Stem tip meristem preferential expression promoter and application thereof
By screening and validating promoters preferentially expressed in cotton shoot apical meristems, constructing recombinant expression vectors and introducing them into plants, the problem of shoot apical specific expression was solved, achieving efficient and stable exogenous gene expression and signal transduction regulation in shoot apex, with the potential for cross-species application.
Patent Information
- Application Number
- CN202610104264.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-26
- Publication Date
- 2026-04-10
AI Technical Summary
In the transgenic engineering of cotton, there is a lack of promoters that can drive the efficient, specific and preferential expression of foreign genes in the shoot tip. Existing constitutive promoters may lead to the accumulation of foreign proteins in the plant, which may disrupt growth and development and pose environmental risks.
A promoter preferentially expressed in the shoot apical meristem of cotton was screened and cloned. Its tissue specificity and functional stability were verified by Arabidopsis transformation system. A recombinant expression vector was constructed and transformed into recombinant engineered bacteria, which was then introduced into recipient plants to drive the expression of exogenous genes.
It achieved high-level specific expression in shoot apical meristems and low-level accompanying expression in adjacent vascular junction regions, significantly improving the expression level of shoot apical related tissues, reducing expression in non-target tissues, enhancing the regulatory efficiency of shoot apical signal transduction-related traits, and has cross-species applicability.
Smart Images

Figure CN121825975A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular biology technology, and more specifically, relates to a promoter preferentially expressed in shoot apical meristem and its application. Background Technology
[0002] The shoot apical meristem is the central region of plant growth and development, containing a population of stem cells capable of continuous division. It is the starting point for the formation of new organs (such as leaves, branches, and inflorescences) and plays a decisive role in plant architecture, internode elongation, and organogenesis. Gene expression in the shoot apical meristem exhibits high spatiotemporal specificity, with significant differences in expression patterns at different developmental stages or under different external conditions. Studying and identifying preferential promoters in the shoot apical meristem not only helps to further elucidate the molecular regulatory mechanisms of plant shoot apex development but also provides key nucleic acid regulatory elements for tissue-specific genetic engineering.
[0003] A promoter is a DNA sequence located upstream of the 5' end of a structural gene that specifically recognizes and binds to RNA polymerase, regulating the initiation of gene transcription. Based on their expression patterns, plant promoters can be classified into three categories: constitutive promoters, tissue-specific promoters, and inducible promoters. Constitutive promoters (such as the CaMV 35S promoter) drive the continuous expression of genes in all plant tissues, but they have significant limitations: constitutive expression of exogenous genes can lead to the accumulation of large amounts of foreign proteins in the plant, disrupting the plant's original metabolic balance and even affecting normal growth and development. Furthermore, the CaMV 35S promoter is controversial in terms of safety, and in some cases, horizontal gene transfer may pose environmental risks.
[0004] Tissue-specific promoters can drive gene expression in specific tissues or organs, exhibiting spatial specificity of expression. They can reduce the impact on normal plant physiological activities, increase the expression concentration of target genes in specific sites, and enhance the transgenic effect.
[0005] The shoot apex meristem is the core site of plant growth and development, and is related to the overall morphogenesis and organogenesis of the plant. Currently, transgenic cotton engineering technology still lacks promoters that can drive the efficient, specific, and preferential expression of exogenous genes in the shoot apex (a key site for plant growth and organogenesis). Summary of the Invention
[0006] The purpose of this invention is to provide a promoter preferentially expressed in shoot apical meristem and its application, in order to solve the above-mentioned technical problems.
[0007] To achieve the above objectives, the present invention adopts the following technical solution: The present invention provides a shoot apical meristem preferential expression promoter, the nucleotide sequence of which is shown in SEQ ID NO.3.
[0008] Based on analysis of the cotton genome database, this invention screened cotton genes and cloned a cotton shoot apical meristem preferential expression promoter from its genomic DNA using PCR technology. The tissue specificity and functional stability were verified using an Arabidopsis transformation system. Experimental results showed that this promoter could drive high-level specific expression of exogenous genes in plant shoot apical meristems, and exhibited some degree of accompanying expression in vascular tissues such as petiole midribs, while showing relatively low expression levels in leaf and root tissues, demonstrating a clear spatial expression preference and good promoter activity.
[0009] The present invention also provides a recombinant expression vector comprising the shoot apical meristem preferentially expressed promoter.
[0010] Furthermore, the shoot apical meristem preferential expression promoter is inserted into the PQTY-GUS vector. Sal I endonuclease site and BamH Obtained between I endonuclease sites.
[0011] The present invention also provides a recombinant engineered bacterium, wherein the recombinant engineered bacterium comprises the above-described recombinant expression vector.
[0012] Furthermore, the recombinant engineered bacteria are obtained by transferring the recombinant expression vector into Agrobacterium competent cells GV3101.
[0013] This invention provides the application of the shoot apical meristem preferential expression promoter, the recombinant expression vector, or the recombinant engineered bacteria in the cultivation of transgenic plants.
[0014] The present invention provides a method for expressing a target nucleotide sequence in a plant, comprising the steps of inserting the target gene downstream of a preferentially expressed promoter in the shoot apical meristem of the above-mentioned recombinant expression vector, and then introducing it into a recipient plant.
[0015] Furthermore, the target gene includes structural genes and regulatory genes.
[0016] The present invention has at least the following beneficial effects: Preferential expression in shoot apical meristem, exhibiting a clear spatial expression bias: This invention provides a plant promoter derived from cotton that drives preferential expression of the target gene in the shoot apical meristem, while showing lower levels of accompanying expression in vascular junction regions such as the midrib of the petiole adjacent to the shoot apical meristem. Compared with existing constitutive promoters, this promoter exhibits a clear spatial expression bias, significantly increasing the expression level of the target gene in shoot apical tissues while effectively reducing its unnecessary expression in non-target tissues.
[0017] It facilitates efficient and stable regulation of shoot apex signal transduction-related traits: Furthermore, since the shoot apex meristem and its adjacent vascular junction region are key hubs for the generation and downward transmission of plant developmental signals, the promoter described in this invention, by maintaining high expression dominance in the shoot apex meristem while achieving limited expression in the vascular junction region, is conducive to effectively transmitting regulatory signals generated at the shoot apex to downstream tissues. It is particularly suitable for regulating the expression of target genes related to shoot apex signal transduction, vascular transport, and plant morphogenesis, thereby improving the overall regulatory efficiency of target genes and enhancing the consistency and stability of agronomic traits such as plant type, internode elongation, branching angle, and apical dominance.
[0018] It has good cross-species applicability and application and promotion potential: In addition, the promoter described in this invention is derived from cotton, but still shows stable spatial expression characteristics in Arabidopsis thaliana, indicating that the cis-regulatory elements contained in the promoter have good cross-species recognition and functional stability, which broadens its application prospects in functional gene research and molecular breeding in different plant species.
[0019] Therefore, the promoter of this invention has preferential expression in shoot apical meristem and clear spatial specificity, which can achieve efficient and stable regulation of the target gene in the shoot apex and related vascular regions, and maintain good function in different plant species, thus having important application potential. Attached Figure Description
[0020] Figure 1 This is a schematic diagram of the structure of the recombinant expression vector PQTY-GUS-ProSBH1.
[0021] Figure 2 The images show the GUS histochemical staining results of the ProSBH1 promoter in Arabidopsis thaliana. In the images, A is a histochemical staining image of the whole Arabidopsis thaliana plant, and B is a magnified image of the shoot tip meristem of Arabidopsis thaliana.
[0022] Figure 3 This figure shows the relative expression levels of the GUS gene driven by the cotton ProSBH1 promoter in different tissues of Arabidopsis thaliana. Data in the figure are mean ± standard error; * indicates significant difference (P<0.05), and ** indicates extremely significant difference (P<0.01). Detailed Implementation
[0023] The present invention will now be described in detail with reference to specific embodiments, but these should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained commercially unless otherwise specified.
[0024] Example 1 I. Obtaining the cotton promoter sequence.
[0025] 1. Primer Design: Specific primers ProSBH1-F and ProSBH1-R were designed to amplify the ProSBH1 promoter sequence. The ProSBH1-F sequence is shown in SEQ ID NO.1, and the ProSBH1-R sequence is shown in SEQ ID NO.2. SEQ ID NO. 1: CCTTACAGTCTTCCTCGA.
[0026] SEQ ID NO. 2: GTGTCCAAAGCCATCAT.
[0027] 2. PCR reaction: DNA was extracted from cotton leaves using the CTAB method and used as a template for PCR amplification using 2×PhantaFlash Master Mix (Dye Plus). The reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0028] Table 1: PCR amplification reaction system for target genes Table 2: PCR amplification reaction procedure for target genes Note: / indicates no data.
[0029] After electrophoresis detection of the PCR product, the target fragment was recovered to obtain the ProSBH1 promoter sequence, which is shown in SEQ ID NO.3.
[0030] SEQ ID NO.3: TTACAGTCTTCCTCGATTTGATCGTTTCATCCCTCTATTGTTGTATTATTATTATTTATCGGTTTCCTTTTTGTAATATATGGAGTAAACGATAAGATAACAAATTATAAACGTCTAATCTCCCTCACTTATCTGTTTTTTTCTCTTTGTAGTTTGCCAGTAAAATGGCAGTGCATCAGTTAGCGGTGCAAGAAAAGAGGGGAGAGTTTTCATCGGGAAGGTAAAGCTTTGCATATCCCCAGCCACAGGCAGTCAGCCACCAGTACTGCCTCAAACACACCCCCACTATATCTCCCACACCTGCTTAATAGTAGAGCCATGAGATTTGAAGTTCTTTCAATGCCTTGCTTTCTTTCTGCATAGCCGCGTGCGTTCTGCAAACACACCAAACCCCCTTCCCCTTCCTTTTTTCTGTCTTTCTTTTCTTCCAAACAAGTGCAAAAGAAGCTCGAGAGACAGAGAGGATTTTGTAATAGAAAGTGAGAATTAATGCTCTCTGCTAATGACTAGGAAGATCAACAAACAAACTCCCATTTTCCAAAGGAAATCTGAGCAGGCTTTGCCAGGTTAGCCCCAGAGAGTAAAATCCCACATTTTTCTCAAACTCCACTACCTCCTGCTGCTGCTGCTATCACTATTTAGGAGTTCCTATGAAAAGCCTGTTGTTTGTAGCATAAATCTCGGGAGAGTTGTAGAGATATTAACAATCTTTAGGGCAAAAAAATAGATTGCGTAGGAAAGAGAAGAGAGAGAAAATGGGTTGTGTTGTTATATAGCAAAGCCCTTGAGGGAACAAACTAGAGGGGGAAACGAAAAGAAAGATAAGATAGTGAGAGATAATGGAAGGTGGTTCCAATAGCACTTCTTGC。
[0031] II. Construction of the ProSBH1 - linked GUS expression vector.
[0032] 1. Primer design: Add SalI and BamHI restriction sites to both ends of the primers. The ProSBH1-SalI-F sequence is shown in SEQ ID NO.4, and the ProSBH1-BamHI-R sequence is shown in SEQ ID NO.5.
[0033] SEQ ID NO. 4: cttcctaggctcgaggtcgacTTACAGTCTTCCTCGATTTGATCG.
[0034] SEQ ID NO. 5: tcagatctaccatggggatccGCAAGAAGTGCTATTGGAACCAC.
[0035] 2. PCR reaction: ProSBH1 was used as a template, and PCR amplification was performed using 2×Phanta Flash Master Mix (Dye Plus). The reaction system is shown in Table 3, and the PCR reaction procedure is shown in Table 4.
[0036] Table 3: PCR amplification reaction system for target genes Table 4: PCR amplification reaction procedure for target genes After electrophoresis detection of the PCR products, the target fragment was recovered.
[0037] 3. Construction of the target fragment and vector: The PQTY-GUS vector was constructed using... Sal I and BamH The target fragment was double-digested with enzyme I to obtain a linearized vector. Seamless cloning technology was then used to ligate the target fragment and the linearized vector. The ligation system is shown in Table 5. The PQTY-GUS vector sequence is shown in SEQ ID NO. 6.
[0038]
[0039] Table 5: Connection System The above-mentioned bonding system was mixed and heated in a water bath at 50°C for 20 minutes to obtain the bonding product.
[0040] 4. Transformation of ligation product: Thaw competent E. coli cells on ice, add 5 μL of ligation product to 50 μL of competent cells, mix well and incubate in an ice-water bath for 30 min, heat shock at 42°C for 90 s, incubate in an ice-water bath for 2 min, add 500 μL of antibiotic-free LB liquid medium, incubate at 37°C on a shaker at 220 rpm for 1 h, centrifuge at 12000 rpm for 1 min, take an appropriate amount of bacterial culture and spread it on LB solid medium containing 50 mg / mL kanamycin, and incubate overnight in a constant temperature incubator at 37°C.
[0041] 5. Screening for positive clones: After single colonies have grown on the above plates, select single colonies for colony PCR identification. The reaction system is shown in Table 6, and the PCR reaction procedure is shown in Table 7.
[0042] Table 6: Bacterial PCR Reaction System Table 7: PCR amplification reaction procedure for target genes After the PCR products are detected by electrophoresis, positive bacteria are selected and sent to the company for sequencing. Figure 1 As shown, the recombinant plasmid PQTY-GUS-ProSBH1 was obtained and preserved for subsequent experiments.
[0043] III. Obtaining transformed Arabidopsis thaliana plants PQTY-GUS-ProSBH1.
[0044] The constructed PQTY-GUS-ProSBH1 recombinant vector was transformed into Agrobacterium competent cells GV3101, and then transformed into WT Arabidopsis thaliana by inflorescence immersion method. Seeds of the transformed plants were then collected.
[0045] After disinfection, the transformed Arabidopsis thaliana (T0 generation) seeds were evenly sown on 1 / 2 MS plates containing 50 mg / mL Hyg to screen for positive seedlings. Positive seedlings grew normally, while non-positive seedlings withered and died. The obtained positive seedlings were selected and transferred to soil for growth under long-day conditions at 22℃, and their seeds were collected (T1).
[0046] IV. Identification of transgenic Arabidopsis thaliana by GUS histochemical staining.
[0047] Using wild-type Arabidopsis thaliana as a control, chemical staining analysis was performed on PQTY-GUS-ProSBH1 transgenic Arabidopsis thaliana. T1 generation seeds were evenly sown on 1 / 2 MS medium containing 50 mg / mL Hyg, treated at 4°C for two days, and then cultured under long-day conditions at 22°C for one week. Subsequently, the seedlings were transferred to soil for further growth. Two-week and three-week-old Arabidopsis thaliana seedlings were treated with GUS staining kits provided by Beijing Huayue Biotechnology Co., Ltd. After one day of dark treatment at 37°C, the staining was decolorized with 70% ethanol, and finally observed under a stereomicroscope. The staining results are shown below. Figure 2 As shown, GUS driven by the ProSBH1 promoter exhibits strong expression signal in the shoot apical meristem of Arabidopsis thaliana, while weaker accompanying expression can be detected in vascular-related regions such as the midrib of the petiole.
[0048] V. Tissue-specific detection at the promoter transcription level.
[0049] 1. Analysis of GUS expression levels in transgenic PQTY-GUS-ProSBH1 Arabidopsis thaliana RNA was extracted from leaves, pods, stem tips, roots, and petioles of PQTY-GUS-ProSBH1 transgenic positive plants using the Trizol method.
[0050] Trizol method for extracting plant RNA: After grinding the sample, add 1 mL of Trizol, vortex and mix well, let stand for 5 min; add 200 μL of chloroform, vortex and mix well, let stand for 2 min, then centrifuge at 12000 rpm for 15 min, aspirate the upper aqueous phase and transfer to a new 1.5 mL centrifuge tube; add another 200 μL of chloroform, mix well, let stand for 2 min, centrifuge at 12000 rpm for 15 min, aspirate the upper aqueous phase and transfer to a new 1.5 mL centrifuge tube; add an equal volume of isopropanol, mix well, let stand at -20℃ for 10 min; centrifuge at 12000 rpm for 10 min, discard the supernatant; add 500 μL of 75% ethanol, mix well, centrifuge at 12000 rpm for 3 min; discard the supernatant, air dry, and dissolve in 20-30 μL of enzyme-free water to obtain plant RNA.
[0051] 2. Reverse transcription: Prepare the following mixture according to the reverse transcription kit in Table 8.
[0052] Table 8: Mixed Systems Gently mix with a pipette, briefly centrifuge, and then perform reverse transcription at 50°C for 15 min and 85°C for 5 sec.
[0053] 3. qRT-PCR Identification: The cDNA obtained after the above reverse transcription reaction was diluted 40-fold as a qRT-PCR template. Actin gene was used as an internal reference gene. qRT-PCR was performed using a real-time quantitative PCR instrument (Light Cycler® 96). Data obtained from the Light Cycler® 96 instrument were processed and analyzed using the 2-ΔΔCt method, and graphs were plotted using GraphPadPrism software. Experimental results are shown below. Figure 3 As shown, the expression level of the GUS gene in different tissues of transgenic Arabidopsis was detected by qRT-PCR. The Actin gene was used as an internal reference for standardization. The expression level of the GUS gene in the shoot tip tissue was significantly higher than that in the leaf, petiole, pod and root tissues. A certain level of expression was detected in the petiole and pod, while the expression level was low in the leaf and root.
[0054] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0055] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
[0056] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A meristem-preferential promoter for expression in shoot apical meristem, characterized in that, The nucleotide sequence of the promoter preferentially expressed in the shoot apical meristem is shown in SEQ ID NO.
3.
2. A recombinant expression vector, characterized in that, It includes the shoot apical meristem preferentially expressed promoter as described in claim 1.
3. The recombinant expression vector according to claim 2, characterized in that, The shoot apical meristem preferential expression promoter is inserted into the PQTY-GUS vector. Sal I endonuclease site and BamH Obtained between I endonuclease sites.
4. A recombinant engineered bacterium, characterized in that, The recombinant engineered bacteria comprises the recombinant expression vector as described in claim 3.
5. The recombinant engineered bacteria according to claim 4, characterized in that, The recombinant expression vector was obtained by transfecting Agrobacterium competent cells GV3101.
6. The application of the shoot apical meristem preferential expression promoter of claim 1, the recombinant expression vector of claim 2, or the recombinant engineered bacteria of claim 4 in the cultivation of transgenic plants.
7. A method for expressing a target nucleotide sequence in a plant, characterized in that, The method includes the steps of inserting the target gene downstream of the preferentially expressed promoter in the shoot apical meristem of the recombinant expression vector of claim 2, and then introducing it into the recipient plant.
8. The method according to claim 7, characterized in that, The target genes include structural genes and regulatory genes.