Candidate gene AetNLR2CIae8 of aegilops tauschii powdery mildew resistance gene pmAeCIae82DS and application thereof
By overexpressing or silencing the AetNLR2CIae8 gene in wheat, its resistance to powdery mildew was regulated, solving the problem of weakened resistance caused by low genetic diversity in modern wheat and improving wheat's resistance to powdery mildew.
Patent Information
- Application Number
- CN202610237667.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-10-11
- Filing Date
- 2026-02-28
- Publication Date
- 2026-04-10
AI Technical Summary
The low genetic diversity of modern wheat leads to weakened resistance to powdery mildew, and existing resistant varieties are easily lost. How to increase the genetic diversity of the D subgenome of wheat to improve its resistance to powdery mildew is an urgent problem to be solved.
We provide the candidate gene AetNLR2CIae8 for the wheat powdery mildew resistance gene pmAeCIae8_2DS and its encoded protein. By constructing a recombinant expression vector, we can overexpress or silence this gene in wheat to regulate its resistance to powdery mildew.
To enhance or reduce wheat's resistance to powdery mildew, increase the genetic diversity of disease-resistant genes in wheat, and maintain the long-lasting resistance of varieties.
Smart Images

Figure CN121825992A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to the candidate gene AetNLR2 of the jointed goatgrass powdery mildew resistance gene pmAeCIae8_2DS. CIae8 Its encoded proteins and applications. Background Technology
[0002] Common wheat (Triticum aestivum L., 2n=6x=42, AABBDD) is an allohexaploid species and one of the most widely cultivated food crops in the world. The most recent polyploidization of wheat occurred 8,000-10,000 years ago, when cultivated emmer wheat (the female parent) was crossed with jointed wheat (the male parent), resulting in the current common hexaploid wheat through natural chromosome doubling, natural selection, and domestication. During this polyploidization process, only a small number of donors from chromosome sets A, B, and D participated in the formation of common wheat. Studies have shown that the jointed wheat (Aegilops tauschii, 2n=2x=14, DD) population can be divided into three evolutionary branches (Lineage 1, 2, and 3). The D subgenome of common wheat has two sources: the Lineage 2 branch of jointed wheat and the Lineage 3 branch of jointed wheat. The Lineage 3 branch contributes only 1.1% of the common wheat D genome. Due to evolutionary bottlenecks, domestication, and artificial selection, the genetic base of common wheat has become increasingly narrow. Compared to the A and B subgenomes, the genetic diversity of the wheat D subgenome is particularly scarce, only about 16% of that of the A and B subgenomes. The low genetic diversity and narrow genetic background of modern wheat have weakened its ability to resist biotic stresses, increasing the risk of large-scale disease outbreaks. For example, more than 50% of the new varieties bred in the 1990s contained the 1BL / 1RS translocation chromosome carrying the powdery mildew resistance gene Pm8. The widespread use of the single resistance source Pm8 and the emergence of new powdery mildew virulent races led to a major powdery mildew outbreak in my country in the 1990s. How to increase the genetic diversity of the wheat D subgenome and improve wheat adaptability and yield is an urgent problem to be solved in wheat breeding. Jointed wheat (Gnaphalium affine) is a donor of the common wheat D genome, with a wide geographical distribution and rich genetic diversity, containing excellent gene resources related to resistance, yield, and quality, and is an important germplasm resource bank for wheat genetic improvement.
[0003] Wheat powdery mildew is one of the most serious diseases threatening wheat growth and development, posing a severe threat to safe wheat production. Frequent physiological variations in the physiological races of wheat powdery mildew fungus (Blumeria graminis f. sp. tritici, Bgt) easily lead to the loss of resistance in widely cultivated single-resistant varieties. Wild relatives of wheat contain abundant superior genes, serving as an important source of genes for wheat genetic improvement. Extracting powdery mildew resistance genes from these relatives can increase the genetic diversity of resistance genes, which is beneficial for maintaining the durability of powdery mildew resistance in wheat varieties. Jointed wheat (Aegilops tauschii, 2n=2x=14, DD) is a donor of the D subgenome of common wheat, containing abundant superior genes for disease resistance, stress resistance, and quality, making it an important gene resource for wheat genetic improvement. Using synthetic wheat as an intermediate bridge for hybridization with common wheat is an important way to transfer superior genes from jointed wheat to the common wheat background. Nearly 50 wheat disease and pest resistance genes have been discovered in jointed goatgrass, including several powdery mildew resistance genes such as Pm2, Pm34, Pm35, and Pm58. The pmAeCIae8_2DS gene, derived from the short arm of chromosome 2D in jointed goatgrass, can positively regulate wheat resistance to powdery mildew, enriching the wheat powdery mildew resistance gene resource library.
[0004] Plant innate immunity mainly consists of two parts: the immune response triggered by the recognition of pathogen-associated molecular patterns (PAMPs) by plant pattern recognition receptors (PRRs) (PAMP-triggered immunity, PTI) and the immune response triggered by the recognition of effector-triggered immunity by plant NLR proteins (Effector-triggered immunity, ETI). Based on differences in their N-terminus, NLR proteins can be divided into two classes: TNL, which contains a TIR domain (Drosophila Toll and human IL-1 receptors) at the N-terminus, and CNL, which contains a CC domain (coiledcoil) at the N-terminus. Plant NLR proteins play a crucial role in plant immunity, directly or indirectly recognizing avirulence (AVR) proteins of pathogens, inducing conformational changes in NLRs, promoting oligomerization, transducing immune signals, and triggering the plant's immune response. Summary of the Invention
[0005] The purpose of this invention is to provide a candidate gene, AetNLR2, for wheat powdery mildew resistance gene pmAeCIae8_2DS. CIae8 and the protein sequence it encodes.
[0006] Another objective is to provide a recombinant expression vector containing the aforementioned genes.
[0007] Another object of the present invention is to provide the application of the gene and the overexpression vector.
[0008] The present invention provides a candidate gene, AetNLR2, for the powdery mildew resistance gene pmAeCIae8_2DS. CIae8 The sequence is derived from the jointed barley variety CIae8, with the gene nucleic acid sequence being SEQ ID NO.1 and its amino acid sequence being SEQ ID NO.2.
[0009] Primer pairs that amplify the full length or any fragment of the gene sequence are also within the scope of protection of this invention.
[0010] When constructing recombinant expression vectors using the aforementioned nucleic acid molecules, any type of enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide. These promoters can be used alone or in combination with other plant promoters, such as the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.
[0011] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.
[0012] The recombinant vector may specifically be a recombinant expression vector. Specifically, the recombinant expression vector may be a recombinant plasmid obtained by inserting the nucleic acid molecule into an existing plant expression vector. Existing plant expression vectors may specifically be pBI220 vector, pWMB220-GUS, BSMV-γ vector, and pLGY-OE3 vector.
[0013] This invention also protects AetNLR2 CIae8 Proteins can be used to regulate resistance to powdery mildew, or to enhance or reduce plant resistance to powdery mildew.
[0014] This invention also protects the code AetNLR2. CIae8 Applications of nucleic acid molecules in proteins, such as cultivating plants with altered resistance to powdery mildew; cultivating plants with enhanced or reduced resistance to powdery mildew.
[0015] This invention also protects a plant breeding method for increasing AetNLR2 in a target plant. CIae8 The activity and / or content of proteins enhance the resistance of the target plant to powdery mildew.
[0016] This invention also protects a plant breeding method for reducing AetNLR2 in target plants. CIae8 The content and / or activity of proteins can reduce the resistance of the target plant to powdery mildew.
[0017] The powdery mildew described above can be caused by powdery mildew pathogens. The powdery mildew pathogen described above can be *Brucea blisterii* wheat-specific strain. Specifically, the powdery mildew pathogen is *Brucea blisterii* strain E26.
[0018] Beneficial effects
[0019] The candidate gene AetNLR2 derived from the powdery mildew resistance gene pmAeCIae8_2DS of jointed goatgrass obtained in this invention CIae8 This gene represents resistance throughout the entire growth period. Cloning and elucidating its mechanism of resistance to powdery mildew will help genetically improve wheat resistance to powdery mildew and cultivate disease-resistant varieties. Overexpression of AetNLR2 in susceptible materials... CIae8 Genes can enhance resistance to powdery mildew; silencing AetNLR2 in resistant materials. CIae8 Genes can enhance susceptibility; in susceptible materials, a strong promoter can be used to drive AetNLR2. CIae8 Gene expression can induce immunity to powdery mildew, indicating that AetNLR2 CIae8 Genes positively regulate powdery mildew resistance. This invention is of great significance for wheat powdery mildew resistance breeding. Attached Figure Description
[0020] Figure 1 : Gene annotation and transcriptome expression data for candidate regions corresponding to the jointed goatgrass AY61 as the reference genome. A: Candidate gene ID, expression levels of candidate genes in powdery mildew resistant jointed goatgrass CIae8 and susceptible jointed goatgrass PI574467 at 0h, 8h, 24h, and 48h after powdery mildew infection.
[0021] Figure 2 Candidate gene AetNLR2 CIae8 The gene structure and expression pattern induced by powdery mildew. A: AetNLR2 CIae8B: Detection of AetNLR2 gene structure using qPCR. CIae8 Powdery mildew resistant jointed goatgrass CIae8 and susceptible jointed goatgrass PI574467 were induced to express by powdery mildew.
[0022] Figure 3 : This refers to the EMS mutant of jointed goatgrass RIL11-1 containing pmAeCIae8_2DS and its corresponding powdery mildew resistance phenotype. A: The mutant is related to the candidate gene AetNLR2. CIae8 B: Mutation site; B: Resistance phenotype of the mutant against powdery mildew E26.
[0023] Figure 4: Transient overexpression of AetNLR2 CIae8 The effect on the absorber index of Yangmai 158. A: pBI220-AetNLR2 CIae8 Vector construction process; B: Overexpression of pBI220-AetNLR2 in young leaves of Yangmai 158 CIae8 Changes in the carrier's post-absorber index.
[0024] Figure 5: Validation of AetNLR2 using VIGS CIae8 Functions. A: Apply BSMV-γ-AetNLR2 with TX11-1 containing pmAeCIae8_2DS. CIae8 Post-silencing efficiency; B: Jointed wheat TX11-1 containing pmAeCIae8_2DS was applied to BSMV-γ-AetNLR2 respectively. CIae8 The powdery mildew resistance phenotype afterward. Detailed Implementation
[0025] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. The substantive content of the present invention is described in detail below with reference to embodiments, but this does not limit the scope of protection of the present invention.
[0026] The powdery mildew fungus used in this study is wheat powdery mildew race E26. It is described in the literature "Zhu YF, Li YB, Fei F, et al. E3 ubiquitin ligase gene CMPG1–V from Haynaldia villosa L. contributes to powdery mildew resistance in common wheat (Triticum aestivum L.)[J]. The Plant Journal, 2015, 48(1):154-168."
[0027] The jointed wheat varieties CIae8 and PI574467, as well as the jointed wheat recombinant inbred line RIL11-1 containing only pmAeCIae8_2DS, in this study are described in the literature “Tang X ,Dai FX,Hao YL,et al. Fine mapping of tworecessive powdery mildew resistance genes from Aegilops tauschii accessionCIae8[J]. Theoretical and Applied Genetics, 2023, 136(9):206.”
[0028] The single-cell transient expression technique and haustorium index are described in the literature “Patrick S, Jana P, Olaf A, et al. A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat[J]. Molecular Plant - Microbe Interactions,1999,12(8):647-654”.
[0029] The gene silencing technique induced by barley stripe mosaic virus is described in the literature “Yuan C, Li C, Yan L, et al. A high throughput barley stripe mosaic virus vector for virus induced gene silencing in monocots and dicots [J]. PLoS One, 2011,10(6):e26468”.
[0030] Example 1. Prediction of pmAeCIae8_2DS candidate genes
[0031] The genome of AY61 was used as the reference genome for CIae8 for CIae8 resequencing and transcriptome data analysis. To further predict candidate genes, transcriptome sequencing was performed on leaves of CIae8 and PI574467 seedlings at 0h, 8h, 24h, and 48h after inoculation with powdery mildew E26. Expression analysis of 14 candidate genes within candidate regions, combined with gene annotation, revealed that the gene AetNLR2... CIae8 AetNLR2 was expressed only in CIae8, and its expression was upregulated by powdery mildew induction, while it was almost not expressed in PI574467. Therefore, AetNLR2 was... CIae8It is a candidate gene for pmAeCIae8_2DS ( Figure 1 ).
[0032] Example 2: Candidate gene AetNLR2 CIae8 Gene cloning and expression patterns
[0033] Using primer pairs P1:CACACCCCATAATCTTGCCG (SEQ ID NO.3) and P2:GCTCTTGGACGCTTTGTTGA (SEQ ID NO.4), with CIae8 gDNA and cDNA as templates, AetNLR2 was targeted. CIae8 The full-length AetNLR2 was cloned and sequenced. CIae8 The full-length cDNA is 4731 bp, encoding 1576 amino acids, while the full-length gDNA is 6876 bp, containing 4 exons and 3 introns. Figure 2 A), whose nucleotide sequence is shown in SEQ ID NO.1 and whose amino acid sequence is shown in SEQ ID NO.2.
[0034] To study the candidate gene AetNLR2 for pmAeCIae8_2DS CIae8 The expression pattern was determined by real-time quantitative PCR using primer pairs P3: AACAAGCTGCACTCCAATGG (SEQ ID NO.5) and P4: TCACCGTCTTTGTCCTCCAA (SEQ ID NO.6) to detect AetNLR2 in CIae8 and PI546647 cells after RNA inoculation at 0 h, 8 h, 24 h, 48 h, and 72 h. CIae8 The expression level of AetNLR2 was found. CIae8 The expression pattern is consistent with the transcriptome expression data. Figure 2 B).
[0035] The above transcriptome analysis and gene cloning can be performed using the following methods.
[0036] 1. Transcriptome sample preparation, sequencing, and expression analysis
[0037] RNA sample preparation is as follows: Place 0.1g of leaf tissue into a 2.0mL RNase-free centrifuge tube and grind at 1500rpm for 30-60s. Add 1mL of TRIPURE and mix by inverting. Vortex at 1000rpm for 15 seconds and incubate at room temperature for 3 minutes to allow complete ribosome dissociation. Centrifuge at 12000rpm for 10 minutes at 4℃ and collect the supernatant to remove high molecular weight DNA and outer membrane. Add 0.2mL of chloroform to the centrifuge tube and vortex vigorously for 15 seconds to mix. Incubate at room temperature for 2-3 minutes. Centrifuge at 12000rpm for 10-15 minutes at 4℃. At this point, the solution and precipitate should be clearly separated into three layers. Transfer the supernatant to a 1.5mL RNase-free centrifuge tube. Add an equal volume of pre-chilled isopropanol, mix by inverting, and incubate at room temperature for 10 minutes. Centrifuge at 12000rpm for 10 minutes at 4℃. Discard the supernatant; at this point, RNA will form a gel-like precipitate at the bottom of the centrifuge tube. Add 1 mL of 75% ethanol prepared with RNase-free H2O and wash the precipitate. Centrifuge at 12000 rpm for 3 min at 4°C and carefully discard the supernatant. Place in a fume hood for 2-3 min to evaporate excess ethanol, then add 30-100 μl of RNase-free H2O to fully dissolve the RNA. After dissolution, store at -70°C. Take 1 μL of total RNA and add 4 μL of 10× loading buffer for electrophoresis on a 1% agarose gel (220V, 15 min). Three clear 5S, 18S, and 28S bands should be visible, with no dragging in the wells. Simultaneously, measure the absorbance at 260 nm and 280 nm on a Nano Drop. For high-purity RNA samples, the A260 / A280 ratio should be close to 2.0.
[0038] 2. AetNLR2 CIae8 Acquisition of gene sequences
[0039] First-strand cDNA synthesis: Performed according to the Novozymes reverse transcription kit (HiScript III 1st Strand cDNASynthesis Kit (+gDNA wiper)).
[0040] Template denaturation: Mix 1 μg RNA template with 6 μl RNase-free ddH2O thoroughly and incubate at 65℃ for 5 min; then incubate on ice for 2 min.
[0041] Genomic DNA removal: Add 2 μl of 5×gDNA Wiper Mix to the previous mixture and mix well. Then 42℃ for 2-3 min.
[0042] Long fragment reverse cDNA: Add 2 μl 5×gDNA Wiper Mix, 2 μl 10×RT Mix, 2 μl HiScript III enzyme Mix, 1 μl Oligo (dT), and 5 μl RNase-free ddH2O to the mixture from the previous step. Mix well and incubate at 37°C for 45 min followed by 85°C for 5 sec. After completion, store at -80°C.
[0043] AetNLR2 CIae8 Gene sequence cloning: AetNLR2 was cloned using primers P1:CACACCCCATAATCTTGCCG (SEQ ID NO.3) and P2:GCTCTTGGACGCTTTGTTGA (SEQ ID NO.4). CIae8 .
[0044] PCR reaction system (50 μL): cDNA: 5 μL, forward and reverse primers (10 μmol / μL) 2 μL each, ddH2O 18 μL, 2×Phata Max Mix Buffer 25 μL, total 50 μL. PCR reaction program: 95.0℃ denaturation for 5 min; 95.0℃ denaturation for 20 s, 56-60℃ annealing for 30 s, 72℃ extension for 3 min, for a total of 35 cycles; 72℃ extension for 10 min; store at 10℃. PCR reactions were performed using an MJResearch PTC-225 thermal cycler. PCR products were analyzed by agarose gel electrophoresis.
[0045] Real-time quantitative PCR and data analysis: AetNLR2 in processed samples CIae8 The expression level was identified using the AceQ qPCR SYBR Green Master Mix (without ROX) kit from Novizan. The RT-PCR system was as follows: 5 μl 2×AceQ® qPCR SYBR® Green Master Mix, 0.2 μl Primer-F / R (10 μM), 1 μl cDNA, and ddH2O to a final volume of 10 μl. After preparation, the RT-PCR was performed on a Roche 480 real-time quantitative PCR instrument, with three replicates per experiment. The program was as follows: pre-denaturation: 95℃ for 5 min; amplification program, 40 cycles: 95℃ for 10 s, 60℃ for 30 s; extension: 72℃ for 5 min; 10℃ for 3 min; data processing: based on the CT values obtained from qRT-PCR, the internal reference gene TaActin was amplified using primers P3 and P4, and the expression level of different samples relative to the control was calculated. -△△CT Where △△CT = (CT) Target -CT Actin ).
[0046] Example 3: Analysis of EMS-susceptible mutants of the powdery mildew gene
[0047] Mutagenesis was induced in 1000 seeds of the jointed goatgrass recombinant inbred line RIL11-1 containing only pmAeCIae8_2DS using 0.5% ethylmethane sulfonate (EMS). Powdery mildew resistance to E26 was assessed in 2400 M1 generation plants, yielding one independent susceptible mutant (Mution11). Primers P1: CACACCCCATAATCTTGCCG (SEQ ID NO.3) and P2: GCTTTGGACGCTTTGTTGA (SEQ ID NO.4) were used to target the mutant AetNLR2. CIae8 Full-length cloning revealed that all four mutants contained point mutations, which led to the formation of AetNLR2. CIae8 Missense mutation occurs ( Figure 3 (This further explains AetNLR2) CIae8 It is a candidate gene for pmAeCIae8_2DS.
[0048] The above gene cloning can be performed using the following methods.
[0049] AetNLR2 CIae8 Cloning of the full-length sequence
[0050] AetNLR2 CIae8 PCR amplification of the full-length sequence of AetNLR2: primers P1 and P2 were used to amplify the AetNLR2 in gDNA. CIae8 The full length of the sample was amplified by PCR; the method was the same as in Example 2, PCR amplification;
[0051] Purification and recovery of the target product: Using the Qingke Biotechnology agarose gel extraction kit, the target band was cut out under UV light and placed in a 2.0 mL tube. 400-500 μL of Buffer GL was added, and the mixture was heated at 65℃ for 300 rpm for 5 min in a metal bath until the colloid was completely melted. 250 μL of Buffer BL was added to the EC adsorption column to activate the silica membrane. The completely melted gel product was transferred to the adsorption column and centrifuged at 12000 rpm for 1 min, discarding the waste liquid at the bottom of the tube. 700 μL of Buffer W2 was added to the adsorption column, and the mixture was centrifuged at 12000 rpm for 1 min, discarding the supernatant. This process was repeated twice. The adsorption column was returned to the tube and centrifuged at 12000 rpm for 2 min, discarding any excess waste liquid. The mixture was allowed to stand at room temperature for 2 min, and the adsorption column was placed in a new tube with 30-50 μL of elution buffer Eluent added. After standing for 2 min, the mixture was centrifuged at 12000 rpm for 2 min. This process was repeated twice. The recovered sample was then transferred to a nanometer. Measure the concentration on the drop and store at -20°C.
[0052] Cloning of the target product: Following the Novozymes blunt-end cloning vector construction kit, the following steps were performed: 1 μL 5×TA / Blunt-Zero Cloning Mix, 1 μL DNA recovery product, and 3 μL ddH2O were mixed thoroughly and recombinated at room temperature for 5-10 min; 50 μL DH5α E. coli competent cells were added; after incubation on ice for 15 min, heat shock was performed at 42℃ for 40-60 sec; after incubation on ice for 2 min, 800 μL LBO medium was added; after activation at 37℃ and 220 rpm for 1 h, the cells were plated on LB agar plates containing ampicillin resistance and incubated upside down for 12 h; single clones were picked with sterile toothpicks and identified by colony PCR; positive single clones were sent to Qingke Biotechnology for sequencing; the obtained AetNLR2... CIae8 The full-length sequence is shown in SEQ ID NO.1.
[0053] Example 4: Validation of AetNLR2 using single-cell transient expression technology CIae8 Functions
[0054] To verify AetNLR2 CIae8 The disease resistance function of AetNLR2 was amplified using recombinant primers P5: TGGAGAGAACACGGGGGATCCATGGAGCTGGTGGTGGGCGCGC (SEQ ID NO.7) and P6: AACGTCGTATGGGTAAGGCCTTCACTGTTGAATGATTATCTT (SEQ ID NO.8). CIae8CIae8 Vector. The formation of haustoria in powdery mildew is fundamental for plant cells to absorb nutrients for growth and reproduction; haustoria formation is often used as an important indicator of powdery mildew resistance. pBI220-AetNLR2 was co-expressed in the young leaves of the susceptible material Yangmai 158 using gene gun-mediated single-cell transient expression technology. CIae8 Using pBI220 and pWMB220-GUS co-expressing Yangmai 158 as a negative control, it was found that: when GUS was expressed alone (empty control), the haustorium index (HI) of Yangmai 158 was 68.7%; GUS and pBI220-GUS expression were also expressed. CIae8 During co-conversion, the aspirator index (HI) of Yangmai 158 was 52.7% (Figure 4); indicating that AetNLR2 CIae8 Transient overexpression of these substances can, to some extent, prevent the formation of the accumulator.
[0055] As shown in Figure 4.
[0056] The above technologies can be achieved through the following methods:
[0057] 1. Overexpression vector pBI220-AetNLR2 CIae8 Construction
[0058] To include AetNLR2 CIae8 Using the full-length cloning plasmid as a template, PCR amplification was performed using recombinant primers P5 and P6. The pBI220 empty vector was digested with BamHI and SacI restriction enzymes. The linearized vector and the amplified target fragment were purified and recovered. Using the Novavirenz ClonExpress II One Step Cloning Kit, the following mixture was prepared: X μL linearized vector, Y μL insert fragment, 2 μL 5×CE II Buffer, 1 μL Exnase II, and ddH2O added to a final volume of 10 μL (X = [0.02 × vector base pairs] ng, Y = [0.04 × fragment base pairs] ng). After thorough mixing, the mixture was incubated at 37°C for 30 min. The transformation and sequencing methods are described in Example 4, gene cloning method.
[0059] 2. Overexpression of AetNLR2 in young leaves of Yangmai 158 using single-cell transient expression technology. CIae8
[0060] Single-cell transient expression technology: The mixed expression vector was thoroughly mixed with gold powder and then bombarded with epidermal cells of fresh leaves of Yangmai 158 at the two-leaf stage using a PDS1000 / He gene gun transformation system. The bombardment conditions were as follows: a ruptureable membrane with a diameter of 1.0 cm and a pressure of 900 psi was used, and the vacuum level during bombardment was 27 inches. The steps are as follows:
[0061] (1) Preparation of gold powder: Weigh 30 mg of gold powder into a 1.5 mL Eppendorf tube; add 70% alcohol, vortex for 5 min, and let stand for 15 min to allow the gold powder to precipitate completely; centrifuge for 5 sec and discard the supernatant; repeat the above step 3 times. Add 1 mL of water, vortex for 1 min, let stand for 1 min, centrifuge for 2 sec and discard the supernatant; add 50% glycerol and vortex thoroughly until homogeneous, and store at -20℃.
[0062] (2) Bullet preparation: After removing the gold powder from -20℃, vortex for 5 min; pipette the gold powder into a 1.5 mL Eppendorf tube at a rate of 2 µL / gun; add the plasmid at a rate of 1 µg / gun; while vortexing, add 50 µL of 2.5 M CaCl2 to the Eppendorf tube, then add 20 µL of 0.1 M spermine, vortex for 3 min; let stand for 1 min, centrifuge for 2 sec, and discard the supernatant; add 140 µL of 70% ethanol, vortex thoroughly, centrifuge for 2 sec, and discard the supernatant; add 140 µL of 100% ethanol, vortex thoroughly, centrifuge for 2 sec, and discard the supernatant; add 15 µL of 100% ethanol, vortex thoroughly, and prepare for use.
[0063] (3) Bombardment: After fully vortexing the wrapped bullets again, evenly coat them onto the macrocarriers and let them air dry; install the rupture membrane, and wet the rupture membrane with anhydrous ethanol before installation; place the macrocarriers on the first layer, place the culture medium with Yangmai 158 leaves on the second layer, and then vacuum to 28 inches; turn on the switch to bombard.
[0064] 3. Staining of powdery mildew haustoria and statistical analysis of haustoria index
[0065] A lower haustorium index indicates stronger resistance to powdery mildew. The haustorium index is the proportion of cells forming haustoria to the total interacting cells. The staining of haustoria and the statistical analysis of the haustorium index in this study can be performed following these steps:
[0066] Leaves bombarded with gene guns were cultured in the dark for 4-6 hours and then inoculated with wheat powdery mildew. About 42 hours after inoculation, the leaves were immersed in staining solution and then placed in a 37°C incubator for 12-24 hours for GUS staining. The presence or absence of haustoria was observed under a microscope in cells infected with powdery mildew spores and expressing the GUS reporter gene, and the haustoria index was counted.
[0067] Example 5: Verification of AetNLR2 using Barley Striped Mosaic Virus-Induced Gene Silencing (BSMV-induced gene silence, VIGS) technology CIae8 Functions
[0068] The wheat VIGS system utilizes the replication and transcription of barley stripe mosaic virus (BSMV) carrying a target fragment within wheat to induce gene silencing through the degradation or epigenetic modification of homologous gene mRNA. Based on sequence alignment, gene-specific regions were selected, and the candidate gene AetNLR2 for pmAeCIae8_2DS was designed. CIae The VIGS amplification primers P7: CTTCCGTTTCTAAGGAAGTTTAAAGTTGGATTTGACGCTGCAG (SEQ ID NO.9) and P8: TTTTAACCACCACCACCGTAGACACGGTGACCATGGCACG (SEQ ID NO.10) amplified AetNLR2. CIae8 A specific 253bp fragment, “CTTCCGTTTCTAAGGAAGTTTAAAGTTGGATTTGACGCTGCAGACAACCAGGACGAGAGCCGCCAGCTTGTCGCCGTGAAGGACCCCGTGGGAGTGGAGGAACACATGGGGGATCTCGACAAGCGGGTGACCTACATCGTCGGCTTCGGGGGAGTGGGGAAGACCGCCATCGCCACTGCCTTGTACAGGAAATTTGGGGACCGATTTGGCCACCGTGCCATGGTCACCGTGTCTACGGTGGTGGTGGTTAAAA”, was inserted into the ApaI restriction site of BSMV-γ to construct BSMV-γ-AetNLR2. CIae8 carrier. Combine BSMV-α, BSMV-β, BSMV-γ, BSMV-PDS and BSMV-γ-AetNLR2 CIae8 The virus was recombined in *Agrobacterium tumefaciens* EHA105 and then in *Tobacco Bengal* leaves after 3-4 weeks. After recombination, the virus was rubbed onto *R. tumefaciens* RIL11-1, a disease-resistant jointed goatgrass material containing only pmAeCIae8_2DS, at the two-leaf-one-heart stage. When the plants coated with BSMV-PDS showed photobleaching, AetNLR2 was used... CIae8 Specific qRT-PCR primers Q-NLR1-F / R are used to apply BSMV-γ-AetNLR2. CIae8 The plants were tested for silencing efficiency and inoculated with powdery mildew, with BSMV-Mock applied as a negative control. Results showed that, compared to the negative control BSMV-γ-EV, silencing a single AetNLR2 plant significantly improved efficiency. CIae8 The expression level decreased significantly ( Figure 5A Furthermore, the powdery mildew phenotype of silent individual plants showed varying degrees of susceptibility symptoms compared to the negative control. Figure 5BThis further validates AetNLR2. CIae8 pmAeCIae8_2DS positively regulates powdery mildew resistance.
[0069] The steps for determining the efficiency of silence are as follows:
[0070] (1) RNA was reverse transcribed into short cDNA fragments using the Novozymes short fragment reverse transcription HiScript RT SuperMix for qPCR kit.
[0071] The reverse transcription system consisted of 1 μl template RNA, 4 μl 4×gDNA wiper Mix, and 11 μl RNase-free ddH2O. After mixing thoroughly, the mixture was incubated at 42℃ for 2 min and then on ice for 2 min. 5×Hiscript qRT SuperMix was then added, mixed thoroughly, and incubated at 37℃ for 15 min and then at 85℃ for 5 sec. After the reverse transcription was completed, the mixture was stored at -20℃.
[0072] AetNLR2 in processed samples CIae8 The expression level was identified using the AceQ qPCR SYBR Green Master Mix (without ROX) kit from Novizan. The qRT-PCR system was as follows: 5 μl 2×AceQ® qPCR SYBR® Green Master Mix, 0.2 μl Primer-F / R (10 μM), 1 μl cDNA, and ddH2O to a final volume of 10 μl. After preparation, the qRT-PCR was performed on a Roche 480 real-time quantitative PCR instrument, with three replicates per experiment. The program was as follows: pre-denaturation: 95℃ for 5 min; amplification program, 40 cycles: 95℃ for 10 s, 60℃ for 30 s; extension: 72℃ for 5 min; 10℃ for 3 min; data processing: based on the CT values obtained from qRT-PCR, the internal reference gene TaActin was amplified using primers P3 and P4, and the expression level of different samples relative to the control was calculated. -△△CT Where △△CT = (CT) Target -CT Actin ).
[0073] Sequence List:
[0074] <110> Nanjing Agricultural University
[0075] <120> AetNLR2 is a candidate gene for the jointed goatgrass powdery mildew resistance gene pmAeCIae8_2DS. CIae8 and its applications
[0076] <160> 10
[0077] <210> 1
[0078] <211>3054
[0079] <212>DNA
[0080] <213>Aegilops tauschii
[0081] <220>
[0082] <223>AetNLR2 CIae8
[0083] <400>1
[0084]
[0085] <210> 2
[0086] <211> 1017
[0087] <212> PRT
[0088] <213> Aegilops tauschii
[0089] <220>
[0090] <223> protein AetNLR2 CIae8
[0091] <400> 2
[0092]
[0093] <210> 3
[0094] <211> 20
[0095] <212> DNA
[0096] <213> Artificial sequence
[0097] <220>
[0098] <223> Primer P1
[0099] <400> 3
[0100] CACACCCCATAATCTTGCCG
[0101] <210> 4
[0102] <211> 20
[0103] <212> DNA
[0104] <213> Artificial sequence
[0105] <220>
[0106] <223> Primer P2
[0107] <400> 4
[0108] GCTCTTGGACGCTTTGTTGA
[0109] <210> 5
[0110] <211> 20
[0111] <212> DNA
[0112] <213> Artificial sequence
[0113] <220>
[0114] <223> Primer P3
[0115] <400> 5
[0116] AACAAGCTGCACTCCAATGG
[0117] <210> 6
[0118] <211> 20
[0119] <212> DNA
[0120] <213> Artificial sequence
[0121] <220>
[0122] <223> Primer P4
[0123] <400> 6
[0124] TCACCGTCTTTGTCCTCCAA
[0125] <210> 7
[0126] <211> 41
[0127] <212> DNA
[0128] <213> Artificial sequence
[0129] <220>
[0130] <223> Primer P5
[0131] <400> 7
[0132] TGGAGAGAACACGGGGGATCCATGGAGCTGGTGGTGGGCGC
[0133] <210> 8
[0134] <211> 42
[0135] <212> DNA
[0136] <213> Artificial sequence
[0137] <220>
[0138] <223> Primer P6
[0139] <400> 8
[0140] AACGTCGTATGGGTAAGGCCTTCACTGTTGAATGATTATCTT
[0141] <210> 9
[0142] <211> 43
[0143] <212> DNA
[0144] <213> Artificial sequence
[0145] <220>
[0146] <223> Primer P7
[0147] <400> 9
[0148] CTTCCGTTTCTAAGGAAGTTTAAAGTTGGATTTGACGCTGCAG
[0149] <210>10
[0150] <211>40
[0151] <212>DNA
[0152] <213>Artificial sequence
[0153] <220>
[0154] <223>Primer P8
[0155] <400>10
[0156] TTTTAACCACCACCACCGTAGACACGGTGACCATGGCACG
Claims
1. AetNLR2, a candidate gene for powdery mildew resistance derived from jointed goatgrass. CIae8 Its characteristics The nucleotide sequence is shown in SEQ ID NO.
1.
2. The gene AetNLR2 as described in claim 1 CIae8 The encoded protein is characterized by The amino acid sequences are SEQ ID NO.
2.
3. Contains the candidate gene AetNLR2 as described in claim 1 CIae8 The nucleic acid fragment expression cassette, recombinant expression vector, and recombinant bacteria.
4. The gene AetNLR2 as described in claim 1 CIae8 Application in regulating resistance to powdery mildew.
5. The use of the protein of claim 2 in regulating powdery mildew resistance.
6. A plant breeding method: increasing the activity and / or content of the protein described in claim 2 in a target plant, thereby enhancing or reducing the target plant's resistance to powdery mildew.
7. The method according to claim 6, characterized in that: The plant is a monocotyledonous plant or a dicotyledonous plant; the monocotyledonous plant is a grass family (Poaceae).
8. The method according to claim 6, characterized in that: By overexpressing the gene AetNLR2 as described in claim 1 in plants CIae8 To increase the activity and / or content of the protein described in claim 2 in the target plant.