Tobacco potassium ion channel NtAKT1 gene and application thereof

By cloning and silencing the NtAKT1 gene, a potassium ion channel in tobacco, and utilizing virus-induced gene silencing technology, the problem of insufficient research on NtAKT1 in tobacco was solved, resulting in a significant reduction in potassium content in tobacco leaves and improved tobacco quality.

CN121874209APending Publication Date: 2026-04-17ZHENGZHOU TOBACCO RES INST OF CNTC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610216324.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-14
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

In tobacco, there is limited research on the coding gene, expression characteristics, and physiological function of NtAKT1, a key potassium channel in the Shaker family, which limits the progress of improving potassium absorption efficiency and quality in tobacco through molecular breeding.

Method used

By cloning the tobacco potassium ion channel NtAKT1 gene and constructing a transient silencing vector using virus-induced gene silencing (VIGS) technology, the NtAKT1 gene was silenced, thereby reducing the potassium ion content in plant leaves.

Benefits of technology

Silent plants with significantly reduced potassium ion content were successfully obtained, indicating that NtAKT1 is a key factor regulating potassium ion accumulation in tobacco, providing genetic resources for increasing potassium content in tobacco leaves and improving tobacco quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121874209A_ABST
    Figure CN121874209A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of genetic engineering, and relates to a gene for regulating and controlling the potassium content of tobacco leaves, in particular to a tobacco potassium ion channel NtAKT1 gene and application thereof. The gene is a potassium ion channel, and the base sequence of the gene is as shown in SEQ ID NO. 1; wherein nucleotides from the 112th site to the 413th site are specific nucleic acid fragments. According to the invention, real-time PCR (polymerase chain reaction) shows that the gene has the highest expression quantity at the root of the tobacco. After a gene transient silencing technology (VIGS) or NtAKT1 gene knockout, the potassium ion content of tobacco leaves is remarkably reduced compared with that of a control group. According to the invention, the transport function of the NtAKT1 gene on the potassium content of the tobacco leaves is defined, a new evidence is provided for analyzing a molecular regulation mechanism of the potassium ion content of the tobacco leaves, a new thought is provided for regulating and cultivating high-potassium-content tobacco leaves through gene expression, and a new gene resource is provided for improving the potassium content of the tobacco leaves through a molecular means.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to genes related to potassium ion absorption and transport in tobacco, belonging to the field of genetic engineering technology, and specifically to a tobacco potassium ion channel that can regulate the potassium ion content of tobacco leaves. NtAKT1 Genes and their applications. Background Technology

[0002] Potassium is an essential macronutrient for plant growth and development, and it is particularly crucial for potassium-loving crops like tobacco (Nicotiana tabacum L.). Its content directly affects the field maturity, color, chemical composition (such as higher reducing sugars and lower total nitrogen), and physical properties (such as elasticity, toughness, and combustibility) of tobacco leaves, ultimately determining the yield and quality of the leaves. Tobacco primarily absorbs K⁺ from the soil through its roots. This process relies on the synergistic action of potassium ion channel proteins (such as AKT1, GORK, KAT, TPK, etc.) and transport proteins (such as HKT, KUP / HAK / KT, etc.). Among these, the AKT1 channel of the Shaker family, as a key inward rectifying channel for high-affinity potassium absorption in roots, has been shown in model plants such as Arabidopsis thaliana to be precisely regulated by the phosphorylation loop of potassium starvation signals and calcium signals, and its loss of function leads to severe potassium deficiency in plants under low potassium conditions. However, although the KUP / HAK / KT transporter family and other transporter proteins have been extensively studied in tobacco, and some genes (such as NtHAK1 and NtHAK5) have been cloned and reported, little is known about the encoding gene, expression characteristics, physiological function, and specific contribution of the key potassium channel NtAKT1 in the Shaker family to potassium absorption and accumulation. This knowledge gap seriously restricts the progress of improving the efficiency of potassium absorption and the quality of tobacco through molecular breeding. Summary of the Invention

[0003] The purpose of this invention is to provide a tobacco potassium ion channel. NtAKT1 Genes, thus laying the foundation for breeding varieties that regulate the potassium ion content of tobacco leaves.

[0004] The objective of this invention is achieved through the following technical solution: A tobacco potassium ion channel NtAKT1 The gene, consisting of 2682 base pairs, is derived from tobacco ( Nicotiana tabacum Its base sequence is shown in SEQ ID NO.1; where nucleotides 112-413 are specific nucleic acid fragments.

[0005] Tobacco potassium ion channels NtAKT1 The protein encoded by the gene consists of 10 amino acids, the amino acid sequence of which is shown in SEQ ID NO.2.

[0006] The tobacco potassium ion channelNtAKT1 The protein encoded by the gene is used in tobacco to regulate potassium ion content.

[0007] The tobacco potassium ion channel NtAKT1 The application of this gene in tobacco plants resulted in a significant decrease in potassium ion content in the leaves after the gene was silenced.

[0008] Used to silence tobacco potassium ion channels NtAKT1 The transient gene silencing VIGS vector was constructed using virus-induced gene silencing (VIGS) technology, with the aforementioned tobacco potassium ion channel... NtAKT1 Using a gene-specific nucleotide fragment as a guide sequence, the specific nucleic acid fragment is ligated into the transient expression vector TRV2, which is then transformed into *E. coli* DH5α to construct the transient silencing vector TRV2-. NtAKT1 .

[0009] The method for transiently silencing tobacco potassium ion channels NtAKT1 The application of the VIGS gene vector in tobacco for silencing tobacco potassium ion channels. NtAKT1 Genes that silence tobacco potassium channels NtAKT1 After gene therapy, the potassium ion content in plant leaves decreased significantly.

[0010] Using the aforementioned method for silencing tobacco potassium ion channels NtAKT1 The VIGS vector constructed from genes NtAKT1 The method of transiently silencing plants utilizes virus-induced gene silencing technology, specifically the transient silencing vector TRV2- NtAKT1 After conversion of Nicotiana benthamiana, potassium ion channels in tobacco were screened and identified. NtAKT1 Transiently silenced genes in plants, compared to non-silenced plants, NtAKT1 Potassium ion content decreased significantly in gene-silenced plants.

[0011] Tobacco potassium ion channels NtAKT1 The potassium ion content in the leaves of gene-silenced plants was significantly lower than that in the control, indicating that... NtAKT1 It may be a key regulatory factor in regulating potassium ion accumulation in tobacco, thus providing an important genetic resource for improving potassium content in tobacco leaves and cultivating high-quality new tobacco varieties through molecular biology.

[0012] This invention discovers tobacco potassium ion channels using real-time PCR. NtAKT1 The gene was expressed at the highest level in the roots of tobacco. A silencer was constructed using virus-induced gene silencing (VIGS) technology. NtAKT1 The VIGS vector of the gene was successfully transformed to obtain repressor. NtAKT1Silent plants expressed in *Nicotiana benthamiana* exhibited a specific phenotype with significantly lower potassium ion content compared to control plants. Analysis of potassium ion content in *Nicotiana benthamiana* revealed a significant reduction in potassium ion content in gene-silenced plants, decreasing by at least 38.9%, indicating that silencing this gene can significantly reduce potassium ion content in plants.

[0013] In summary, it can be seen that gene silencing technology or gene knockout can be used to achieve this. NtAKT1 The gene can produce gene-silenced plants with reduced potassium ion content, indicating that... NtAKT1 It is a positive regulator of potassium ion content in tobacco, providing a new genetic resource for increasing potassium content in tobacco leaves through molecular means. Attached Figure Description

[0014] Figure 1 For different tissues and organs NtAKT1 relative expression level Figure 2 For silent plants NtAKT1 The relative expression level of genes; Figure 3 The potassium ion content in tobacco leaves with virus-induced gene silencing after drying and control tobacco leaves. Detailed Implementation

[0015] The present application will be further explained below with reference to the embodiments. Before introducing the specific embodiments, the basic situation of some biological materials, experimental reagents, experimental instruments and other items involved in the following embodiments will be briefly introduced as follows. Biomaterials:

[0016] Tobacco material: Tobacco Benedict ( Nicotiana benthamiana ), a commercial tobacco variety; Transient expression vector: TRV2, purchased from China Plasmid Vector Bacterial Cell Gene Preservation Center; Gene sequencing and primer synthesis were provided by Shanghai Sangon Biotech. Experimental reagents:

[0017] LA Taq enzyme, PstI restriction endonuclease, plasmid extraction kit, gel extraction kit, etc., were purchased from Takara. The In-Fusion one-step cloning kit was purchased from clontech. The RNA extraction kit was purchased from GeneAnswer. The reverse transcription kit and RT-PCR kit were purchased from Roche. Peptone, yeast extract, etc., were purchased from Oxoid. The following is a brief description of some reagent formulations and preparation methods: (1) LB liquid medium (1L): 10 g bacterial peptone, 10 g sodium chloride (NaCl), 5 g yeast extract, autoclaved at high temperature; (2) YEB liquid culture medium (1L): 5 g beef extract, 5 g bacterial peptone, 5 g sucrose, 1 g yeast extract, 2 ml 1M magnesium sulfate (MgSO4), autoclaved at high temperature; (3) 1M 2-(N-morpholine) ethanesulfonic acid (MES) stock solution: Dissolve MES in ddH2O, filter and sterilize, store at -20℃ for later use; (4) 200 mM Acetosyringone stock solution: Dissolve acetosyringone in dimethyl sulfoxide (DSMO) and store at -20℃ for later use; (5) MMA (1L): 20 g sucrose, 5 g MS salts (Duchefa Biochemie), 1.95 g MES, 1 ml acetylsuccinone (200 mM), pH=5.6; Experimental apparatus: Tgradient PCR instrument, a product of Biometra. LightCycler 96 real-time quantitative PCR instrument, a product of Roche. Example 1

[0018] This embodiment mainly focuses on tobacco potassium ion channels. NtAKT1 The process of obtaining genes is briefly described below.

[0019] Using cultivated tobacco leaves as samples, total RNA was extracted from tobacco leaves using an RNA extraction kit and reverse transcribed into cDNA for later use. By using homology comparison, referencing Arabidopsis thaliana AtAKT1 Based on the gene sequence and the known partial gene sequence of tobacco, the amplification primer sequences are designed as follows: F: 5'-CGCGAGCTCGGTACC ATGGGAGATGTGAGAAGAAAT -3', R: 5'-GCTCACCATGGATCCTCACCTCAACTCATCACC-3'; Using the prepared cDNA as a template, PCR amplification was performed using the primers described above. The amplified product was then purified and sequenced to obtain the tobacco potassium ion channel. NtAKT1 The gene sequence, whose base sequence is shown in SEQ ID No.1, consists of 2682 bases, of which nucleotides 112-413 are specific nucleic acid fragments.

[0020] After translation of the gene sequence, the encoded protein sequence is shown in SEQ ID No.2, which includes 893 amino acids. Further comparative analysis showed that the protein contains highly homologous sequences and is highly conserved. Example 2

[0021] In order to detect NtAKT1 To investigate the expression specificity of the gene in different tissues, samples were taken from the roots, stems, and leaves of tobacco plants during their vigorous growth phase and from the flowers during their full bloom phase. RNA was extracted and reverse transcribed into cDNA for the corresponding organs. Real-time PCR was then used to detect the expression of the gene in different tissues. Specific quantitative primer sequences were designed as follows: F: 5'- ATGGAGGATCATTAGGGC-3' R: 5'- GTCGTGCTCATTGGTCTG-3' The results showed that ( Figure 1 Tobacco potassium ion channels NtAKT1 The gene is expressed in all tissues of tobacco, with the highest expression level in the roots. Example 3

[0022] Using the tobacco potassium ion channel obtained in Example 1 NtAKT1 The inventors further constructed a vector for transient gene silencing, and the relevant construction process is briefly described below.

[0023] A relatively specific nucleic acid fragment from this gene (nucleotide sequence 112-413 of SEQ ID NO.1) was selected as the guide sequence for VIGS. The primer sequence is designed as follows, and this sequence was amplified. The primer sequence design for constructing the VIGS transient silencing vector is as follows: NtAKT1 -F:5'-AGATCGACGACAAGACCCTGCAGTAGTAGCCATTATAGTCTTTCAACT-3', NtAKT1 -R:5'-TTCTGAGGAGAAGAGCCCTGCAGCAACGAGTAGATACGTGGTTCTAT-3'; Amplification length: 302bp.

[0024] The amplified fragment was ligated into the TRV2 vector using the in-fusion method (ligation at 50℃ for 15 min), transformed into E. coli DH5α, and TRV2- was constructed. NtAKT1 Carrier.

[0025] After successful sequencing, the recombinant plasmid was transformed into Agrobacterium GV3101 using the freeze-thaw method. After culturing at 30°C for 48 hours, single colonies were picked, cultured in liquid, and then verified by bacterial PCR to ensure that the target fragment was transformed correctly. Example 4

[0026] Using the VIGS transient silencing vector constructed in Example 3, the inventors conducted further cultivation experiments with *Nicotiana benthamiana* as an example to silence the tobacco potassium ion channels in the plant. NtAKT1 The gene and related experimental procedures are briefly described below.

[0027] Sow tobacco seeds in seedling pots and cultivate seedlings. Two weeks after germination, transplant the seedlings into plastic pots (10cm×10cm). Carry out daily fertilization and watering under the conditions of 22℃, 16h light / 8h dark. After 4-5 weeks of growth, select 12 pots of tobacco seedlings with uniform growth for later use.

[0028] The contents of TRV1, TRV2, TRV2-PDS (positive control), and TRV2- NtAKT1 Single colonies of Agrobacterium were inoculated into YEB (5 mL) medium (kanamycin, 50 μg / mL), and cultured overnight at 28℃ and 250 r / min with shaking for about 48 h before being transferred to 50 mL of YEB. Incubate overnight at 28°C with shaking. Centrifuge at 4000 rpm for 8 min to collect Agrobacterium bacteria into 50 mL centrifuge tubes. Adjust the OD value of the bacterial culture to approximately 1.0 using a mixed solution containing 10 mmol / L 2-N-morpholinyl ethanesulfonic acid (MES), 250 μmol / L acetosyringone (As), and 10 mmol / L MgCl2. [The text then abruptly shifts to a seemingly unrelated topic:] ...in the presence of TRV2, TRV2-... PDS TRV2- NtAKT1 Add an equal volume of MMA suspension of Agrobacterium to the MMA suspension containing TRV1 Agrobacterium, mix well, and let stand at room temperature for 3-6 hours.

[0029] For inoculation, select approximately 4-5 leaves of uniform growth. Using a 1 mL needleless sterile syringe, inject Agrobacterium suspension containing different TRV recombinant plasmids into the fully expanded leaves from the underside of the leaves using a pressure filtration method, ensuring the bacterial suspension completely fills the leaf. Incubate at 22℃ and 75% humidity. Four pots were inoculated with plants containing the TRV2-PDS positive control, while the remaining plants contained the TRV2 empty vector and the TRV2-PDS ... NtAKT1 Six pots of each type of plant were inoculated.

[0030] Six weeks after inoculation, the levels of the virus in silent plants and control plants were measured. NtAKT1 Relative gene expression levels and potassium ion content.

[0031] In silent plants and control plants NtAKT1 The relative gene expression levels were analyzed by qRT-PCR, and the results are as follows: Figure 2 As shown.

[0032] The potassium ion content of the obtained silent plants and control plants was detected. The detection method is as follows: Take samples of the leaves of the above-mentioned plants, taking 3-4 leaves from each plant, wrapping them in aluminum foil, and drying them overnight in an oven at 90°C. The dried sample was crushed using a grinder. 0.05g of tobacco leaves (accurate to 0.0001g) was weighed, 15ml of 5% acetic acid solution was added, and the sample was placed in a constant temperature shaker (30℃ shaker) and shaken for 30min. After filtration through filter paper, the potassium ion content was determined using a continuous flow analyzer.

[0033] The results are as follows Figure 3 As shown. The results indicate that TRV2- NtAKT1 The potassium ion content in virus-induced gene-silenced plants was approximately 61% of that in control plants. That is, after gene silencing, the potassium ion content in the plants decreased by about 38.9%. SEQ ID NO.1

[0034] SEQ ID NO.2

[0035]

Claims

1. A tobacco potassium channel NtAKT1 A gene with a CDS sequence comprising 2682 bases, the base sequence of which is shown in SEQ ID NO. 1; wherein nucleotides 112-413 are a specific nucleic acid fragment.

2. The tobacco potassium channel of claim 1 NtAKT1 a protein encoded by the gene, characterized in that, It contains 893 amino acids, and its amino acid sequence is shown in SEQ ID NO.

2.

3. The tobacco potassium channel of claim 2 NtAKT1 application of the protein encoded by the gene in tobacco, characterized in that, Used to regulate the potassium ion content of tobacco leaves.

4. The tobacco potassium channel of claim 1 NtAKT1 application of the gene in tobacco, characterized in that, Silencing this gene reduced the potassium ion content in tobacco leaves.

5. For silencing the tobacco potassium ion channel of claim 1 NtAKT1 Transient gene silencing (VIGS) vectors, characterized in that, By the following construction method: the tobacco potassium ion channel NtAKT1 The specific nucleotide fragment of the gene is connected to the transient expression vector TRV2, and E. coli DH5α is transformed, so as to obtain the transient silencing vector TRV2- NtAKT1 .

6. The method for silencing tobacco potassium ion channels as described in claim 5 NtAKT1 The application of the VIGS gene vector in tobacco is characterized by, Potassium channel in tobacco NtAKT1 genes.

7. Using the method described in claim 5 for silencing tobacco potassium ion channels NtAKT1 The VIGS vector constructed from genes NtAKT1 The method for transiently silencing plants is characterized by, Using virus-induced gene silencing technique, the transient silencing vector TRV2- NtAKT1 was transformed into N. benthamiana, and the tobacco potassium ion channel gene NtAKT1 transiently silenced plants were screened and identified, compared with non-silenced plants, NtAKT1 The potassium ion content in the gene-silenced plants was significantly reduced.

8. The method of claim 7 NtAKT1 Use of transiently silenced or RNAi transgenic plants in breeding for regulation of potassium ion content in tobacco, characterized in that, The potassium ion content in the plant leaves decreased.