KASP molecular marker related to soybean aphid resistance and application
By developing KASP molecular markers related to soybean aphid resistance, and utilizing specific primer sets and quantitative real-time PCR technology, the problems of long cycle, large environmental interference, and low accuracy in traditional soybean aphid resistance breeding were solved. This enabled early and efficient screening and a significant reduction in the breeding cycle, thereby improving soybean breeding efficiency.
Patent Information
- Application Number
- CN202610133337.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-30
- Publication Date
- 2026-04-14
AI Technical Summary
Traditional soybean aphid resistance breeding has a long cycle, is greatly affected by environmental conditions, has low accuracy of identification results, and the genetic mechanism of aphid resistance traits is complex, making it difficult to quickly aggregate excellent aphid resistance genes, which restricts the breeding efficiency of aphid-resistant soybean varieties.
We developed KASP molecular markers associated with soybean aphid resistance, targeting the SNP site at 11165119 bp on chromosome 8 of the soybean genome. We used specific primer sets and real-time PCR technology to achieve early genotyping identification, and provided corresponding detection methods and kits for rapid screening in soybean breeding.
It enables high-precision, low-cost early screening of aphid-resistant individuals, shortens the breeding cycle by 8-12 months, improves breeding efficiency, and reduces costs by more than 60%, making it suitable for large-scale breeding and germplasm resource evaluation.
Smart Images

Figure CN121852599A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular breeding technology, specifically relating to a KASP molecular marker related to soybean aphid resistance and its application. Background Technology
[0002] Soybeans are a crucial oilseed crop and a source of high-quality protein globally. Aphid infestation is one of the major biological stressors affecting soybean yield and quality. Soybean aphids suck soybean sap with their piercing-sucking mouthparts, causing stunted plant growth, curled and yellowing leaves, and transmitting viral diseases. In severe cases, this can lead to yield reductions of over 30%. Traditional soybean aphid resistance breeding relies mainly on field phenotypic identification, which suffers from long cycles, susceptibility to environmental conditions, and low accuracy. Furthermore, the genetic mechanisms of aphid resistance are complex, making it difficult for traditional breeding methods to quickly aggregate superior aphid-resistant genes, thus limiting the efficiency of developing aphid-resistant soybean varieties.
[0003] Molecular marker-assisted breeding (MAS) technology enables precise screening of early generations of crops, significantly improving breeding efficiency. Among these technologies, KASP (competitive allele-specific PCR) technology, due to its advantages of high throughput, low cost, no need for electrophoresis, and accurate results, has been widely applied in the development of molecular markers for important crop traits and in breeding practices. Developing specific KASP molecular markers by identifying SNPs associated with soybean aphid resistance through genome-wide association analysis (GWAS) is a key approach to achieving efficient breeding of aphid-resistant soybeans.
[0004] This study, through field aphid surveys conducted in Changchun, Jiutai, and Jilin provinces in 2022 and 2023, combined with GWAS analysis, identified the SNP locus Chr08_11165119 (located at 11165119 bp on soybean chromosome 8) as significantly associated with soybean aphid resistance. This locus exhibits a T→G nucleotide polymorphism, and its G allele homozygosity is closely related to the highly aphid-resistant phenotype in soybean. Currently, there are no KASP molecular markers targeting this locus applied in aphid-resistant soybean breeding practices. Therefore, developing specific KASP molecular markers for this locus and related detection technologies is of great significance for advancing the aphid-resistant soybean breeding process. Summary of the Invention
[0005] In view of this, the present invention provides a KASP molecular marker related to soybean aphid resistance, as well as corresponding primer combinations, detection methods and kits, to solve the core pain points of traditional aphid resistance breeding such as "long screening cycle, large environmental interference and low accuracy".
[0006] To achieve the above objectives, the present invention is implemented through the following solution:
[0007] This invention provides a KASP molecular marker associated with soybean aphid resistance, wherein the KASP molecular marker targets a SNP site at physical location 11165119 bp on chromosome 8 of the soybean genome; the SNP site exhibits T / G nucleotide polymorphism;
[0008] Based on the sequence information of soybean reference genome version Wm82.a2.v1, combined with GWAS analysis of 200 major soybean varieties in Northeast China and field aphid survey data from three locations over two consecutive years from 2022 to 2023, this invention identifies the SNP site (Chr08_11165119bp) on chromosome 8 as the core marker site. This site exhibits T→G nucleotide polymorphism and, through sequence analysis, is located in the functionally associated region of the soybean genome.
[0009] The present invention also provides a set of primers for the above-mentioned KASP molecular markers, the primers comprising:
[0010] The nucleotide sequence is as shown in SEQ ID NO. 1. Upstream specific primer 1 (F1);
[0011] The nucleotide sequence is as shown in SEQ ID NO. 2 for upstream specific primer 2 (F2);
[0012] The nucleotide sequence is shown in SEQ ID NO. 3. The downstream universal primer (R) is as follows.
[0013] SEQ ID NO.1:
[0014] GAAGGTGACCAAGTTCATGCT AAATGTGAAGATTCTGAGACCGTTGAT;
[0015] SEQ ID NO.2:
[0016] GAAGGTCGGAGTCAACGGATT AAATGTGAAGATTCTGAGACCGTTGAG;
[0017] SEQ ID NO.3:
[0018] CGAATGTGAATGGTTTTGTACTCTGATTC.
[0019] The primers provided by this invention have been verified by BLAST comparison with the soybean genome database, and there is no risk of primer dimerization or non-specific binding.
[0020] This invention provides a method for identifying soybean aphid resistance genotypes, the method comprising the following steps:
[0021] (1) Genomic DNA was extracted from soybean leaves, seeds and other tissues using the CTAB method or a commercial DNA extraction kit. The purity and concentration of the DNA were tested to ensure that the OD260 / OD280 was between 1.8 and 2.0 and the concentration was about 50 ng / μL.
[0022] (2) KASP-PCR amplification: Amplification was performed according to the following system and procedure: KASP-PCR amplification system 2μl reaction system: soybean sample DNA template, 5ng / μl, 1μl; 2x Master Mix for ASPCR V1 1μl; KASP Assay Mix, F1:F2:R=1:1:3, 0.02μl;
[0023] The reaction conditions included: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 sec, annealing at 61–55℃ for 40 sec, with a decrease of 0.6℃ per cycle, for 10 cycles; and denaturation at 95℃ for 20 sec, annealing at 55℃ for 40 sec, for 30 cycles.
[0024] (3) Use a real-time PCR instrument to detect the fluorescence signal of the amplification results, and determine the genotype of the soybean sample based on the fluorescence type;
[0025] The identification method is as follows:
[0026] When only FAM fluorescence signal is detected, the genotype is determined to be TT, i.e., soybean is susceptible to aphids;
[0027] When only HEX fluorescence signal is detected, the genotype is determined to be GG, which means soybean is resistant to aphids;
[0028] When both FAM and HEX dual fluorescence signals are detected simultaneously, the genotype is determined to be T / G heterozygous.
[0029] In the practical operation of this invention, especially in soybean breeding, preferentially selecting individuals with homozygous G alleles as parents can significantly increase the proportion of aphid resistance traits in the offspring population and accelerate the breeding process of aphid-resistant soybean varieties.
[0030] The present invention also provides a kit for detecting the above-mentioned KASP molecular marker, characterized in that the kit includes the above-mentioned primers and KASP Master Mix, positive control, negative control and PCR reaction buffer.
[0031] The kit provided by this invention can be directly used for large-scale laboratory testing. It is easy to operate, produces reliable results, and is suitable for early screening of aphid-resistant genotypes in soybean breeding.
[0032] This invention provides the application of the above-mentioned KASP molecular marker, the above-mentioned primers, any of the above-mentioned identification methods, or the above-mentioned kit in molecular marker-assisted breeding for soybean aphid resistance.
[0033] This invention provides the application of the above-mentioned KASP molecular marker, the above-mentioned primers, any of the above-mentioned identification methods, or the above-mentioned kit in the screening of aphid resistance in soybean germplasm resources.
[0034] This invention provides the application of the above-mentioned KASP molecular marker, the above-mentioned primers, any of the above-mentioned identification methods, or the above-mentioned kit in identifying soybean aphid resistance traits.
[0035] The molecular markers and corresponding SNP sites involved in this invention enhance the soybean's defense response to aphids by regulating the expression or function of related resistance genes, thereby improving the soybean's aphid resistance.
[0036] Compared with existing technologies, the present invention has the following advantages:
[0037] 1. Strong aphid resistance specificity: Verified by field trials in three locations over two consecutive years, the homozygous G allele phenotype is highly consistent with the aphid-resistant phenotype, resulting in high screening accuracy;
[0038] 2. Early and rapid screening: Genotyping can be completed during the soybean seedling stage, without waiting for aphids to occur in the field and for the plants to mature, shortening the breeding cycle by 8 to 12 months and reducing breeding costs by more than 60%;
[0039] 3. High-throughput adaptability: KASP technology does not require electrophoresis, and the detection time for a single sample is ≤2h. It can achieve high-throughput screening of 96 / 384-well plates, making it suitable for large-scale breeding and germplasm resource evaluation.
[0040] 4. Wide range of applications: It can be directly applied to soybean molecular marker-assisted breeding, aphid-resistant germplasm resource screening and innovation, and provides key technical support for the precision breeding of aphid-resistant soybean varieties.
[0041] In summary, the KASP molecular marker based on the 11165119bp locus (Chr08_11165119) on soybean chromosome 8, along with its specific primer set, detection method, and applications, provided by this invention, directly addresses the core pain points in soybean aphid resistance breeding: long phenotypic screening cycles, significant environmental interference, and low accuracy. This molecular marker targets aphid-related SNP loci validated in three fields over two consecutive years. It enables rapid and accurate genotyping using allele-specific fluorescent PCR technology, allowing for the screening of aphid-resistant individuals at the seedling stage without relying on field aphid phenotypes. It not only possesses the technical advantages of high specificity, high stability, and high throughput, but also fills the application gap of efficient molecular markers for soybean aphid resistance. It provides a key tool for the precise breeding of aphid-resistant soybean varieties, rapid evaluation of germplasm resources, and molecular marker-assisted breeding, demonstrating clear innovation, outstanding practicality, and broad industrial application value. It is of great significance for ensuring soybean yield and quality and promoting the green and efficient development of the soybean industry. Attached Figure Description
[0042] Figure 1 Manhattan plot (MLMM model) of genome-wide association analysis (GWAS) of soybean aphid resistance.
[0043] The horizontal axis in the figure represents soybean chromosomes 1 to 20, and the vertical axis represents the -log10(P) value of the association significance. A significantly high -log10(P) peak appears at the marked location on chromosome 8 (Chr08_11165119), indicating that this site is strongly associated with soybean aphid resistance.
[0044] Figure 2 Manhattan plot of genome-wide association analysis of soybean aphid resistance;
[0045] The x-axis and y-axis have the same meaning. Figure 1 The Chr08_11165119 locus on chromosome 8 still showed a significant association peak, verifying the stability of the association at this locus.
[0046] Figure 3 QQ plot (MLMM model) of GWAS analysis of soybean aphid resistance.
[0047] The horizontal axis represents the expected −log10(P) value, and the vertical axis represents the actual observed −log10(P) value. Most points are close to the diagonal, indicating low false positive interference in the analysis. The observed value of the target site (Chr08_11165119) deviates significantly from the diagonal, verifying the authenticity of the association.
[0048] Figure 4 QQ plot of GWAS analysis of soybean aphid resistance;
[0049] The x-axis and y-axis have the same meaning. Figure 3This further verifies the authenticity of the target site association and the reliability of the analysis results.
[0050] Figure 5 This is a schematic diagram of the KASP primer design;
[0051] The primer binding region and fluorescent label type of the target SNP site are shown. Detailed Implementation
[0052] This invention aims to provide a KASP molecular marker related to soybean aphid resistance and its application. The technical solution of this invention is described in detail below with reference to the accompanying drawings, primer sequences, and specific embodiments.
[0053] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions.
[0054] Example 1
[0055] Identification of SNPs associated with soybean aphid resistance
[0056] Two hundred soybean varieties commonly cultivated in Northeast China were selected and planted in experimental fields in Changchun City, Jiutai District, and Jilin City in 2022. A randomized complete block design with three replicates was used, and conventional agronomic management was implemented. Aphid infestation was investigated during the soybean V5-R6 growth stage (under natural aphid infestation conditions), and the aphid infestation index was calculated to determine the aphid resistance level of the varieties. In 2023, 24 candidate aphid-resistant and susceptible varieties were re-investigated and verified in the experimental fields of Changchun City and Jiutai District. A total of 18,530 soybean plants were investigated to ensure that the growth stages of the investigated materials were consistent and that the groups were comparable.
[0057] Genomic DNA was extracted from leaves of seedlings of various varieties. SNP data for the entire chromosome 8 region were obtained through resequencing. GWAS analysis (using two mainstream models, MLMM and BLINK) was then used to screen for loci associated with aphid resistance. Among these, the Manhattan plot (… Figure 1 , Figure 2 The graph shows a significant association peak at 11165119 bp on chromosome 8, as indicated by the QQ plot. Figure 3 , Figure 4 The authenticity of the association was verified (low false positive rate), and the T / G polymorphic SNP site (Chr08_11165119) was finally identified as the core marker site. The association between this site and soybean aphid resistance was P<0.01, and the aphid index of the G allele homozygous variety was significantly lower than that of the T allele homozygous variety.
[0058] Example 2
[0059] Development of KASP primer sets targeting target SNP sites
[0060] Based on the soybean reference genome Wm82.a2.v1 sequence, a set of KASP primers was designed targeting the T / G polymorphism site at 11165119 bp (Chr08_11165119) on soybean chromosome 8. Following KASP technical specifications, the 3' ends of two allele-specific primers correspond to different alleles at the corresponding SNP site, and different fluorescent tag sequences (FAM and HEX) are introduced at the 5' ends. The universal primers are complementary to the downstream sequences at the SNP site. The primer sequences are as follows:
[0061] Allele T-specific primer K-Aphid-FAM:
[0062] 5'- GAAGGTGACCAAGTTCATGCT AAATGTGAAGATTCTGAGACCGTTGAT-3', SEQ ID NO.1, (underlined is the FAM fluorescent tag sequence);
[0063] Allele G-specific primer K-Aphid-HEX:
[0064] 5'- GAAGGTCGGAGTCAACGGATT AAATGTGAAGATTCTGAGACCGTTGAG-3', SEQ ID NO.2, (underlined is the HEX fluorescent tag sequence);
[0065] Universal primer K-Aphid-Common: 5'-CGAATGTGAATGGTTTGTACTCTGATTC-3', SEQ ID NO.3;
[0066] After purification by HPLC, the primers were verified by soybean genome BLAST comparison. No non-target regions with homology ≥85% were bound, ensuring amplification specificity.
[0067] A schematic diagram of the KASP primer design is shown below. Figure 5 As shown.
[0068] Example 3
[0069] Validation and Application of KASP Molecular Markers
[0070] Fifteen soybean varieties that had passed field trials and were identified as resistant or susceptible to aphids (7 resistant varieties and 8 susceptible varieties) were selected. Genomic DNA was extracted from the leaves of each variety at the seedling stage and the concentration was adjusted to 50 ng / μL (OD). 260 / OD 280=1.8~2.0), and a 2μL KASP amplification system (containing 1μL DNA template (5ng / μL), 1μL 2×KASP Master Mix, and 0.04μL primer mixture (F1:F2:R=1:1:3)) was used for detection. The reaction conditions were 95℃ pre-denaturation for 10 min, 95℃ denaturation for 20 sec + annealing at 61~55℃ for 40 sec (decreasing by 0.6℃ per cycle, 10 cycles), and 95℃ denaturation for 20 sec + annealing at 55℃ for 40 sec (30 cycles). After amplification, the genotype was determined by a real-time PCR instrument.
[0071] The results showed that HEX fluorescence signals were detected in all seven aphid-resistant varieties, indicating homozygous G alleles; FAM fluorescence signals were detected in all eight aphid-susceptible varieties, indicating homozygous T alleles. This demonstrates that the genotype of this KASP molecular marker highly matches the soybean aphid resistance phenotype and can be efficiently applied to the rapid screening of aphid-resistant soybean germplasm resources and marker-assisted breeding.
[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. A KASP molecular marker associated with soybean aphid resistance, characterized in that, The KASP molecular marker targets the SNP site at a physical location of 11165119 bp on chromosome 8 of the soybean genome; The SNP site exhibits T / G nucleotide polymorphism.
2. A set of primers for detecting the KASP molecular marker of claim 1, characterized in that, The primers include: The nucleotide sequence is as shown in SEQ ID NO. 1 for upstream specific primer 1; The nucleotide sequence is as shown in SEQ ID NO. 2, upstream specific primer 2; The nucleotide sequence is shown in SEQ ID NO.
3. A downstream universal primer.
3. A method for identifying soybean aphid resistance genotypes, characterized in that, The identification method includes the following steps: (1) Extract genomic DNA from the soybean sample to be tested; (2) Using genomic DNA as a template, KASP-PCR amplification was performed using the primers described in claim 2 to obtain the amplification results; (3) Use a real-time PCR instrument to detect the fluorescence signal of the amplification results, and determine the genotype of the soybean sample based on the fluorescence type.
4. The identification method according to claim 3, characterized in that, The reaction program for KASP-PCR amplification in step (2) is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s, annealing at 61℃~55℃ for 40 s, decreasing by 0.6℃ for each cycle, for a total of 10 cycles; denaturation at 95℃ for 20 s, annealing at 55℃ for 40 s, for a total of 30 cycles.
5. The identification method according to claim 3, characterized in that, The identification method described in step (3) is as follows: When only FAM fluorescence signal is detected, the genotype is determined to be TT, i.e., soybean is susceptible to aphids; When only HEX fluorescence signal is detected, the genotype is determined to be GG, which means soybean is resistant to aphids; When both FAM and HEX dual fluorescence signals are detected simultaneously, the genotype is determined to be T / G heterozygous.
6. A kit for detecting the KASP molecular marker of claim 1, characterized in that, The kit includes the primers as described in claim 2.
7. The application of the KASP molecular marker of claim 1, the primer of claim 2, the identification method of any one of claims 3 to 5, or the kit of claim 6 in marker-assisted breeding for soybean aphid resistance.
8. The application of the KASP molecular marker of claim 1, the primer of claim 2, the identification method of any one of claims 3 to 5, or the kit of claim 6 in the screening of aphid resistance in soybean germplasm resources.
9. The application of the KASP molecular marker of claim 1, the primer of claim 2, the identification method of any one of claims 3 to 5, or the kit of claim 6 in identifying soybean aphid resistance traits.