Lactobacillus paracasei with multi-matrix fermentation capability and application thereof
By synergistically combining Lactobacillus paracasei Shannan.LPA-972 with Streptococcus salivarius subsp. thermophilus Jiacha.ST-685 and Lactobacillus delbrueckii subsp. lactis Dangxiong LB Ⅷ, the problem of incompatibility between milk-based and plant-based starter cultures has been solved, enabling efficient and low-cost production of multi-substrate fermentation and improving the quality and sensory characteristics of fermented products.
Patent Information
- Application Number
- CN202610257065.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-04
- Publication Date
- 2026-04-17
AI Technical Summary
Existing milk-based and plant-based starter cultures are separate and cannot be used interchangeably, resulting in high production costs and complex processes. Furthermore, existing strains have limited functions, making it difficult for them to adapt to complex substrate environments, leading to low fermentation efficiency, slow acid production rates, limited variety of flavor compounds in fermentation products, and insufficient probiotic functions.
By using a synergistic blend of Lactobacillus paracasei Shannan.LPA-972, Streptococcus salivarius subsp. thermophilus Jiacha.ST-685, and Lactobacillus delbrueckii subsp. lactis Dangxiong LB Ⅷ, and utilizing their multi-substrate fermentation capabilities, through genes related to the phosphoenolpyruvate-glycosyltransferase system, fermentation can be carried out using multiple carbon sources to form a fermented product with rich flavor and silky texture.
It achieves broad adaptability to both milk-based and plant-based fermentation, improves fermentation efficiency by 30% to 50%, reduces production costs and process complexity, and enhances the nutritional and sensory quality of fermentation products.
Smart Images

Figure FT_1 
Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbiology, specifically relating to a type of Lactobacillus paracasei with multi-substrate fermentation capabilities and its applications. Background Technology
[0002] Existing milk-based starter cultures typically use animal milk sources (such as cow's milk and goat's milk) as the substrate, and the core microbial strains are usually a combination of Streptococcus salivarius and Lactobacillus delbrueckii. However, such microbial combinations have the following limitations: (1) the microbial strains have a single function and are only suitable for animal milk fermentation, making it difficult to adapt to the complex substrate environment (such as low lactose substrate, high fiber substrate, and anti-nutritional factor substrate) in plant-based raw materials (such as soy milk, coconut milk, and oat milk); (2) the fermentation products have a limited variety of flavor substances and insufficient probiotic functions.
[0003] Existing plant-based starter cultures mostly rely on single lactic acid bacteria or complex fungi (such as yeast), which have problems such as low fermentation efficiency, slow acid production rate, and loose texture. Furthermore, they cannot be used interchangeably with milk-based starter cultures, which requires two separate strain systems to be configured at the production end, increasing costs and process complexity.
[0004] Chinese patent CN119639605A discloses a ketone-flavored *Lactobacillus paracasei* strain and its application in the preparation of fermented dairy products. Experiments have shown that this *Lactobacillus paracasei* can produce diacetyl and acetoin during the fermentation of cow's milk. However, this *Lactobacillus paracasei* can only be used as a milk-based starter culture, and not as a plant-based starter culture. Summary of the Invention
[0005] The problem with the existing technology is that there is a lack of a universal starter culture that can be used for both fermentation of milk-based and fermentation of plant-based starter cultures.
[0006] To address the aforementioned problems in the existing technology, this invention provides a *Lactobacillus paracasei* with multi-substrate fermentation capability and its applications.
[0007] The specific technical solution is as follows: Technical Solution 1: A type of *Lactobacillus paracasei*, characterized in that the *Lactobacillus paracasei* is: *Lactobacillus paracasei* (… Lactobacillus paracasei Shannan.LPA-972, accession number CCTCC NO: M 20242026.
[0008] Technical Solution 2: According to Technical Solution 1, the Lactobacillus paracasei is characterized in that the 16S rDNA sequence of the Lactobacillus paracasei is shown in SEQ ID NO:3.
[0009] Technical Solution 3: According to Technical Solution 2, *Lactobacillus paracasei* is characterized in that the *Lactobacillus paracasei* carries genes related to the phosphoenolpyruvate-glycotransferase system. Preferably, the genes related to the phosphoenolpyruvate-glycotransferase system include one or more genes selected from the group consisting of galactitol-specific genes, galactitol-specific genes, galactose-specific genes, glucose-specific genes, and maltose-specific genes. More preferably, the phosphoenolpyruvate-glucose transferase system-related genes include one or more genes selected from the group consisting of galactitol-specific EIIB component genes, galactitol-specific EIIC component genes, galactose-specific EIIC component genes, glucose-specific EIIA component genes, and maltose-specific EIICB component genes.
[0010] Technical Solution 4: According to the *Lactobacillus paracasei* of Technical Solution 3, the galactitol-specific EIIB component gene contains the gene sequence shown in SEQ ID NO:4, and / or the gene sequence shown in SEQ ID NO:5, and / or the gene sequence shown in SEQ ID NO:6, and / or the gene sequence shown in SEQ ID NO:7, and the gene sequence shown in SEQ ID NO:8, of the maltose-specific EIICB component gene.
[0011] Technical Solution 5: *Lactobacillus paracasei* according to any one of Technical Solutions 1-4, characterized in that it has substrate utilization capability, wherein the substrate comprises one or more substances selected from the group consisting of D-ribose, D-ribitol, D-galactose, D-glucose, D-fructose, D-mannose, eugenol, mannitol, sorbitol, methyl-α-D-glucopyranoside, N-acetylglucosamine, ferric citrate of aesculin, salicin, D-cellobiose, D-maltose, D-lactose, D-sucrose, D-trehalose, inulin, D-melatonin, D-gentiobiose, D-thulene, D-tagatose, and potassium gluconate.
[0012] Technical Solution 6: The use of *Lactobacillus paracasei* as described in any one of Technical Solutions 1-5 in the preparation of *Lactobacillus paracasei* inoculum, starter culture, milk-based fermented milk, or plant-based fermented milk.
[0013] Technical Solution 7: A Lactobacillus paracasei inoculant, characterized in that it contains Lactobacillus paracasei as described in any one of Technical Solutions 1-5.
[0014] Technical Solution 8: The *Lactobacillus paracasei* inoculant according to Technical Solution 7, characterized in that the viable count of *Lactobacillus paracasei* in the inoculant is 2-3 × 10⁻⁶. 11 CFU / g, Preferably, the *Lactobacillus paracheirus* inoculant is prepared by the following steps: [The text abruptly ends here, likely due to an incomplete sentence or missing information.] The bacterial seed culture was inoculated into a fermentation medium for fermentation to obtain *Lactobacillus paracasei* fermentation broth. The fermentation broth was then separated into solid and liquid components and dried to obtain *Lactobacillus paracasei* inoculum. More preferably, the solid-liquid separation method is centrifugation, wherein the centrifugation speed is 8000-10000 r / min and the centrifugation time is 20-30 min, and / or the drying method is vacuum freeze-drying, wherein the vacuum degree of the vacuum freeze-drying is 20-25 Pa, the temperature is -25℃ to -20℃, and the time is 48-60 h. More preferably, the drying method is vacuum freeze-drying, wherein, by weight, the freeze-drying protectant used in vacuum freeze-drying includes 15-30 parts skim milk, 5-15 parts mannitol, 5-15 parts trehalose, 1-5 parts monosodium glutamate and 1-5 parts glycerol.
[0015] Technical Solution 9: A method for preparing Lactobacillus paracasei inoculant as described in Technical Solution 7 or 8, characterized in that it includes the following steps: inoculating Lactobacillus paracasei seed liquid into a fermentation medium for fermentation culture to obtain Lactobacillus paracasei fermentation broth, and then separating the solid and liquid components of the Lactobacillus paracasei fermentation broth and drying it to obtain Lactobacillus paracasei inoculant.
[0016] Technical Solution 10: The preparation method according to Technical Solution 9, characterized in that, based on the weight of the fermentation culture medium, the fermentation culture medium comprises 2-3 wt% glucose, 2-3 wt% yeast extract, 0.4-0.5 wt% anhydrous sodium acetate, 0.05-0.15 wt% diammonium hydrogen phosphate, 0.005-0.015 wt% magnesium sulfate heptahydrate, 0.005-0.015 wt% manganese sulfate, 0.05-0.15 wt% Tween 80, and the balance being water. More preferably, the fermentation culture is a high-density fermentation culture, wherein during the high-density fermentation culture, a carbon source is fed to maintain a residual sugar of 10-20 g / L, Na2CO3 is fed to maintain a pH of 4.5-5, and the culture is carried out at 37-40°C without aeration for 12-15 h.
[0017] Technical Solution 11: The preparation method according to Technical Solution 9 or 10 is characterized in that the seed culture of *Lactobacillus paracasei* is prepared by a method comprising the following steps: inoculating *Lactobacillus paracasei* into a seed culture medium for cultivation to obtain the seed culture of *Lactobacillus paracasei*. Preferably, the seed culture medium is prepared with water, wherein each liter of water comprises 5-15g of protease digest, 5-15g of beef extract powder, 5-15g of yeast extract powder, 1-5g of triammonium citrate, 1-5g of sodium acetate, 0.15-0.25g of magnesium sulfate heptahydrate, 0.045-0.055g of manganese sulfate tetrahydrate, 1.5-2.5g of dipotassium hydrogen phosphate, 20-25g of glucose, and 1.00-1.20g of Tween 80. More preferably, the solid-liquid separation method is centrifugation, wherein the centrifugation speed is 8000-10000 r / min and the centrifugation time is 20-30 min, and / or the drying method is vacuum freeze drying, wherein the vacuum degree of the vacuum freeze drying is 20-25 Pa, the temperature is -25℃ to -20℃, and the time is 48-60 h.
[0018] Technical Solution 12: The preparation method according to any one of Technical Solutions 9-11 is characterized in that the drying method is vacuum freeze-drying, wherein, by weight, the freeze-drying protectant used in vacuum freeze-drying includes 15-30 parts of skim milk, 5-15 parts of mannitol, 5-15 parts of trehalose, 1-5 parts of monosodium glutamate and 1-5 parts of glycerol.
[0019] Technical Solution 13: A fermentation agent, characterized in that, by weight, the fermentation agent comprises 40-45 wt% of *Streptococcus salivarius* subsp. *thermophilus*, 30-35 wt% of *Lactobacillus paracasei* as described in Technical Solution 7 or 8, and 20-25 wt% of *Lactobacillus delbrueckii* subsp. *lactophilus*.
[0020] Technical Solution 14: The fermenting agent according to Technical Solution 13, characterized in that the viable count of the *Lactobacillus delbrueckii* subsp. *lactam* agent is 2.5-3.5 × 10⁻⁶. 10 CFU / g, and / or the viable count of the *Streptococcus thermophilus* subsp. *salivarius* agent is 2-3 × 10⁻⁶. 11 CFU / g.
[0021] Technical Solution 15: The fermenting agent according to Technical Solution 13 or 14, characterized in that the number of viable bacteria of *Streptococcus salivarius* subsp. *thermophilus* in each g of the fermenting agent is 1.2-1.35 × 10⁻⁶. 11 The viable count of CFU and / or the *Lactobacillus delbrueckii* subsp. *lactamella* is 0.6-0.75 × 10⁻⁶. 10 The viable count of CFU and / or the *Lactobacillus paracasei* is 0.9-1.05 × 10⁻⁶. 11 CFU.
[0022] Technical Solution 16: The fermenting agent according to any one of Technical Solutions 13-15, characterized in that the Lactobacillus delbrueckii subsp. lactis is Lactobacillus delbrueckii Dangxiong LB Ⅷ, with accession number CCTCC NO:M 2022316; and / or the Streptococcus salivarius subsp. thermophilus is Streptococcus salivarius Jiacha.ST-685, with accession number CCTCC NO:M 20231495.
[0023] Technical Solution 17: A method for preparing a fermenting agent according to any one of Technical Solutions 13-16, characterized in that it includes the following steps: based on the weight of the fermenting agent, mixing 40-45 wt% of Streptococcus salivarius thermophilus agent, 30-35 wt% of Lactobacillus paracasei agent as described in Technical Solution 7 or 8, and 20-25 wt% of Lactobacillus delbrueckii subsp. lactis agent to obtain the fermenting agent.
[0024] Technical Solution 18: According to the preparation method described in Technical Solution 17, the Lactobacillus delbrueckii subsp. lactis inoculant is prepared by the following steps: Lactobacillus delbrueckii subsp. lactis seed culture is inoculated into a fermentation medium for fermentation to obtain Lactobacillus delbrueckii subsp. lactis fermentation broth; then, the Lactobacillus delbrueckii subsp. lactis fermentation broth is separated into solid and liquid components and dried to obtain the Lactobacillus delbrueckii subsp. lactis inoculant, wherein the viable count of the Lactobacillus delbrueckii subsp. lactis inoculant is 2.5-3.5 × 10⁻⁶. 10 CFU / g, preferably, more preferably, when fermenting *Lactobacillus delbrueckii* subsp. *lactamella*, the fermentation culture method is high-density fermentation culture, wherein, during high-density fermentation culture, a carbon source is added to maintain residual sugar at 10-20 g / L, Na₂CO₃ is added to maintain pH 4.5-5, and the culture is carried out at 37-40°C without aeration for 12-15 h. And / or the *Streptococcus thermophilus* subsp. *sauristatin* inoculum is prepared by the following steps: *Streptococcus thermophilus* seed culture is inoculated into a fermentation medium for fermentation to obtain *Streptococcus thermophilus* fermentation broth; then, the *Streptococcus thermophilus* fermentation broth is separated into solid and liquid components and dried to obtain the *Streptococcus thermophilus* inoculum, wherein the viable count of the *Streptococcus thermophilus* inoculum is 2-3 × 10⁻⁶. 11 CFU / g, preferably, when fermenting Streptococcus thermophilus subsp. saliva, the fermentation culture method is high-density fermentation culture, wherein during high-density fermentation culture, a carbon source is fed to maintain residual sugar at 15-20 g / L, Na2CO3 is used to maintain pH 4.5-5, and the culture is carried out at 40-42℃ without aeration for 12-15 h.
[0025] Technical Solution 19: The use of the starter culture agent described in any one of Technical Solutions 13-16 in the preparation of milk-based fermented milk or plant-based fermented milk.
[0026] Technical Solution 20: A milk-based fermented milk or plant-based fermented milk, characterized in that the milk-based fermentation is prepared by a method comprising the following steps: mixing the starter culture from any one of Technical Solutions 13-16 with animal milk and then fermenting to obtain milk-based fermented milk. Alternatively, the plant-based fermented milk may be prepared by a method comprising the following steps: mixing the fermenting agent as described in any one of technical solutions 13-16 with plant milk and then fermenting to obtain plant-based fermented milk.
[0027] Technical Solution 21: The milk-based fermented milk or plant-based fermented milk according to Technical Solution 20 is characterized in that the animal milk includes cow's milk, and / or the plant milk is prepared by a method comprising the following steps: mixing plants with water, pulping and separating solids and liquids, discarding the precipitate, then adding amylase for enzymatic hydrolysis, sterilization and enzyme inactivation to obtain plant milk, preferably, the enzymatic hydrolysis temperature is 60-70°C and / or the enzymatic hydrolysis time is 30-60 min; preferably, the sterilization temperature is 85-95°C and / or the sterilization time is 10-15 min.
[0028] Technical Solution 22: The milk-based or plant-based fermented milk according to Technical Solution 20 or 21, characterized in that the mixing ratio of the starter culture to the animal milk is 0.03-0.1 g: 1 L. Alternatively, the mixing ratio of the fermenting agent to the plant milk may be 0.03-0.1g:1L.
[0029] Technical Solution 23: A milk-based fermented milk or plant-based fermented milk according to any one of Technical Solutions 20-22, characterized in that the plant includes one or a combination of two of grains and nuts, preferably, the grain includes one or a combination of two of legumes and oats, more preferably, the grain is oats.
[0030] Technical Solution 24: The milk-based fermented milk or plant-based fermented milk according to Technical Solution 21 is characterized in that the amylase is α-amylase, wherein the amount of α-amylase added is 0.05-0.15 wt% based on the weight of the plant milk.
[0031] Technical Solution 25: A method for preparing milk-based fermented milk or plant-based fermented milk according to any one of technical solutions 20-24, characterized in that the method for preparing milk-based fermented milk includes the following steps: mixing the starter culture according to any one of technical solutions 13-16 with animal milk and then fermenting to obtain milk-based fermented milk. Alternatively, the preparation method of the plant-based fermented milk may include the following steps: mixing the fermenting agent as described in any one of technical solutions 13-16 with plant milk and then fermenting to obtain plant-based fermented milk.
[0032] Technical Solution 26: The preparation method according to Technical Solution 25 is characterized in that, when preparing the milk-based fermented milk, fermentation is stopped after the acidity reaches 65-75°T, preferably, the fermentation temperature is 40-45°C. Alternatively, when preparing the plant-based fermented milk, the fermentation temperature is 35-40°C and / or the fermentation time is 8-10 hours. Preferably, fermentation is stopped when the acidity reaches 30-40°T.
[0033] Beneficial effects of this invention: This invention uses Lactobacillus paracasei Shannan.LPA-972 as an effective strain for multi-substrate fermentation. By synergistically combining it with Streptococcus salivarius subsp. thermophilus Jiacha.ST-685 and Lactobacillus delbrueckii subsp. lactis Dangxiong LBⅧ, it breaks through the functional boundaries of traditional strain combinations, achieving broad compatibility between milk-based (animal milk) and plant-based (plant milk) raw materials. At the same time, it significantly improves the nutritional and sensory quality of fermentation products, effectively solving the multi-substrate fermentation problem of milk-based (animal milk) and plant-based (plant milk), and effectively reducing the process cost and complexity of dairy product production. Attached Figure Description
[0034] Figure 1 The results of identifying the utilization ability of Lactobacillus paracasei Shannan.LPA-972 with different substrates after 48 h of culture.
[0035] Microbial strain preservation information The present invention provides Lactobacillus paracasei ( Lactobacillus paracasei Shannan.LPA-972 was deposited at the China Center for Type Culture Collection on September 23, 2024, with accession number CCTCC NO:M 20242026. The deposit address is: Wuhan University, Wuhan, China, 430072, China; telephone: (027)-68754052.
[0036] The *Lactobacillus delbrueckii* subsp. *lactamella* used in the embodiments and comparative examples of this invention (…) Lactobacillus delbrueckii subsp.lactis Dangxiong LB Ⅷ, deposited on March 23, 2023, at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 2023396, address: Wuhan University, Wuhan, China, postcode: 430072; telephone: 02768754052. It is also described in Chinese Patent Publication No. CN116948884A.
[0037] The thermophilic subsp. salivarius used in the embodiments and comparative examples of this invention ( Streptococcus salivarius subsp.thermophilusJiacha.ST-685 strain was deposited at the China Center for Type Culture Collection (CCTCC) on August 17, 2023, with accession number CCTCC NO: M 20231495. The depositary address is: Wuhan University, Wuhan, China, Postcode: 430072; Telephone: (027)-68754052. It has been described in Chinese Patent Publication No. CN118872730A. Detailed Implementation
[0038] The *Lactobacillus paracasei* Shannan.LPA-972 provided by this invention exhibits a broad-spectrum carbon source utilization capability, effectively fermenting various substrates. This diverse metabolic capacity demonstrates that *Lactobacillus paracasei* Shannan.LPA-972 can adapt to various sugar-rich environments, such as dairy products and grain products, thereby surviving and competing in different ecological niches. In industrial applications, this capability helps promote gelation and improve texture, enhancing fermentation efficiency and product quality, for example, by more effectively utilizing the carbon source in raw materials during the fermentation of yogurt, oat milk, and cheese. Furthermore, the various probiotic properties and antibacterial capabilities of *Lactobacillus paracasei* Shannan.LPA-972 can increase the health attributes of products. This strain is compatible with multiple characteristics, suitable for industrial production, and has a high safety profile. This makes it an ideal choice for functionalizing fermented dairy products, achieving clean labeling, and optimizing sensory appeal.
[0039] The *Lactobacillus paracasei* Shannan.LPA-972 provided by this invention, isolated from traditional pickled vegetables from Shannan, Tibet, is a naturally occurring wild-type plateau strain with broad-spectrum carbon source utilization characteristics. It is suitable for non-lactose carbon sources in plant-based raw materials and lactose carbon sources in milk-based raw materials, exhibiting multi-substrate fermentation capabilities. Furthermore, compared to 20 publicly disclosed *Lactobacillus paracasei* strains randomly screened by NCBI, *Lactobacillus paracasei* Shannan.LPA-972 contains 5 unique genes related to the phosphoenolpyruvate:glycotransferase system, corresponding to the transport and metabolism of galactitol, galactose, glucose, and maltose, respectively. Through API identification (API identification is a biochemical reaction-based microbial identification technique that achieves rapid and accurate microbial identification through standardized kits and coding systems), *Lactobacillus paracasei* Shannan.LPA-972 demonstrates the ability to utilize 16 sugars, including galactose, glucose, and maltose, making this strain well-adapted to both animal-based and plant-based milk sources.
[0040] The thermophilic subspecies of Streptococcus salivarius used in this invention, Jiacha.ST-685, has strong lactase activity and acid resistance, which can rapidly decompose lactose in animal milk to produce acid. At the same time, it improves the plant protein gel network by secreting extracellular polysaccharides (EPS) in plant matrix raw materials, thus solving the problem of rough texture in plant-based yogurt.
[0041] The Lactobacillus delbrueckii subsp. Dangxiong LB Ⅷ used in this invention has the ability to enhance protein hydrolysis and the synthesis of flavor substances (such as acetaldehyde and diacetyl).
[0042] Therefore, the starter culture provided by this invention, comprising *Lactobacillus paracasei* Shannan.LPA-972, *Streptococcus salivarius* subsp. *thermophilus* Jiacha.ST-685, and *Lactobacillus delbrueckii* subsp. *Dangxiong* LB Ⅷ, produces milk-based and plant-based fermented products with rich flavor, silky texture, and strong water retention. Furthermore, it reduces the use of flavorings, stabilizers, and other additives, effectively reducing the process costs and complexity in the production of milk-based and plant-based fermented products.
[0043] This invention utilizes a starter culture containing a specific ratio of viable bacteria—*Lactobacillus paracasei*, *Lactobacillus delbrueckii* subsp. *lactotrichum*, and *Streptococcus salivarius* subsp. *thermophilus*—to ferment plant and animal milk. During fermentation of animal milk, in the early stages, *Streptococcus salivarius* subsp. *thermophilus* preferentially utilizes lactose to rapidly produce acid and secrete formic acid, creating an anaerobic environment for *Lactobacillus delbrueckii* subsp. *lactotrichum*. Simultaneously, the purines and pyrimidines produced by its metabolism promote the growth of *Lactobacillus delbrueckii* subsp. *lactotrichum*. In the later stages of fermentation, *Lactobacillus delbrueckii* subsp. *lactotrichum* compensates for the nutritional deficiencies of *Streptococcus salivarius* by degrading casein to release amino acids (such as valine) and further acidifies to pH 4.5, enhancing gel strength. When fermenting plant-based milk, *Streptococcus thermophilus* and *Lactobacillus delbrueckii* have limited access to carbon sources, making them unable to utilize starch, maltose, and other carbon sources in plant-based milk. However, the *Lactobacillus paracasei* provided in this invention possesses fermentation capabilities for galactitol, galactose, glucose, and maltose, enabling it to utilize multiple carbon sources in both plant-based and animal-based milk to produce acid. This allows the *Lactobacillus paracasei* to compensate for the limited carbon sources and poor acid production efficiency of *Streptococcus thermophilus* and *Lactobacillus delbrueckii* in plant-based milk substrates, allowing the starter culture to produce acid and ferment normally in plant-based milk. These three bacteria work together to regulate the fermentation process, synthesizing key flavor compounds (such as acetaldehyde and diacetyl) through metabolic complementarity and synergistically secreting extracellular polysaccharides (EPS), ultimately forming the unique sour and aromatic flavor, delicate texture, and stable gel structure of yogurt. This symbiotic relationship increases fermentation efficiency by 30%–50%, resulting in higher overall acidification rates, cell proliferation, and metabolite yields compared to single-strain fermentation.
[0044] In some specific embodiments, the raw materials used in preparing the culture medium according to the present invention include yeast extract powder. The yeast extract powder mainly exists in the culture medium as an organic nitrogen source, providing the necessary nitrogen element for microbial growth during fermentation. Common organic nitrogen sources such as yeast extract powder, yeast peptone, and yeast extract powder decompose in the culture medium, releasing amino acids and small peptides, which then become nitrogen sources required for microbial growth. That is to say, when using yeast extract powder as a common organic nitrogen source to prepare the culture medium, the present invention does not particularly limit its source; it can be any commercially available source or prepared by conventional methods. As long as the commercially available yeast extract powder has a total nitrogen content (dry weight) greater than or equal to 9.0 wt% and an amino nitrogen content (dry weight) greater than or equal to 3.0 wt%, it can be used in the present invention.
[0045] Preferably, in some specific embodiments, the yeast extract powder, by weight, further comprises: 2-3 ppm of vitamin B1, 40-42 ppm of vitamin B2, 80-82 ppm of vitamin B5, 10-12 ppm of vitamin B6, 5-7 ppm of vitamin B7, 24-27 ppm of vitamin B9, 0.1-0.4 (ug / 100g) of vitamin B12, 3015-3018 ppm of choline, 2015-2018 ppm of inositol, and 315-320.0 ppm of niacin.
[0046] More preferably, based on the weight of the yeast extract, the yeast extract further includes: 20.2-28.3% free amino acids and 51.0-76.0% hydrolyzed amino acids.
[0047] The free amino acid content includes, based on the weight of the yeast extract, 1-1.5% free aspartic acid, 1.5-2.0% free threonine, 1.0-1.5% free serine, 3.5-4.0% free glutamic acid, 0.5-1.0% free glycine, 3.0-3.5% free alanine, 0.1-0.3% free cysteine, 1.5-2.0% free valine, 0.5-1.0% free methionine, 1.0-1.5% free isoleucine, 2.0-2.5% free leucine, 1.0-1.5% free tyrosine, 1.0-1.5% free phenylalanine, 1.0-1.5% free lysine, 0.1-0.5% free histidine, 1.0-1.5% free arginine, and 0.5-1.0% free proline.
[0048] The hydrolyzed amino acid content includes, based on the weight of the yeast extract, 6-7% hydrolyzed aspartic acid, 2-3.5% hydrolyzed threonine, 2-3.5% hydrolyzed serine, 10-15% hydrolyzed glutamic acid, 2-5% hydrolyzed glycine, 5-10% hydrolyzed alanine, 0.1-0.4% hydrolyzed cysteine, 3-5% hydrolyzed valine, 0.4-0.6% hydrolyzed methionine, 3-4% hydrolyzed isoleucine, 4-4.5% hydrolyzed leucine, 1.5-2.5% hydrolyzed tyrosine, 1.5-2.5% hydrolyzed phenylalanine, 4.5-5% hydrolyzed lysine, 1-1.5% hydrolyzed histidine, 3-3.5% hydrolyzed arginine, and 2-2.5% hydrolyzed proline.
[0049] In some specific embodiments, the present invention provides a fermentation agent comprising, by weight, 40-45 wt% of Streptococcus salivarius subsp. thermophilus, 30-35 wt% of Lactobacillus paracasei, and 20-25 wt% of Lactobacillus delbrueckii subsp. lactis.
[0050] Preferably, the number of viable bacteria, including *Streptococcus thermophilus* subsp., in each gram of the fermentation agent is 1.2-1.35 × 10⁻⁶. 11 The viable count of CFU and / or the *Lactobacillus delbrueckii* subsp. *lactamella* is 0.6-0.75 × 10⁻⁶. 10 The viable count of CFU and / or the *Lactobacillus paracasei* is 0.9-1.05 × 10⁻⁶. 11 CFU.
[0051] More preferably, the viable count of *Streptococcus thermophilus* subsp. per gram of the fermenting agent may be 1.20 × 10⁻⁶. 11 CFU, 1.21×10 11 CFU, 1.22×10 11 CFU, 1.23×10 11 CFU, 1.24×10 11 CFU, 1.25×10 11 CFU, 1.26×10 11 CFU, 1.27×10 11 CFU, 1.28×10 11 CFU, 1.29×10 11 CFU, 1.30×10 11 CFU, 1.31×10 11 CFU, 1.32×10 11 CFU, 1.33×10 11 CFU, 1.34×10 11 CFU or 1.35×10 11CFU, or any two of the above endpoints, constitute the number of viable *Streptococcus thermophilus* subsp. per gram of the fermenting agent within the numerical range.
[0052] More preferably, the viable count of *Lactobacillus delbrueckii* subsp. *lactamella* per gram of the starter culture may be 0.60 × 10⁻⁶. 10 CFU, 0.61×10 10 CFU, 0.62×10 10 CFU, 0.63×10 10 CFU, 0.64×10 10 CFU, 0.65×10 10 CFU, 0.66×10 10 CFU, 0.67×10 10 CFU, 0.68×10 10 CFU, 0.69×10 10 CFU, 0.70×10 10 CFU, 0.71×10 10 CFU, 0.72×10 10 CFU, 0.73×10 10 CFU, 0.74×10 10 CFU or 0.75×10 10 CFU, or any two of the above endpoints, constitute the number of viable Lactobacillus delbrueckii subsp. lactis per gram of the fermenting agent within the numerical range.
[0053] More preferably, the viable count of *Lactobacillus paracasei* per gram of the fermenting agent may be 0.90 × 10⁻⁶. 11 CFU, 0.91×10 11 CFU, 0.92×10 11 CFU, 0.93×10 11 CFU, 0.94×10 11 CFU, 0.95×10 11 CFU, 0.96×10 11 CFU, 0.97×10 11 CFU, 0.98×10 11 CFU, 0.99×10 11 CFU, 1.00×10 11 CFU, 1.01×10 11 CFU, 1.02×10 11 CFU, 1.03×10 11 CFU, 1.04×10 11 CFU or 1.05×10 11 CFU, or any two of the above endpoints, constitute the number of viable Lactobacillus paracasei per gram of the fermenting agent within the numerical range.
[0054] Terminology Explanation The plant-based milk described in this invention, also known as plant-based milk or plant milk, refers to a milky liquid made from plant-based raw materials such as beans, nuts, grains, and seeds through processes such as soaking, grinding, pressing, and / or filtering. It is a key fermentation substrate for plant-based fermented foods such as plant yogurt, plant cheese, and fermented plant milk beverages.
[0055] To better understand the above technical solutions, the technical solutions of the present invention will be clearly and completely explained below with reference to specific embodiments. It should be noted that the content of the specific embodiments is merely a specific implementation and explanation of the technical solutions of the present invention and should not be construed as a limitation on the scope of protection of the present invention. Unless otherwise stated, all raw materials / reagents / instruments used in the embodiments of the present invention are conventional commercially available products. The sources of information on the experimental raw materials used in the present invention are shown in Table 1.
[0056]
[0057] The yeast extract powder (model: FM902) used in this application embodiment was sold by Angel Yeast Co., Ltd. The chemical characteristics of this product are as follows: moisture content ≤ 6.0 wt%, total nitrogen content (dry weight) ≥ 9.0 wt%, amino nitrogen content (dry weight) ≥ 3.0 wt%, ash content ≤ 15.0 wt%, and sodium chloride content ≤ 2.0 wt%.
[0058] The trace elements contained in the yeast extract powder (model: FM902) used in the examples are as follows: vitamin B1 2.6 ppm, vitamin B2 41.6 ppm, vitamin B5 81.3 ppm, vitamin B6 11.5 ppm, vitamin B7 5.79 ppm, vitamin B9 25.1 ppm, vitamin B12 0.21 (ug / 100g), choline 3017.0 ppm, inositol 2016.0 ppm, and niacin 318.0 ppm.
[0059] The yeast extract (model: FM902) used in the examples contained 23.3% free amino acids and 59.16% hydrolyzed amino acids.
[0060] The free amino acid content is as follows, based on the weight of the yeast extract: free aspartic acid 1.3%, free threonine 1.7%, free serine 1.0%, free glutamic acid 3.5%, free glycine 0.7%, free alanine 3.2%, free cysteine 0.1%, free valine 1.8%, free methionine 0.5%, free isoleucine 1.3%, free leucine 2.4%, free tyrosine 1.1%, free phenylalanine 1.0%, free lysine 1.3%, free histidine 0.3%, free arginine 1.5%, and free proline 0.6%.
[0061] The hydrolyzed amino acid content is as follows: based on the weight of the yeast extract, hydrolyzed aspartic acid 6.56%, hydrolyzed threonine 2.99%, hydrolyzed serine 2.88%, hydrolyzed glutamic acid 10.75%, hydrolyzed glycine 2.94%, hydrolyzed alanine 5.10%, hydrolyzed cysteine 0.21%, hydrolyzed valine 3.63%, hydrolyzed methionine 0.84%, hydrolyzed isoleucine 3.02%, hydrolyzed leucine 4.32%, hydrolyzed tyrosine 2.10%, hydrolyzed phenylalanine 2.07%, hydrolyzed lysine 4.69%, hydrolyzed histidine 1.30%, hydrolyzed arginine 3.54%, and hydrolyzed proline 2.22%.
[0062] Example 1 1. Screening and identification of strains Strain screening: Pickled vegetables from herders' homes in Shannan City, Tibet Autonomous Region, were mixed with sterile water, and then serially diluted 10-fold to a final volume of 10. -5 10 -6 Bacterial suspensions of different gradients were plated at 200 μL onto MRS plates and incubated at 37°C for 48 hours. By observing colony morphology, single colonies suspected to be *Lactobacillus paracasei* were picked from MRS agar plates and incubated in MRS liquid medium at 37°C for 12 hours to obtain a bacterial suspension. A loopful of this suspension was streaked onto a fresh MRS agar plate and purified at 37°C for 48 hours. This streaking purification was repeated three times. The purified bacterial suspension was then inoculated onto MRS agar plates and incubated statically at 37°C for 48 hours. Colony morphology was then observed. 20 μL of the purified bacterial suspension was transferred to a glass slide and observed under an optical microscope for microscopic morphology.
[0063] The genome of this strain was extracted, and 16S rDNA sequencing and species identification were performed using a high-fidelity enzyme. The primer information used is shown in Table 2, and the PCR amplification reaction system and amplification program are shown in Table 3.
[0064]
[0065]
[0066] The 16S rDNA sequence of this strain, SEQ ID No. 3, is shown below. The 16S rDNA sequence of this strain was compared using NCBI-BLAST, identifying the strain as *Lactobacillus paracasei*. Lactobacillus paracasei The strain, named *Lactobacillus paracasei* Shannan.LPA-972 (abbreviated as LPA-972), was deposited on September 23, 2024, at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC NO: M 20242026. The deposit address is: Wuhan University, Wuhan, China, postcode: 430072; telephone: (027)-68754052.
[0067] SEQ ID No. 3: 2. Whole genome sequencing analysis of Lactobacillus paracasei Shannan.LPA-972 Whole-genome sequencing and comparative genomics analysis of *Lactobacillus paracasei* Shannan.LPA-972 (LPA-972 for short) revealed that, compared to 20 *Lactobacillus paracasei* strains randomly selected by NCBI, strain Shannan.LPA-972 possesses 35 unique genes, 14.3% of which are related to carbohydrate metabolism. Among these, five unique genes are associated with the phosphoenolpyruvate-glycotransferase (PTS) system (a bacterial-specific sugar transport system; the presence of these genes indicates that *Lactobacillus paracasei* can utilize multiple sugars and has multi-substrate fermentation capabilities), corresponding to transport and metabolism. The gene sequences for galactitol, galactose, glucose, and maltose are shown below: OMHPBIPD_02796 (galactitol-specific EIIB component of the PTS system, SEQ ID NO:4), OMHPBIPD_02794 (galactitol-specific EIIC component of the PTS system, SEQ ID NO:5), OMHPBIPD_02795 (galactose-specific EIIC component of the PTS system, SEQ ID NO:6), OMHPBIPD_00372 (glucose-specific EIIA component of the PTS system, SEQ ID NO:7), and OMHPBIPD_00368 (maltose-specific EIICB component of the PTS system, SEQ ID NO:8). These unique genes enable this strain to perform multi-substrate fermentation, allowing fermentation in both animal and plant milk. The PTS system comprises two cytoplasmic phosphotransferases [enzyme I (EI) and histidine phosphocarrier protein (HPr)] and a species-dependent number of sugar-specific enzyme II complexes (EIIA, EIIB, EIIC, EIID). Each sugar-specific enzyme II complex consists of one or two hydrophobic monolayer membrane domains (domains C and D) and two hydrophilic domains (domains A and B). Domain A (EIIA) receives phosphate groups from the general HPr protein and specifically transfers them to the corresponding domain B (EIIB) component. Domains C and D (EIIC and EIID) are transmembrane channels for carbohydrate transport. Membrane domain B (EIIB) is responsible for carbohydrate phosphorylation.
[0068] SEQ ID NO:4: ATGAAACGAAAGAGAATCTATGTTTGTTGCGGTTCTGGAATTGCAACATCGACGGTAATTGCAAAGAAAGTGAAAGATGCGTTGGACAAAGAAGGTATTCCGTATATTGTTGATCAATTTACGGTTCAACAGATTAGTTCAAAGGTAGCTATGCTAAAACCCGATTTAATTGTCAGCTCTGCCCAAATTACCACAGACGTTCAAGGTGTACCTGTTGTGATGGCTCGTTCCTTCCTTACTGGTATCAATAAGCAGGATACAATCGATGAAATTCTTTATGTTTTAAAGGGAGCACAACTTAGTTAG SEQ ID NO:5: ATGGGACTATTTATTGGTGGTGGATTAGCTGCAGTGGCGCGAATGCCAGTTGCAACTGTTTTACAAACAGCAGTTAAGATTGCGGCCAGTCTTGTACTCATTCCTAAAATGGTCGCATTACTAATGGACGGCTTAACGCTGATATCTGAGTCTGCGCAAGAATGGATGCAGAAACGATTCCCGGGTCGACAATTGTATATTGGACTTGATTCGGCTCTTGGAATAGGACATCCATATGTCCTTACAACTGGATTGTTGATGATTCCATTTGCGCTAGTTTTAGCATTCATTTTGCCAGGTAATAAAGTACTACCGCTTGCTGATTTAACAGCACTACCGTATTTTATGATTTTTGCTATCTTACCATCAAAAGGCAATTTGTTTCGCGGTTTGATATCAGGCATTCTGTTCACAATTATTATTTTATATTGTGCAAGTTATGCTGCACCAATCGTGACGCAACTTGCTGTGCAAGTGGGGTATCATTTGCCAAAAGGTTCCACTCAGGTTACCTCGCTGGCAGTTGGTGCTCAGTGGTATACATGGATTATTTACTGGATATTAGGGAAATTTGCGGCGTTGTTTTGA SEQ ID NO:6: ATGCACATTATTTTGGATTTTTTCCAGTACATCATCAACCTTGGTGTCAGTGTTATGATGCCAATTATTATTACAGTTCTTGGGCTGATTTTTGGAAATAAACTTTCTTCATCGTTTAAGTCTGGACTGACAGTTGGTTTAGGTTTTGTTGGCTTAAA TGCCATTACGGCACTCATGATTGATGCTATCTCGCCAGTAACTCGCGCTCTGGTCAAACAGTATAATTTTCAATTGACAGCGACTGATATGGGGTGGGGTGTTGGAGCATCATTGGCTTGGGGAACAGAAGTTGTGCCGTTTGTTTTCCTAACGATTA TTGCGACAAACGTTATCATGATTCTATTTAATTGGACGAAAACAATGGACGTTGATATTTGGAACTTTTGGGAACCGATGGCAATTGCAAGTGCACTTTATTTAACGACTAGAAATCTTTTTTATTGCGCTATTAAGTGCTGTGATCAATATGGCTATTATCTTCAAAATTGCCGACTGGACACAAAAGGATGTTGACGAAGTTCTTGGCCTTGAGGGGATTTCTTTTCCGCATTTACAAAGTACTGGCTGGGCGCTAATCGGTTATCCGCTTAACTGGATCTTAGATCGAATTCCAGGAATCAAAAATATTTCGTGA SEQ ID NO:7: ATGTTTGGACTATTTAAAGCTAAGAAAAAAACAGGACAGCCGATTATTGCCCCTGTCACGGGCATCCTTATGCCACTCGATGATGTGACGGATGACGTTTTTTCACAAAAGATGATGGGAGACGGCTTTGCGATTCAACCAGAAGAATCGCAAATTGTTTCTCCGGTTTCTGGTACTGTGTCAACGGTTTTCCCTACGAAACATGCGATTGGTATCACGACTCCAGAAGGTTTAGACGTGCTCGTTCACATGGGCTTAGATACGGTCGAATTAGACGGGAAACCTTTTAAAGTTGATGTTGCTCTAAATGATGTTGTGACGGCGGGTCAACCACTTGCTACCATTGATCGTGAACAGATCAAAAAAAGTGGTTATGACGATACGATTGTCGTCATCTATACAAATATGGAAAAATTAAAGAACTTTCCAACAGTTGTTTCAAGTCAAATTACGCAGGGCCAACAAATTGGTGAACTGATATACGTTTAA SEQ ID NO:8: Example 2: Identification and analysis of API 50 CHL lactobacillus of Lactobacillus paracasei Shannan.LPA-972 (1) After activating Lactobacillus paracasei Shannan.LPA-972 in MRS liquid medium at 37℃, it was streaked onto MRS solid medium plates and incubated at 37℃ for 48h. Single colonies were picked and the utilization ability of Lactobacillus paracasei Shannan.LPA-972 for 49 substrates was tested using the API 50 CHL Lactobacillus identification kit. The bacteria produced acidic products, causing the indicator phenol red to change from purple to yellow; for some substrates, the indicator phenol red changed from purple to brown or black after acidification. The results are as follows. Figure 1 As shown in Table 4.
[0069]
[0070]
[0071] Note: In the table, "-" indicates no color change, no reaction, and the substrate cannot be used; "+" indicates a decrease in pH, a color change in the indicator, and the substrate can be used.
[0072] like Figure 1 As shown, Figure 1 The results of identifying the utilization ability of *Lactobacillus paracasei* Shannan.LPA-972, after 48 hours of culture, for different substrates were presented. Figure 1 The first row in the middle, from left to right, shows the substrates identified as follows: negative control, glycerol, jujubitol, D-arabinose, L-arabinose, D-ribose, D-xylose, L-xylose, D-ribitol, and methyl-β-D-xylanoside. Figure 1 The second row in the middle, from left to right, shows the substrates identified as D-galactose, D-glucose, D-fructose, D-mannose, L-sorbose, L-rhamnose, eugenol, inositol, mannitol, and sorbitol. Figure 1 The third row in the middle, from left to right, shows the substrates identified as follows: methyl-α-D-mannopyranoside, methyl-α-D-glucopyranoside, N-acetylglucosamine, amygdalin, arbutin, ferric citrate of aesculin, salicin, D-cellobiose, D-maltose, and D-lactose. Figure 1 The fourth row in the middle, from left to right, shows the substrates identified as D-micobiose, D-sucrose, D-trehalose, inulin, D-minotriose, D-raffinose, starch, glycogen, xylitol, and D-gentibiose. Figure 1 The fifth row in the middle, from left to right, shows the substrates identified as D-thulonose, D-lysose, D-tagatose, D-fucose, L-fucose, D-arabinol, L-arabinol, potassium gluconate, potassium 2-ketogluconate, and potassium 5-ketogluconate.
[0073] The results showed that *Lactobacillus paracasei* Shannan.LPA-972 can utilize the following substrates: D-ribose, D-ribitol, D-galactose, D-glucose, D-fructose, D-mannose, eugenol, mannitol, sorbitol, methyl-α-D-glucopyranoside, N-acetylglucosamine, ferric citrate of esculin, salicin, D-cellobiose, D-maltose, D-lactose, D-sucrose, D-trehalose, inulin, and D-minotriose. The available substrate species, including D-gentiobiose, D-thulene, D-tagatose, and potassium gluconate, account for 62.5% of the carbon source. These available carbon sources include D-lactose, a common carbon source in animal milk raw materials, and D-fructose and D-maltose, a common carbon source in plant milk raw materials. Therefore, Lactobacillus paracasei Shannan.LPA-972 has multi-substrate fermentation capabilities, especially in fermentation in animal milk raw materials.
[0074] Example 3: Preparation of a multifunctional dairy starter (1) *Streptococcus salivarius* subsp. *Jiacha.ST-685, *Lactobacillus paracasei* Shannan.LPA-972, and *Lactobacillus delbrueckii* subsp. *Dangxiong* LB Ⅷ were inoculated into MRS liquid medium at an inoculum of 2% to obtain primary seed culture of *Streptococcus salivarius* subsp. *Jiacha.ST-685 (viable count of 3 × 10⁻⁶). 9 CFU / mL), primary seed culture of Lactobacillus paracasei Shannan.LPA-972 (viable count 3×10⁻⁶ CFU / mL), 9 CFU / mL) and primary seed culture of Lactobacillus delbrueckii subsp. Dangxiong LB Ⅷ (viable count 3 × 10⁻⁶ CFU / mL) 9 (CFU / mL) (2) The primary seed culture of Streptococcus thermophilus Jiacha.ST-685, Lactobacillus paracasei Shannan.LPA-972, and Lactobacillus delbrueckii subsp. lactis Dangxiong LB Ⅷ obtained in step (1) were inoculated into MRS liquid medium at 2% to obtain secondary seed culture of Streptococcus salivarius subsp. thermophilus Jiacha.ST-685 (with a viable count of 3×10⁻⁶). 9 CFU / mL), secondary seed culture of Lactobacillus paracasei Shannan.LPA-972 (viable count 3×10⁻⁶ CFU / mL), 9 CFU / mL) and secondary seed culture of Lactobacillus delbrueckii subsp. Dangxiong LB Ⅷ (viable count 3×10⁻⁶ CFU / mL) 9 (CFU / mL) (3) The secondary seed cultures of *Streptococcus salivarius* subsp. *Jiacha.ST-685, *Lactobacillus paracasei* Shannan.LPA-972, and *Lactobacillus delbrueckii* subsp. *Dangxiong* LB Ⅷ obtained in step (2) were inoculated into the fermentation medium at a 5% inoculation rate for high-density fermentation to obtain the fermentation broth of *Streptococcus salivarius* subsp. *Jiacha.ST-685 (viable count of 5 × 10⁻⁶). 10 CFU / mL), fermentation broth of Lactobacillus paracasei Shannan.LPA-972 (5×10⁻⁶ CFU / mL), 10 CFU / mL) and fermentation broth of Lactobacillus delbrueckii subsp. Dangxiong LB Ⅷ (viable count 5 × 10⁻⁶ CFU / mL) and Lactobacillus delbrueckii subsp. Dangxiong LB Ⅷ (viable count 5 × 10⁻⁶ CFU / mL). 9 (CFU / mL) The fermentation medium, by weight, includes: 2 wt% glucose, 2 wt% yeast extract FM902, 0.45 wt% anhydrous sodium acetate, 0.1 wt% diammonium hydrogen phosphate, 0.010 wt% magnesium sulfate heptahydrate, 0.010 wt% manganese sulfate, 0.10 wt% Tween 80, and the remainder is water. After adjusting the pH to 6.5 ± 0.2, it is autoclaved at 115℃ for 20 min. Among them, when the thermophilic subspecies of Streptococcus salivarius Jiacha.ST-685 was cultured in high-density fermentation, a carbon source was added to maintain residual sugar at 15-20 g / L and Na2CO3 to maintain pH 4.5-5, and the culture was carried out at 42℃ without aeration for 12 h.
[0075] When conducting high-density fermentation culture of *Lactobacillus paracasei* Shannan.LPA-972 and *Lactobacillus delbrueckii* subsp. *Dangxiong* LB Ⅷ, a fed carbon source was used to maintain residual sugar at 10-20 g / L, and Na2CO3 was used to maintain pH 4.5-5. The culture was carried out at 40°C without aeration for 12 h.
[0076] (4) The fermentation broths of *Streptococcus thermophilus* subsp. Jiacha.ST-685, *Lactobacillus paracasei* Shannan.LPA-972, and *Lactobacillus delbrueckii* subsp. Dangxiong LB Ⅷ obtained in step (3) were centrifuged at 8000 r / min for 30 min to collect *Streptococcus thermophilus* subsp. Jiacha.ST-685 bacterial sludge, *Lactobacillus paracasei* Shannan.LPA-972 bacterial sludge, and *Lactobacillus delbrueckii* subsp. Dangxiong LB Ⅷ bacterial sludge. Then, freeze-drying agents were added to the three bacterial sludges and vacuum freeze-drying was performed. The vacuum freeze-drying parameters were: pre-freezing at -40℃ for 3 h, then vacuuming to 25 Pa, and freeze-drying at -20℃ for 48 h to obtain *Streptococcus thermophilus* subsp. Jiacha.ST-685 bacterial powder (viable count of 3 × 10⁻⁶). 11 CFU / g), Lactobacillus paracasei Shannan.LPA-972 bacterial powder (viable count 3×10⁻⁶ CFU / g), 11 CFU / g), Lactobacillus delbrueckii subsp. lactis Dangxiong LB Ⅷ probiotic powder (live count 3×10⁻⁶) 10 (CFU / g), wherein the freeze-drying protectant is 20g skim milk, 6g mannitol, 5g trehalose, 1g sodium glutamate and 1g glycerol.
[0077] (5) Based on the weight of the multifunctional dairy starter, 45% of the thermophilic Streptococcus Jiacha.ST-685 bacterial powder, 30% of the Lactobacillus paracasei Shannan.LPA-972 bacterial powder, and 25% of the Lactobacillus delbrueckii subsp. lactis Dangxiong LB Ⅷ bacterial powder were mixed to obtain the multifunctional dairy starter, wherein each g of the multifunctional dairy starter contained 1.35 × 10⁻⁶ viable Streptococcus Jiacha.ST-685 bacteria. 11 The viable count of CFU-containing *Lactobacillus paracasei* Shannan.LPA-972 was 0.9 × 10⁻⁶. 11 The viable count of CFU of *Lactobacillus delbrueckii* subsp. *Dangxiong* LB Ⅷ was 0.75 × 10⁻⁶. 10 CFU.
[0078] Example 4: Preparation of a multifunctional dairy starter The difference from Example 3 is that in step (5), based on the weight of the multifunctional dairy starter, 40% of the thermophilic Streptococcus Jiacha.ST-685 bacterial powder, 35% of Lactobacillus paracasei Shannan.LPA-972 bacterial powder, and 25% of Lactobacillus delbrueckii subsp. lactis Dangxiong LB Ⅷ bacterial powder obtained in step (4) are mixed to obtain the multifunctional dairy starter, wherein each g of the multifunctional dairy starter contains 1.2 × 10⁻⁶ viable Streptococcus Jiacha.ST-685 bacteria. 11 The viable count of CFU of *Lactobacillus paracasei* Shannan.LPA-972 was 1.05 × 10⁻⁶. 11 The viable count of CFU of *Lactobacillus delbrueckii* subsp. *Dangxiong* LB Ⅷ was 0.75 × 10⁻⁶. 10 CFU.
[0079] Example 5: Preparation of a multifunctional dairy starter The difference from Example 3 is that in step (5), based on the weight of the multifunctional dairy starter, 45% of the thermophilic Streptococcus Jiacha.ST-685 bacterial powder, 35% of Lactobacillus paracasei Shannan.LPA-972 bacterial powder, and 20% of Lactobacillus delbrueckii subsp. lactis Dangxiong LB Ⅷ bacterial powder obtained in step (4) are mixed to obtain the multifunctional dairy starter, wherein each g of the multifunctional dairy starter contains 1.35 × 10⁻⁶ viable Streptococcus Jiacha.ST-685 bacteria. 11 The viable count of CFU of *Lactobacillus paracasei* Shannan.LPA-972 was 1.05 × 10⁻⁶. 11 The viable count of CFU (Cellular Fumin) of *Lactobacillus delbrueckii* subsp. *Dangxiong* LB Ⅷ was 0.6 × 10⁻⁶. 10 CFU.
[0080] Comparative Example 1: Preparation of a multifunctional dairy starter The difference from Example 3 is that in step (5), based on the weight of the multifunctional dairy starter, 50% of the thermophilic Streptococcus Jiacha.ST-685 bacterial powder, 10% of Lactobacillus paracasei Shannan.LPA-972 bacterial powder, and 40% of Lactobacillus delbrueckii subsp. lactis Dangxiong LB Ⅷ bacterial powder obtained in step (4) are mixed to obtain the multifunctional dairy starter, wherein each g of the multifunctional dairy starter contains 1.5 × 10⁻⁶ viable Streptococcus Jiacha.ST-685 bacteria. 11 The viable count of CFU-containing *Lactobacillus paracasei* Shannan.LPA-972 was 0.3 × 10⁻⁶. 11 The viable count of CFU of *Lactobacillus delbrueckii* subsp. *Dangxiong* LB Ⅷ was 1.2 × 10⁻⁶.10 CFU.
[0081] Comparative Example 2: Preparation of a multifunctional dairy starter The difference from Example 3 is that in step (5), based on the weight of the multifunctional dairy starter, 25% of the thermophilic Streptococcus Jiacha.ST-685 bacterial powder, 35% of Lactobacillus paracasei Shannan.LPA-972 bacterial powder, and 40% of Lactobacillus delbrueckii subsp. lactis Dangxiong LB Ⅷ bacterial powder obtained in step (4) are mixed to obtain the multifunctional dairy starter, wherein each g of the multifunctional dairy starter contains 0.75 × 10⁻⁶ viable Streptococcus Jiacha.ST-685 bacteria. 11 The viable count of CFU of *Lactobacillus paracasei* Shannan.LPA-972 was 1.05 × 10⁻⁶. 11 The viable count of CFU of *Lactobacillus delbrueckii* subsp. *Dangxiong* LB Ⅷ was 1.2 × 10⁻⁶. 10 CFU.
[0082] Comparative Example 3: Preparation of a multifunctional dairy starter The difference from Example 3 is that in step (5), based on the weight of the multifunctional dairy starter, 45% of the thermophilic Streptococcus Jiacha.ST-685 bacterial powder, 40% of the Lactobacillus paracasei Shannan.LPA-972 bacterial powder, and 15% of the Lactobacillus delbrueckii subsp. lactis Dangxiong LB Ⅷ bacterial powder obtained in step (4) are mixed to obtain the multifunctional dairy starter, wherein each g of the multifunctional dairy starter contains 1.35 × 10⁻⁶ viable Streptococcus Jiacha.ST-685 bacteria. 11 The viable count of CFU of *Lactobacillus paracasei* Shannan.LPA-972 was 1.2 × 10⁻⁶. 11 The viable count of CFU of *Lactobacillus delbrueckii* subsp. *Dangxiong* LB Ⅷ was 0.45 × 10⁻⁶. 10 CFU.
[0083] The preparation methods for fermented milk and fermented oat milk used in the technical effect evaluations 1-4 below are shown below: 1. The preparation method of fermented milk is as follows: (1) After heating the raw milk to 60°C, it was homogenized under low pressure of 5mPa and high pressure of 20mPa to obtain homogenized raw milk. (2) After homogenization, the raw milk was pasteurized at 90°C for 12 minutes and then cooled to 43°C at room temperature. (3) Add 0.1g of the multifunctional dairy starter from Examples 3-5 and Comparative Examples 1-3 to each L of cooled milk, and then ferment at 42°C until the acidity reaches 70°T before stopping fermentation. Then refrigerate overnight at 4°C to obtain fermented milk.
[0084] 2. The preparation method of fermented oat milk is as follows: (1) Pre-treat the oats by quickly rinsing to remove surface starch, soaking the oats in cold water for 20 minutes and then draining them. Next, mix the drained oats with distilled water at a ratio of 1g:12mL and place the mixture in a high-speed blender. Blend at 36,000 rpm for 1 minute to obtain the mixture. Then, filter the mixture through fine gauze to remove the oat residue and obtain oat milk. (2) After heating the oat milk obtained in step (1) to 65°C, add 0.1wt% α-amylase based on the weight of the oat milk, keep warm and stir for 45 minutes until the starch in the oat milk is completely liquefied, then heat to 95°C and keep for 10 minutes to inactivate the enzyme, and then cool to 42°C. (3) Add 0.1g of the multifunctional dairy starter from Examples 3-5 and Comparative Examples 1-3 to each L of cooled oat milk, then incubate in a constant temperature incubator at 37°C for 9h (at which point fermentation reaches an acidity of 40°T) and stop fermentation. Refrigerate overnight at 4°C to obtain fermented oat milk.
[0085] Technical Effect Evaluation 1: Determination of the content of each carbon source in the system before and after fermentation Fermented cow's milk and fermented oat milk were prepared using the multifunctional dairy starter from Examples 3-5 and Comparative Examples 1-3. The changes in lactose content in fermented cow's milk before and after fermentation are shown in Table 5 below, and the changes in maltose and glucose content in fermented oat milk before and after fermentation are shown in Table 6 below. The lactose content was detected by method 1 (high performance liquid chromatography) according to GB5009.8-2023. The maltose and glucose contents were also detected by method 1 (high performance liquid chromatography) according to GB5009.8-2023.
[0086]
[0087] As shown in Table 5, the multifunctional dairy starter cultures of Examples 3-5 reduced the lactose content in fermented milk by 1.45-1.85% compared to before fermentation. Specifically, compared to before fermentation, Example 3 saw a reduction of 1.45%, Example 4 a reduction of 1.53%, and Example 5 a reduction of 1.85%, while Comparative Examples 1-3 saw reductions of only 1.19%, 1.1%, and 1.25%, respectively. The results indicate that the multifunctional dairy starter cultures of Examples 3-5 have a higher carbon source utilization rate in milk compared to Comparative Examples 1-3.
[0088]
[0089] As shown in Table 6, when fermenting oat milk using the multifunctional dairy starter from Examples 3-5, the maltose content decreased by 1.7-1.79% and the glucose content decreased by 0.69-0.81% compared to before fermentation. Specifically, compared to before fermentation, the maltose content decreased by 1.7% in Example 3, 1.74% in Example 4, and 1.79% in Example 5, while the maltose content of Comparative Examples 1-3 decreased by only 1.14%, 1.16%, and 1.26%, respectively. Compared to before fermentation, the glucose content decreased by 0.69% in Example 3, 0.73% in Example 4, and 0.81% in Example 5, while the glucose content of Comparative Examples 1-3 decreased by only 0.47%, 0.48%, and 0.55%, respectively. The results indicate that, compared to Comparative Examples 1-3, the multifunctional dairy starter from Examples 3-5 has a higher utilization rate of carbon sources (maltose and glucose) in oat milk.
[0090] Technical Effect Evaluation 2: Determination of Fermentation Rate and Post-Shelf-Life Acidification The fermentation rate and post-shelf-life acidification of fermented cow's milk and fermented oat milk prepared using the multifunctional dairy starter cultures of Examples 3-5 and Comparative Examples 1-3 were tested. Fermentation rate refers to the time taken for the yogurt base to reach an acidity of 70°T after inoculation with lactic acid bacteria and fermentation at 42°C. Post-shelf-life acidification refers to the continued metabolism of lactose and acid production by the starter cultures during cooling and post-fermentation stages after fermentation has ceased in yogurt production. The method for detecting acidification after shelf life is as follows: the fermented milk or the fermented oat milk is placed in a constant temperature chamber at 4°C, and the acidity changes of the fermented milk or the fermented oat milk are recorded on days 0, 7, 14, and 21.
[0091] The acidity was determined according to the method in the national standard GB5009.239-2016. Specifically, the fermented milk or fermented oat milk was removed from the constant temperature incubator, stirred evenly, and 10g (accurate to 0.001g) of the fermented milk or fermented oat milk sample was weighed into a 150ml conical flask. 20ml of freshly boiled and cooled distilled water was added; the mixture was stirred evenly, and the pH was titrated to 8.3 with 0.1mol / L sodium hydroxide standard solution. The volume of sodium hydroxide standard titration solution consumed (V) was recorded. A blank experiment was performed with the corresponding volume of distilled water, and the volume of sodium hydroxide standard solution consumed (V0) was recorded. The acidity of the fermented dairy product was calculated according to the following formula 1. The result was expressed as the arithmetic mean of two independent determinations obtained under repeatability conditions, and the result was retained to three significant figures.
[0092]
[0093] In the formula, X—acidity of the sample, in °T; The molar concentration of C-sodium hydroxide standard solution is expressed in moles per liter (mol / L). V — The volume of sodium hydroxide standard solution consumed during titration, in milliliters (mL). V0—The volume of sodium hydroxide standard solution consumed in the blank experiment, in milliliters (mL). 100-100g sample; M—Mass of the sample, in grams (g); 0.1 — The acidity theory defines the molar concentration of sodium hydroxide, expressed in moles per liter (mol / L).
[0094] The fermentation rate and post-shelf-life acidification results of the fermented milk prepared using the multifunctional dairy starter cultures of Examples 3-5 and Comparative Examples 1-3 are shown in Tables 7 and 8 below:
[0095] As shown in Table 7, the multifunctional dairy starter of Examples 3-5 fermented milk at a rate of 5.0-5.5 hours, which is faster than that of Comparative Examples 1-3.
[0096]
[0097] As shown in Table 8, when fermenting milk using the multifunctional dairy starter from Examples 3-5, the acidity of the fermented milk increased by only 26-30°T within a 21-day shelf life. Specifically, the acidity of the milk after fermentation in Example 3 increased by only 30°T, in Example 4 by only 28°T, and in Example 5 by only 26°T. However, the acidity of the milk after fermentation in Comparative Example 1 increased by as much as 53°T, in Comparative Example 2 by as much as 42°T, and in Comparative Example 3 by as much as 49°T. The results indicate that, compared to Comparative Examples 1-3, the fermented milk obtained using the multifunctional dairy starter from Examples 3-5 exhibits slower acidification after its shelf life and demonstrates better stability.
[0098] The fermentation rate and post-shelf-life acidification results of the fermented oat milk prepared using the multifunctional dairy starter cultures of Examples 3-5 and Comparative Examples 1-3 are shown in Tables 9 and 10 below:
[0099] As shown in Table 9, the multifunctional dairy starter of Examples 3-5 fermented oat milk at a rate of 6.2-7.5 h, which is faster than that of Comparative Examples 1-3.
[0100]
[0101] As shown in Table 10, when fermenting oat milk using the multifunctional dairy starter from Examples 3-5, the acidity of the fermented oat milk increased by only 32-40°T within a 21-day shelf life. Specifically, the acidity of the oat milk after fermentation in Example 3 increased by only 40°T, in Example 4 by only 36°T, and in Example 5 by only 32°T. However, the acidity of the oat milk after fermentation in Comparative Example 1 increased by as much as 58°T, in Comparative Example 2 by as much as 52°T, and in Comparative Example 3 by as much as 55°T. The results indicate that, compared to Comparative Examples 1-3, the fermented oat milk obtained using the multifunctional dairy starter from Examples 3-5 exhibits slower acidification after its shelf life and demonstrates better stability.
[0102] In summary, the results show that, compared to Comparative Examples 1-3, the fermented milk and fermented oat milk prepared using the multifunctional dairy starter from Examples 3-5 fermented relatively quickly, completing fermentation within 5.5 hours and 7 hours, respectively. Furthermore, compared to Comparative Examples 1-3, the fermented milk and fermented oat milk prepared using the multifunctional dairy starter from Examples 3-5 exhibited relatively low post-acidification during their shelf life.
[0103] Technical Effect Evaluation 3: Shelf Life Stability Test The shelf-life stability of fermented milk and fermented oat milk products prepared using the multifunctional dairy starter cultures of Examples 3-5 and Comparative Examples 1-3 was tested. The specific testing method for shelf-life stability was as follows: Fermented milk and fermented oat milk prepared using the multifunctional dairy starter cultures of Examples 3-5 and Comparative Examples 1-3 were placed in an environment of 25°C. 50g of each sample was weighed into a 50mL centrifuge tube and centrifuged at 3500rpm for 10min. The supernatant (whey separation) was retained, and the whey separation rate was calculated according to Formula 2. This was repeated three times, and the average value was taken. The whey separation rate scoring criteria are shown in Table 11, and the whey separation rate scoring results are shown in Table 12.
[0104] In the formula, m1 represents the mass of the separated whey, expressed in grams (g). m — the mass of the sample taken, in grams (g);
[0105]
[0106] As shown in Table 12, the results show that, compared with Comparative Examples 1-3, the fermented cow's milk and fermented oat milk prepared using the multifunctional dairy starter from Examples 3-5 have stable texture, low whey content after accelerated centrifugation, whey separation rate ≤3%, and good texture during shelf life.
[0107] Technical Effect Evaluation 4: Comprehensive Application Performance Evaluation (1) Fifteen dairy professionals who had participated in sensory training were randomly selected as sensory evaluators to evaluate the comprehensive application performance of fermented milk. The sensory evaluation criteria are shown in Table 13, and the results are shown in Table 14.
[0108]
[0109]
[0110] As shown in Table 14, the results indicate that the fermented milk prepared using the multifunctional dairy starter from Examples 3-5 scored 7-8 points in appearance, 7-9 points in fermented aroma, 8-9 points in smoothness, 7-8 points in flavor harmony, and 7-9 points in taste. This suggests that, compared to Comparative Examples 1-3, the fermented milk prepared using the multifunctional dairy starter from Examples 3-5 exhibits better overall performance in terms of appearance, fermented aroma, smoothness, flavor harmony, and taste.
[0111] (2) Fifteen dairy professionals who had participated in sensory training were randomly selected as sensory evaluators to evaluate the comprehensive application performance of fermented oat milk. The sensory evaluation criteria are shown in Table 15, and the results are shown in Table 16.
[0112]
[0113]
[0114] As shown in Table 16, the results indicate that the oat milk prepared using the multifunctional dairy starter from Examples 3-5 scored 7-9 points in appearance, 7-8 points in fermented aroma, 7-8 points in smoothness, 8-9 points in flavor harmony, and 7-9 points in taste. This suggests that, compared to Comparative Examples 1-3, the fermented oat milk prepared using the multifunctional dairy starter from Examples 3-5 exhibits better overall performance in terms of appearance, fermented aroma, smoothness, flavor harmony, and taste.
[0115] The above embodiments are only for further explanation and understanding of the technical solution of the present invention, and are not intended to limit the present invention. Any improvements made by those skilled in the art on this basis that do not highlight substantive features or make significant progress should fall within the protection scope of the present invention.
Claims
1. A type of *Lactobacillus paracasei*, characterized in that, The *Lactobacillus paracasei* is: *Lactobacillus paracasei* (… Lactobacillus paracasei Shannan.LPA-972, accession number CCTCC NO: M 20242026.
2. The *Lactobacillus paracasei* according to claim 1, characterized in that, The 16S rDNA sequence of the *Lactobacillus paracasei* is shown in SEQ ID NO:
3.
3. The *Lactobacillus paracasei* according to claim 1, characterized in that, The *Lactobacillus paracasei* carries genes related to the phosphoenolpyruvate-glycotransferase system.
4. The *Lactobacillus paracasei* according to claim 3, characterized in that, The phosphoenolpyruvate-glucose transferase system-related genes include one or more genes selected from the group consisting of galactitol-specific EIIB component genes, galactitol-specific EIIC component genes, galactose-specific EIIC component genes, glucose-specific EIIA component genes, and maltose-specific EIICB component genes.
5. The *Lactobacillus paracasei* according to claim 4, characterized in that, The galactitol-specific EIIB component gene contains the gene sequence shown in SEQ ID NO:4, and / or the gene sequence shown in SEQ ID NO:5, and / or the gene sequence shown in SEQ ID NO:6, and / or the gene sequence shown in SEQ ID NO:7, and the gene sequence shown in SEQ ID NO:8, of the galactitol-specific EIIIC component gene.
6. The *Lactobacillus paracasei* according to claim 1, characterized in that, It has substrate utilization capability, wherein the substrate includes one or more substances selected from the group consisting of D-ribose, D-ribitol, D-galactose, D-glucose, D-fructose, D-mannose, eugenol, mannitol, sorbitol, methyl-α-D-glucopyranoside, N-acetylglucosamine, ferric citrate of aesculin, salicin, D-cellobiose, D-maltose, D-lactose, D-sucrose, D-trehalose, inulin, D-melatoninose, D-gentiobiose, D-thulene, D-tagatose, and potassium gluconate.
7. The use of *Lactobacillus paracasei* according to any one of claims 1-6 in the preparation of *Lactobacillus paracasei* inoculum, starter culture, milk-based fermented milk, or plant-based fermented milk.
8. A Lactobacillus paracasei inoculum, characterized in that, Contains *Lactobacillus paracasei* as described in any one of claims 1-6.
9. The *Lactobacillus paracasei* inoculum agent according to claim 8, characterized in that, The viable count of *Lactobacillus paracasei* in the *Lactobacillus paracasei* inoculum is 2-3 × 10⁻⁶. 11 CFU / g.
10. A method for preparing the *Lactobacillus paracasei* inoculum according to claim 8 or 9, characterized in that, The process includes the following steps: inoculating the Lactobacillus paracasei seed culture into a fermentation medium for fermentation to obtain Lactobacillus paracasei fermentation broth; then separating the solid and liquid components of the Lactobacillus paracasei fermentation broth and drying it to obtain Lactobacillus paracasei inoculum.
11. A fermenting agent, characterized in that, The fermenting agent comprises, by weight, 40-45 wt% of *Streptococcus thermophilus* subsp. *salicylic acid*, 30-35 wt% of *Lactobacillus paracasei* as described in claim 8 or 9, and 20-25 wt% of *Lactobacillus delbrueckii* subsp. *lactospirae*.
12. The fermenting agent according to claim 11, characterized in that, The viable count of the *Lactobacillus delbrueckii* subsp. *lactospirae* inoculum is 2.5-3.5 × 10⁻⁶. 10 CFU / g, and / or the viable count of the *Streptococcus thermophilus* subsp. *salivarius* agent is 2-3 × 10⁻⁶. 11 CFU / g.
13. The fermenting agent according to claim 11, characterized in that, The viable count of *Streptococcus thermophilus* subsp. per gram of the fermentation agent is 1.2-1.35 × 10⁻⁶. 11 The viable count of CFU and / or the *Lactobacillus delbrueckii* subsp. *lactamella* is 0.6-0.75 × 10⁻⁶. 10 The viable count of CFU and / or the *Lactobacillus paracasei* is 0.9-1.05 × 10⁻⁶. 11 CFU.
14. The fermenting agent according to any one of claims 11-13, characterized in that, The Lactobacillus delbrueckii subsp. lactis is Lactobacillus delbrueckii Dangxiong LB Ⅷ, with accession number CCTCC NO:M 2022316; and / or the Streptococcus salivarius subsp. thermophilus is Streptococcus salivarius Jiacha.ST-685, with accession number CCTCC NO:M20231495.
15. A method for preparing a fermenting agent according to any one of claims 11-14, characterized in that, The process includes the following steps: based on the weight of the fermenting agent, mixing 40-45 wt% of Streptococcus salivarius thermophilus agent, 30-35 wt% of Lactobacillus paracasei agent as described in claim 8 or 9, and 20-25 wt% of Lactobacillus delbrueckii subsp. lactis agent to obtain the fermenting agent.
16. The preparation method according to claim 15, characterized in that, The *Lactobacillus delbrueckii* subsp. *lactamella* inoculum is prepared by the following steps: *Lactobacillus delbrueckii* subsp. *lactamella* seed culture is inoculated into a fermentation medium for fermentation to obtain *Lactobacillus delbrueckii* subsp. *lactamella* fermentation broth; then, the fermentation broth is separated into solid and liquid components and dried to obtain the *Lactobacillus delbrueckii* subsp. *lactamella* inoculum, wherein the viable count of the *Lactobacillus delbrueckii* subsp. *lactamella* inoculum is 2.5-3.5 × 10⁻⁶. 10 CFU / g, And / or the *Streptococcus thermophilus* subsp. *sauristatin* inoculum is prepared by the following steps: *Streptococcus thermophilus* seed culture is inoculated into a fermentation medium for fermentation to obtain *Streptococcus thermophilus* fermentation broth; then, the *Streptococcus thermophilus* fermentation broth is separated into solid and liquid components and dried to obtain the *Streptococcus thermophilus* inoculum, wherein the viable count of the *Streptococcus thermophilus* inoculum is 2-3 × 10⁻⁶. 11 CFU / g.
17. The use of the starter culture of any one of claims 11-14 in the preparation of milk-based or plant-based fermented milk.
18. A milk-based fermented milk or a plant-based fermented milk, characterized in that, The milk-based fermentation is prepared by a method comprising the following steps: mixing the starter culture of any one of claims 11-14 with animal milk and then fermenting to obtain milk-based fermented milk. Alternatively, the plant-based fermented milk may be prepared by a method comprising the following steps: mixing the fermenting agent according to any one of claims 11-14 with plant milk and then fermenting to obtain plant-based fermented milk.
19. The milk-based fermented milk or plant-based fermented milk according to claim 18, characterized in that, The animal milk includes cow's milk, or the plant milk is prepared by a method comprising the following steps: mixing plant with water, pulping and separating solid and liquid, discarding the precipitate, then adding amylase for enzymatic hydrolysis, sterilization and enzyme inactivation, to obtain plant milk.
20. The milk-based fermented milk or plant-based fermented milk according to claim 18, characterized in that, The mixing ratio of the fermenting agent to the animal milk is 0.03-0.1 g: 1 L. Alternatively, the mixing ratio of the fermenting agent to the plant milk may be 0.03-0.1g:1L.
21. The milk-based fermented milk or plant-based fermented milk according to claim 19, characterized in that, The plants include one or a combination of two of the following: grains and nuts.
22. The milk-based fermented milk or plant-based fermented milk according to claim 19, characterized in that, The amylase is α-amylase, wherein the amount of α-amylase added is 0.05-0.15 wt% based on the weight of the plant milk.
23. A method for preparing a milk-based fermented milk or plant-based fermented milk according to any one of claims 18-22, characterized in that, The method for preparing the milk-based fermented milk includes the following steps: mixing the starter culture agent according to any one of claims 11-14 with animal milk and then fermenting to obtain milk-based fermented milk. Alternatively, the method for preparing the plant-based fermented milk may include the following steps: mixing the fermenting agent according to any one of claims 11-14 with plant milk and then fermenting to obtain plant-based fermented milk.
24. The preparation method according to claim 23, characterized in that, When preparing the milk-based fermented milk, fermentation is stopped after the acidity reaches 65-75°T; or when preparing the plant-based fermented milk, fermentation is stopped after the acidity reaches 30-40°T.
Citation Information
Patent Citations
Lactobacillus delbrueckii subsp. Lactis with high biofilm formation and strong stress resistance and application thereof
CN116948884A
Ketoflavour type lactobacillus paracasei and application thereof in preparation of fermented dairy products
CN119639605A
Lactobacillus paracasei, Lactobacillus paracasei preparation, and applications of Lactobacillus paracasei preparation in pig feed
CN107164269A
Lactobacillus paracasei and application thereof in prevention or treatment of oral diseases
CN115717113A
Lactobacillus paracasei for preventing and / or treating hyperuricemia and application thereof
CN117085045A