Molecular marker for early detection of tripistil wheat and detection method

By designing specific molecular marker primers combined with PCR and gel electrophoresis techniques, the problem of identifying the three-pistil trait in wheat breeding was solved, enabling early, rapid, and accurate detection and improving breeding efficiency.

CN121852604APending Publication Date: 2026-04-14CHINA WEST NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610180205.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-09
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies are insufficient for rapidly and accurately identifying the three-pistil trait in wheat breeding, resulting in low breeding efficiency and hindering large-scale application.

Method used

By designing specific molecular marker primers and combining PCR and gel electrophoresis techniques, we can identify *Triticum aestivum* by detecting specific nucleotide sequences, thus enabling early detection.

Benefits of technology

It enables rapid and accurate identification of three-pistil wheat, shortens the detection cycle, and achieves an accuracy rate of up to 96.08%, providing technical support for wheat breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention provides a molecular marker for early detection of tripistil wheat. The molecular marker comprises a nucleotide sequence as shown in SEQ ID NO. 3 and / or SEQ ID NO. 4. The molecular marker provided by the invention can distinguish tripistil wheat from common wheat, has the characteristics of rapidness, high efficiency, accuracy, practicability and the like, and plays an important role in tripistil wheat identification and wheat high-yield molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker and detection method for early detection of three-stalked wheat. Background Technology

[0002] Triticum aestivum L. with three pistils (TP) is an important type of genetic variation. Unlike common wheat (single pistil, SP), a single flower of triticum aestivum contains three normally developed pistils, while the number and structure of the other floral organs are normal. This characteristic allows triticum aestivum to produce three conjoined seeds after pollination, significantly increasing the number of grains per ear and thus the potential to increase wheat yield per unit area. In wheat genetic breeding practices, the triticum trait is considered one of the key genetic resources for increasing wheat yield due to its significant advantage in the number of grains per ear. Integrating the triticum trait into superior varieties is of significant strategic importance for breeding high-yielding wheat varieties and ensuring food security.

[0003] The identification of the tripithecidate trait in wheat still relies on traditional field phenotypic observation methods. This requires waiting until the wheat enters the heading stage or even after the grains mature, and then manually counting the number of pistils or the number of twin grains in the florets. This process is time-consuming (often taking several months), labor-intensive, and inefficient, which greatly limits the large-scale, rapid screening and application of this trait in breeding.

[0004] In the field of modern crop genetics and breeding, molecular marker technology has become an indispensable core tool due to its high efficiency and precision. This technology can directly reveal genetic differences at the DNA level, and the detection results are not affected by environmental factors. However, although molecular marker technology has obvious advantages, it still has significant shortcomings in identifying the three-pistil trait in wheat. For example, Guo Yuhuan, Screening and Identification of Candidate Genes Controlling the Three-Pistil Trait in Wheat [D], Xihua Normal University, 2023, disclosed the intervals related to the three-pistil trait; Liu Yingxi, Molecular Localization and Candidate Gene Analysis of Three-Pistil Genes in Wheat [D], Shanxi Agricultural University, 2024, disclosed some polymorphic markers and located the relevant genes within an interval, but due to the large target interval, it is difficult to achieve fine localization and cannot guarantee the accuracy of detection.

[0005] The latest research on the three-ovary gene reports the key gene TaWUS-D1, which is involved in the formation of the three-ovary trait (Activation of TaWUS-D1 drives multi-ovary floret development in bread wheat, Plant communication, 2025.10). However, this gene is present in both three-ovary wheat and common wheat, so three-ovary wheat cannot be identified by molecular detection.

[0006] Therefore, current technologies lack molecular markers that are closely linked to the three pistils trait in wheat and have high specificity and applicability. Summary of the Invention

[0007] To address the above problems, the present invention aims to provide a rapid and efficient method for early detection of three-stalk wheat.

[0008] The present invention provides a molecular marker for early detection of three-stalked wheat, the molecular marker comprising the nucleotide sequence shown in SEQ ID NO.3 and / or SEQ ID NO.4.

[0009] Furthermore, it also includes the nucleotide sequences shown in SEQ ID NO.1 and / or SEQ ID NO.2.

[0010] The present invention also provides primers for amplifying the nucleotide sequences shown in SEQ ID NO.1, 2, 3 and / or SEQ ID NO.4.

[0011] The primers are at least one of the following four primer pairs: Primer pairs SEQ ID NO. 5-6 are used to amplify the nucleotide sequence shown in SEQ ID NO. 1; Primer pairs SEQ ID NO. 7-8 are used to amplify the nucleotide sequence shown in SEQ ID NO. 2; Primer pairs SEQ ID NO. 9-10 are used to amplify the nucleotide sequence shown in SEQ ID NO. 4; Primer pairs SEQ ID NO. 11~12 are used to amplify the nucleotide sequence shown in SEQ ID NO. 4; The present invention also provides a kit for detecting tripidular wheat and common wheat, comprising the primers as described in claim 2 or 3.

[0012] This invention also provides the application of the above-mentioned molecular markers, primers, and kits in the detection of tripidular wheat and common wheat.

[0013] The present invention also provides a method for detecting tripithecidous wheat and common wheat, comprising the following steps: Using the genomic DNA of the sample to be tested as a template, PCR amplification was performed using the primers described above. The sample to be tested was identified based on the presence and sequence of the amplification products. If the sequences shown in SEQ ID NO. 3 and / or 4 can be amplified, it is tripidular wheat; if the sequences shown in SEQ ID NO. 3 and 4 cannot be amplified, but only the sequences shown in SEQ ID NO. 1 and 2 are amplified, it is common wheat.

[0014] This invention also provides the application of the above-mentioned molecular markers, primers, and kits in molecular marker-assisted breeding of wheat.

[0015] This invention designs specific molecular marker pairs and combines PCR and gel electrophoresis techniques to detect the presence or absence of target bands, determining whether wheat exhibits a three-pistil trait. This enables rapid and accurate identification of the three-pistil trait in wheat during the seedling stage. This invention can replace traditional phenotypic observation, significantly shortening the detection cycle. Comparison with field phenotypic statistical verification results shows an accuracy of up to 96.08%, making it a valuable reference for the detection of three-pistil wheat and providing technical support for accelerating wheat breeding and high-yield molecular breeding of wheat.

[0016] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the embodiments do not limit the present invention in any way. For those skilled in the art, any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention should be considered equivalent substitutions and are included within the protection scope of the present invention. Attached Figure Description

[0017] Figure 1 Molecular detection results of Fielder x TP F3 hybrid offspring and their corresponding paternal and maternal parents. Note: M: DL2000 DNA Maker; A: maternal parent, wild wheat (Fielder); B: paternal parent, three-stalked wheat (TP); 1-10: single plants of the hybrid population.

[0018] Figure 2 Schematic diagram of the floral organ structure of Triplophysa truncatum (TP) and Chinese Spring wheat (CS). Note: A: Chinese Spring wheat, containing one pistil; B: Triplophysa truncatum (TP), containing three pistils. Detailed Implementation

[0019] The present invention will be further described in detail below with reference to the embodiments, but the present invention is not limited thereto.

[0020] Unless otherwise specified, all reagents and materials used in the following examples and comparative examples are commercially available. Where specific techniques or conditions are not specified in the examples, they should be performed in accordance with the techniques or conditions described in the literature or the product instructions.

[0021] Example 1: Development and application of the molecular markers of the present invention 1. Materials and Methods 1.1 Test Materials The 23 wheat hybrid F1 cells used in this invention n Segregating populations and their corresponding paternal and maternal parent plants (specifically, wheat hybrid F1) n The segregating population types and their maternal and paternal parents are shown in Table 2. The wheat was planted in the experimental field of Xihua Normal University (30°49′N, 106°4′E). Population materials were obtained through multiple generations of self-pollination after artificial pollination of selected parents in hybridization experiments. The wheat materials for the tripithecidate trait included TP (tripithecidate wheat), CM28TP (CM28 and CM28TP are a pair of nearly isogenetic lines; CM28TP exhibits a tripithecidate phenotype), Y29 (a tripithecidate phenotype with generally purple seeds), and HTS-1 (a wheat stamen homologous transformation sterile mutant with carpelized stamens and a tripithecidate phenotype). The planting date for this experiment was October 12, 2024.

[0022] 1.2 Test Methods 1.2.1 Design of specific molecular markers Based on the whole-genome sequencing results of *Triticum aestivum*, a comparative analysis of its genome sequence with the standard reference genome of common wheat, "Chinese Spring," revealed a chromosomal structural variation (approximately 0.03 Mb of duplication and 0.4 Mb of deletion) at 589.7-590.1 Mb on chromosome 2D. Based on the characteristics of this key structural variation region, four specific molecular marker primers were designed and developed using Primer Premier 6 software (see Table 1 for specific primer sequence information, used for PCR detection in seedlings of wheat with the triticum aestivum trait). Primer specificity was tested on the wheat multi-omics website (http: / / wheatomics.sdau.edu.cn). All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Standard polymerase chain reaction (PCR) amplification (specific primer amplification product sequences are shown below) and agarose gel electrophoresis analysis demonstrated that this set of molecular markers can be used for early, rapid, and accurate identification of the triticum aestivum trait in wheat.

[0023] Table 1. Specific molecular marker primer sequences:

[0024] Product sequence of SP1 amplification (SEQ ID NO.1): GCACCCAGTATCCACAAGGGACTAAAATCATGAAAATTAGCACGCATCACTATAGTGTATTCTTGCTGGCGCGGTATTTTTTCTAGTGTTCTTAATGAACTGCATCTTACATTGCTAAGAAATGTGAATTGCTCTAGGCCTTTTCAGGTAAACTCTATTTTGCATGGGAGTATGGGATGAAACATCTGTACAACGTAGACAATCCCTGCATTAAAATGCTATCATATTTAGGGGATGAGTCTAGAATCTGTTTCGCCTTTATTTACGTTATTTGGATGCTGTAATGAAGGAAGGACATGTGCATCAGATTGTTATGTCTTTGTCTTTTTCTGCGAC Product sequence of SP2 amplification (SEQ ID NO.2): GTGGACAAAGAAATGGACTATATTACTTTTGAGGTATATAGAGTTCGGTTCACGTATTTGCCCCTTTGATGACAAGGCATTTGGCAGGACCACTCATAATTTAGGTTCTGAATTGAACAGAGGCTTGTATAGAATTACAGTTGTTACAATAGTGCCTGAGTTTCCTTCTCACCTTCCCTTTGTTTTATGGGAAGCAAGAGCAAACGATTTGTACATCTGTGTTGTAAATTAGATAATTATCATCTGTACCATACTGTTATATACTCCCTTGGATGTACAGATAAACTTCATATATCTGTTAACAAGGGATGTACCCAAGGAGTATTGTTATATACTCCCTTGGATGTACATCTGCATGAAAGTTGCCCATCTCCCTTCGATGTCTGATAGTGCCACCT Product sequence of TP1 amplification (SEQ ID NO.3): The sequence of the product of TP2 amplification (SEQ ID NO.4): 1.2.2 DNA Sample Preparation During the wheat seedling stage (three-leaf stage), 23 three-pistil wheat hybrid F1 plants cultivated in the field were collected. n Fresh young leaves (approximately 100 mg) were collected from the isolated population (10 individual plants randomly selected from each population) and their corresponding male and female parent plants (1 plant each). DNA extraction and purification were performed using a commercially validated plant genomic DNA extraction kit (Seville Biosciences). The concentration and purity (OD) of the extracted DNA were determined using a nano-spectrum spectrophotometer (NanoDrop2000). 260 / 280 If the concentration is >1.8, adjust the final concentration to 20 – 50 ng / μL and store at -20°C for later use.

[0025] Table 2. Segregation population types of Fn groups in three-pistil wheat hybrids:

[0026] 1.2.3 Polymerase Chain Reaction (PCR) The four synthesized specific molecular marker primers were first temperature optimized using a PCR instrument (rapid dual-groove gradient PCR instrument) to determine the optimal annealing temperature before proceeding to the next step of the experiment (see Table 1 for the optimal annealing temperatures of the specific primers). The three-pistil wheat hybrid F1 was used. n Genomic DNA from the isolated population and its corresponding paternal and maternal parents was used as samples for PCR amplification using four pairs of specific molecular marker primers. The total PCR amplification volume was 20 μL (see Table 4 for the specific PCR amplification system), and all amplification was performed using 2 x Taq PCRMasterMix polymerase (see Table 5 for the PCR reaction program of the four primer pairs). The amplified PCR products were stored at -20°C.

[0027] Table 3 PCR amplification system:

[0028] Table 4 PCR reaction procedure:

[0029] 1.2.4 Agarose gel electrophoresis detection The amplified PCR products were detected by electrophoresis using 1%–1.5% agarose gel (prepared fresh for each use). In the electrophoresis tank, 6 μL of PCR product was added to the sample wells of the gel using a micropipette, with 6 μL of DL2000 DNA Marker used as a control. The electrophoresis conditions were: 120 V for 30 min. After electrophoresis, the position and intensity of the electrophoretic bands were observed and recorded using a fully automated gel imaging analysis system.

[0030] 1.2.5 Field Validation During the critical stage of wheat reproductive development—from heading to flowering (April 2025)—23 three-pistil wheat hybrid F1 lines bred in the field were statistically analyzed. n The traditional phenotypic screening method of the number of pistils in the floral organs of segregating populations (10 individual plants randomly selected from each population) was used. Plants with three pistils per flower were classified as three-pistil wheat, and plants with one pistil per flower were classified as single-pistil wheat. This method accurately distinguishes three-pistil wheat from single-pistil wheat in the segregating population of three-pistil wheat hybrids. At the same time, the results of manual statistical analysis were compared and analyzed with the results of molecular marker detection to verify the accuracy of molecular marker detection.

[0031] 2 Results and Analysis 2.1 Using specific molecular markers to target F1 hybrids of three-pistil wheat n Separate groups for testing Genomic DNA samples were collected from 23 segregating Fn populations of *Tetrandrus triticum* hybrids (10 plants randomly selected from each population) and their corresponding paternal and maternal parents (one plant each). Specific molecular marker primers SP1, SP2, TP1, and TP2 were used for analysis. Taking the F3 hybrids of *Fielder* x *Tetrandrus triticum* and their corresponding paternal and maternal parents as an example... Figure 1 As shown, the detection results of molecular marker primers SP1 and SP2 (with bands of 336bp and 398bp simultaneously) indicate that the target band appears in the maternal parent Fielder wheat (A) and wheat plants numbered 1, 7, 8, and 9 of the hybrid offspring, but not in the paternal parent Tripithecus wheat (B) and wheat plants numbered 2, 3, 4, 5, 6, and 10 of the hybrid offspring. The detection results of molecular marker primers TP1 and TP2 (with bands of 1232bp and 1516bp simultaneously) indicate that the target band appears in the paternal parent Tripithecus wheat (B) and wheat plants numbered 2, 3, 4, 5, 6, and 10 of the hybrid offspring, but not in the maternal parent Fielder wheat (A) and wheat plants numbered 1, 7, 8, and 9 of the hybrid offspring.

[0032] The results showed that the maternal parent, Fielder wheat (A), and the hybrid offspring numbered 1, 7, 8, and 9 were single-pistil wheat, while the paternal parent, tripistil wheat (B), and the hybrid offspring numbered 2, 3, 4, 5, 6, and 10 were tripistil wheat. These results were consistent with expectations, indicating that this set of specific molecular markers can be used for the early detection of tripistil wheat.

[0033] 2.2 Identification of segregating Fn populations from three-pistil wheat hybrids During the wheat developmental stage from heading to flowering, morphological observations were conducted on the floral organs of each spikelet in 23 wheat hybrid segregating groups (10 plants per group + one male parent and one female parent). Examples of floral organ structures in tripidular wheat (TP) and Chinese spring wheat (CS) are shown below. Figure 2 As shown.

[0034] The field statistical results were compared and analyzed with the molecular detection results of the hybrid population and its parents. Among the 255 samples of hybrid population and its parents tested for molecular markers (230 hybrid populations and 25 parents), 245 were consistent with the field statistical results, with an accuracy rate of 96.08%. It can be seen that the molecular marker detection of the present invention is accurate and reliable, and highly consistent with the field statistical results.

[0035] In summary, the specific molecular markers designed in this invention can achieve rapid and accurate identification of the three-pistil trait in wheat during the seedling stage, with an accuracy rate of up to 96.08%. They have high reference value for the identification of three-pistil wheat and are suitable for widespread application.

Claims

1. A molecular marker for early detection of three-stamen wheat, characterized in that, The molecular markers include the nucleotide sequences shown in SEQ ID NO.3 and / or SEQ ID NO.

4.

2. The molecular marker according to claim 1, characterized in that, It also includes the nucleotide sequences shown in SEQ ID NO.1 and / or SEQ ID NO.

2.

3. Primers for amplifying the nucleotide sequences shown in SEQ ID NO.1, 2, 3 and / or SEQ ID NO.

4.

4. The primer according to claim 3, characterized in that, The primers are at least one of the following four primer pairs, wherein, Primer pairs SEQ ID NO. 5-6 are used to amplify the nucleotide sequence shown in SEQ ID NO. 1; Primer pairs SEQ ID NO. 7-8 are used to amplify the nucleotide sequence shown in SEQ ID NO. 2; Primer pairs SEQ ID NO. 9-10 are used to amplify the nucleotide sequence shown in SEQ ID NO. 3; Primer pairs SEQ ID NO.11~12 are used to amplify the nucleotide sequence shown in SEQ ID NO.

4.

5. A kit for detecting trifoliate wheat and common wheat, characterized in that, It includes the primers described in claim 3 or 4. The application of the molecular marker of claim 1 or 2, the primer of claim 3, and the kit of claim 5 in the detection of tripithecidal wheat and common wheat.

6. A method for detecting tripidular wheat and common wheat, characterized in that, Includes the following steps: Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the primers described in claim 3. The sample to be tested is identified based on the presence or absence of the amplification product and its sequence. If the sequences shown in SEQ ID NO.3 and 4 can be amplified, it is tripidular wheat; if only the sequences shown in SEQ ID NO.1 and 2 are amplified, it is common wheat.

7. The application of the molecular marker of claim 1 or 2, the primer of claim 3, and the kit of claim 5 in molecular marker-assisted breeding of wheat.