DNA methylation enzyme gene StCMT1 derived from Sophora tonkinensis, which is induced to be up-regulated under cadmium stress conditions and is related to the enhancement of plant cadmium tolerance.

[0006] The coding region (CDS) of the StCMT1 gene has a length of about 2448 bp, and the sequence is shown as SEQ ID No. 2. The encoded protein has a length of about 815 aa, and the sequence is shown as SEQ ID No. 1.

[0007] On the other hand, the application provides an application of overexpressing the above-mentioned Sophora tonkinensis DNA methylation enzyme gene in improving plant cadmium tolerance.

[0008] The above-mentioned application is achieved by constructing a biological material overexpressing the Sophora tonkinensis DNA methylation enzyme gene, and then genetically transforming the plant to be improved into the plant. The biological material is a recombinant vector or a host cell.

[0009] In a third aspect, the present application provides a method for improving the cadmium tolerance of a plant, comprising the steps of: constructing an overexpression vector of a DNA methylase gene of Sophora tonkinensis, and transforming the overexpression vector into a plant to be improved by genetic transformation, so as to improve the cadmium tolerance of the plant to be improved. The nucleotide sequence of the DNA methylase gene of Sophora tonkinensis is shown in SEQ ID No. 2. The plant is Sophora tonkinensis or tobacco.

[0010] In a fourth aspect, the present application provides the use of the above method in cultivating a cadmium-tolerant plant under cadmium stress.

[0011] The StCMT1 and the application thereof provided by the present application can be used for: cadmium-tolerant molecular breeding of crops or medicinal plants in cadmium-polluted soil areas; construction of cadmium-tolerant transgenic materials for mechanism research or new variety creation; and use as a molecular marker or an expression marker for rapid screening and evaluation of cadmium-tolerant materials.

[0012] The present application has the following beneficial effects:

[0013] The present application determines StCMT1 as a key candidate gene for continuous induction expression under cadmium stress through transcriptome screening combined with qRT-PCR verification, and proves that overexpression of StCMT1 can enhance the cadmium tolerance under 100 μM and 200 μM CdCl2 stress conditions in tobacco, which has clear repeatability and application value.

[0014] The gene and the application scheme provided by the present application can be popularized to other crops or medicinal plants to improve the production safety and stress resistance in cadmium-polluted environments. In addition, as a key enzyme gene related to DNA methylation, the application of StCMT1 is conducive to improving the stress adaptation ability from the epigenetic level, and provides reusable technologies for subsequent combination of omics screening, molecular design breeding and pollution-tolerant cultivation. BRIEF DESCRIPTION OF DRAWINGS

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are only some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0016] Figure 1 Expression changes of StCMT1 in the roots of Sophora tonkinensis under different cadmium stress concentrations and different treatment times; wherein the transcriptome TPM curve: mean ± SD; the qRT-PCR column: 2 -ΔΔCT , the internal reference Actin, mean ± SD.

[0017] Figure 2 Structure domain of StCMT1 protein.

[0018] Figure 3 Figure 1 is a diagram of pBK-35S-GLosGFP-StCMT1 vector.

[0019] Figure 4 Figure 2 is a PCR identification of StCMT1 transgenic tobacco; wherein WT is wild type, 1-10 is transgenic plant, + is pBK-35S-GLosGFP-StCMT1 plasmid, and H2O is ultrapure water.

[0020] Figure 5 Figure 3 is the expression amount (qRT-PCR) of StCMT1 in transgenic tobacco; wherein WT is wild type, OE1-OE10 is transgenic plant.

[0021] Figure 6 Figure 4 is a comparison diagram of growth phenotype of transgenic tobacco under 100 μM and 200 μM CdCl2 treatment; wherein WT is wild type, OE2, OE6 and OE8 are transgenic plants. DETAILED DESCRIPTION

[0022] The technical solutions of the present application will be described clearly and completely below in conjunction with the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort belong to the scope of protection of the present application.

[0023] The experimental methods used in the following experimental examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials available through commercial channels unless otherwise specified.

[0024] The present application finds a DNA methylation enzyme gene StCMT1 derived from Sophora tonkinensis, which is induced to up-regulate expression under cadmium stress and is related to enhanced plant cadmium tolerance. The coding region (CDS) of the StCMT1 gene has a length of about 2448 bp, and the sequence is shown as SEQ ID No. 2, and the encoded protein has a length of about 815 aa, and the sequence is shown as SEQ ID No. 1.

[0025] Example 1: Screening and expression verification of StCMT1 under cadmium stress

[0026] (1) Materials and treatment

[0027] The seedlings of Millettia pinnata were cultured by hydroponics. The Cd treatments were set as 0 (CK), 40 (T1), 80 (T2), 160 (T3) μM CdCl2. The root samples were collected at 0, 12, 24, 48 h and 7 d, respectively. Three samples were collected for each treatment, each sample contained 3 biological replicates. After sampling, the samples were quickly frozen in liquid nitrogen and stored at -80℃.

[0028] (2) Transcriptional screening

[0029] The total RNA of roots was extracted by TRIzol. 1 μg of RNA was used to construct the transcriptional library and perform Illumina platform sequencing (150 bp double-end). The data were subjected to quality control and expression quantification, and TPM normalization was used. The expression characteristics of StCMT1 under Cd stress were analyzed. The results are shown in Figure 1 The expression of StCMT1 under different concentrations of Cd stress at different time points was significantly increased.

[0030] (3) qRT-PCR verification

[0031] The RNA was reversely transcribed into cDNA using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme Company).

[0032] Actin was used as the internal reference gene (upstream primer: TCAGCACCTTCCAGCAGATG, downstream primer: GAAGCACTTCCTGTGGACG). StCMT1 gene-specific primers (upstream primer: ACTTGATGGCTTGAGCGACTGTAAG, downstream primer: AAATTAGATCGGCATCACCTGGAAGAG) were used for qRT-PCR detection.

[0033] The reaction system was:

[0034] 2×SupRealQ Ultra Hunter SYBR qPCR Master Mix (Vazyme Company) 10 μL, forward primer (10 μM) 0.4 μL, reverse primer (10 μM) 0.4 μL, cDNA 1 μL, ddH2O 8.2 μL.

[0035] The reaction conditions were: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 10 s, 60℃ annealing for 30 s, 40 cycles. Each sample was repeated three times, and 2 -ΔΔCT The relative expression was calculated and expressed as mean ± SD. The results are shown in Figure 1As shown, it is indicated that StCMT1S is generally induced and up-regulated under cadmium stress: compared with CK, most treatments are significantly increased at 12-48 h, and then generally fall at the 7 d stage, but are still higher than CK, and the overall change trend is consistent with the transcriptome results.

[0036] Example 2: StCMT1 overexpression vector construction

[0037] (1) Obtain StCMT1 coding sequence: according to the genomic annotation information of Sophora tonkinensis, design and synthesize an upstream primer (ACTTGATGGCTTGAGCGACTGTAAG) and a downstream primer (AAATTAGATCGGCATCACCTGGAAGAG) with enzyme digestion sites, and perform PCR amplification with Sophora tonkinensis cDNA as a template. The reaction system is: 2 × Phanta Max Master Mix (Vazyme Company) 25 μL, upstream primer 2 μL, downstream primer 2 μL, cDNA 2 μL, dd H2O 19 μL, and the reaction conditions are: 95 °C pre-denaturation for 3 min, 95 °C denaturation for 15 s, 58 °C annealing for 15 s, 72 °C extension for 45 s, 35 cycles; after the PCR product is detected by electrophoresis and the size of the target gene fragment is consistent, the product is recovered using a FastPure Gel DNA Extraction Mini Kit (Vazyme Company), and then connected with a 5 min TA / Blunt-Zero Cloning Kit (Vazyme Company) and transformed into E. coli DH 5α competent cells. 3-5 single colonies are selected, and colony PCR is performed using 2 × Rapid Taq MasterMix (Vazyme Company) for verification, and the positive clones with correct band size and brightness are sequenced for confirmation. The sequencing results show that the CDS length of StCMT1 is about 2448 bp, and the encoded protein is about 815 aa. The full-length of StCMT1 gene CD region is 2448 bp, encoding 815 amino acids, and the encoded protein contains a chromo domain, a BAH domain and a DNA methylase domain, as shown in Figure 2 .

[0038] (2) Vector construction: The correctly sequenced StCMT1 gene fragment was ligated with pBK-35S-GLosGFP expression vector by enzyme digestion, and the reaction conditions were as follows: pBK-35S-GLosGFP 1 μL, PCR product 1 μL, BioRun Eco31I 1 μL, T4 DNA Ligase 1 μL, 10 × Reaction Buffer 2 μL, ddH2O 14 μL (all reagents were purchased from Wuhan Boyuan Company). The above system was mixed uniformly, centrifuged briefly, and then incubated at 37°C for 30-60 min; then heated at 65°C for 20 min to terminate the reaction. 10 μL of enzyme digestion and ligation product was transformed into E. coli DH 5α competent cells, and 10 single colonies were picked for colony PCR verification. The positive clone with correct sequence was named pBK-35S-GLosGFP-StCMT1, and the vector schematic diagram is shown in Figure 3 The recombinant plasmid pBK-35S-GLosGFP-StCMT1 was transformed into Agrobacterium EHA105 by heat shock method.

[0039] Example 3: Agrobacterium-mediated genetic transformation of tobacco and obtaining transgenic plants

[0040] (1) Tobacco seeds were sterilized with 75% alcohol for 30 s, washed with sterile water for 1 min, and then sterilized with 84 disinfectant for 3-5 min, washed with sterile water for 3 times, 1 min / time. The sterilized tobacco seeds were sown on germination medium, and cultured at 23°C with 16 h light / 8 h dark for 4-5 weeks. The sterile tobacco leaves were cut into small pieces with a scalpel and inoculated on pre-culture medium.

[0041] (2) 2 mL of Agrobacterium EHA105 containing pBK-35S-GLosGFP-StCMT1 recombinant plasmid was inoculated into 100 mL of LB liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured at 28°C, 220 rpm until the OD value was about 0.8. Centrifuged at 8000 rpm for 5 min, removed the supernatant, and then suspended the bacterial cells with sterile MS liquid medium to OD600 of about 0.5, which was used as the engineering bacteria liquid for subsequent infection of tobacco leaves.

[0042] (3) Pre-cultured tobacco leaves for 2-3 days were inoculated in Agrobacterium suspension for 10-15 min, and the infected tobacco leaves were dried on filter paper and inoculated on co-culture medium for dark culture for 48-72 h. The co-cultured leaves were transferred to induction medium for induction of callus for about 10 d. The callus was selected and transferred to Basta-containing resistance screening medium for culture for 15-30 d, and the positive callus after screening was transferred to differentiation medium for culture for 15-30 d; the positive callus with vigorous growth was inoculated on differentiation medium, and during the differentiation process, if seedlings were formed, they were inoculated on the seedling culture medium for growth for 7-10 d, tobacco genomic DNA was extracted by CTAB method, and upstream primer (GCTATCTGTCACTTTATTGTG) and downstream primer (TTGAAGATGCTTCACTTCCTATT) were synthesized for PCR detection.

[0043] (4) The transgenic tobacco seedlings positive in PCR detection were acclimated and transplanted into flowerpots, and after seed collection, the seeds were sown on Basta-containing resistance medium for continuous screening, and the seedlings were detected by PCR after germination, and the results are shown in Figure 4 , and it can be seen from Figure 4 that 10 tobacco plants were positive in PCR detection. The positive plants were transplanted, and T1 generation seeds were harvested. The seedlings formed after sowing of the T1 generation seeds were extracted for RNA and reverse transcribed into cDNA, and the expression amount of StCMT1 was detected by qRT-PCR (the method is the same as before), and the results are shown in Figure 5 , and it can be seen from Figure 5 that the expression amount of StCMT1 in 10 overexpression lines was significantly higher than that in wild type tobacco plants, and 3 high expression lines (OE2, OE6, and OE8) were selected for cadmium tolerance phenotype identification.

[0044] Example 4: Identification of cadmium tolerance of transgenic tobacco

[0045] (1) Treatment method

[0046] WT and StCMT1 overexpression T1 seedlings were cultured on MS medium at the same time, and a control group and a cadmium-containing treatment group (100 μM or 200 μM CdCl2) were set. After about 20 days of culture, the phenotype was observed and recorded.

[0047] (2) Results

[0048] As shown in Figure 6 , compared with WT, the StCMT1 overexpression lines showed better growth state under the culture condition containing 100 μM or 200 μM CdCl2, higher plant height, lighter leaf yellowing, and lower overall growth inhibition, indicating that StCMT1 overexpression can enhance plant cadmium tolerance.

[0049] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A Sophora tonkinensis DNA methyltransferase, the amino acid sequence of which is shown in SEQ ID No.

1.

2. A Sophora tonkinensis DNA methyltransferase gene, the nucleotide sequence of which is shown in SEQ ID No.

2.

3. The application of overexpression of the Sophora tonkinensis DNA methyltransferase of claim 1 in improving plant tolerance to cadmium stress.

4. The application of the overexpression of Sophora tonkinensis DNA methyltransferase according to claim 3 in improving plant tolerance to cadmium stress, characterized in that: The application involves constructing biological material that overexpresses the Sophora tonkinensis DNA methyltransferase gene as described in claim 2, and then transferring it into the plant to be improved via genetic transformation.

5. The application of the overexpression of Sophora tonkinensis DNA methyltransferase according to claim 4 in improving plant tolerance to cadmium stress, characterized in that: The biomaterial is a recombinant vector or a host cell.

6. The application of the overexpression of the Sophora tonkinensis DNA methyltransferase gene according to any one of claims 3-5 in improving plant tolerance to cadmium stress, characterized in that: The plant in question is either Sophora tonkinensis or tobacco.

7. A method for improving cadmium tolerance in plants, characterized in that, The steps are as follows: construct an overexpression vector for the DNA methyltransferase gene of Sophora tonkinensis, and transfer it into the plant to be improved through genetic transformation to enhance the cadmium tolerance of the plant.

8. The method for improving cadmium tolerance in plants according to claim 7, characterized in that: The nucleotide sequence of the Sophora tonkinensis DNA methyltransferase gene is shown in SEQ ID No.

2.

9. The method for improving cadmium tolerance in plants according to claim 7, characterized in that: The plant in question is either Sophora tonkinensis or tobacco.

10. The application of the method according to any one of claims 7-9 in the cultivation of cadmium-tolerant plants under cadmium stress conditions.

Citation Information

Patent Citations

  • Application of gene methylation in gene expression regulation

    CN104673803A