Engineering bacterium for producing nisin

By isolating Lactococcus lactis LL09 from fermented soybean meal and performing gene editing and fermentation optimization, an engineered strain LL09::3nisA-∆Plasmid2\3 that produces lactic acid nisin efficiently was constructed, solving the problems of low yield and high cost of existing strains and achieving high-efficiency production and cost reduction.

CN121914948APending Publication Date: 2026-04-24HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610063698.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-19
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing nisin-producing strains have limited nisin synthesis capacity and are susceptible to bacteriophage infection and environmental stress, resulting in low yields and high production costs, making it difficult to meet market demand.

Method used

Lactococcus lactis LL09 was isolated from fermented soybean meal, and PnisA-nisA expression cassette was inserted using gene editing technology to eliminate unnecessary plasmids and optimize fermentation conditions, including carbon source, temperature and pH, to construct an engineered strain LL09::3nisA-∆Plasmid2\3 that produces lactic acid nisin efficiently.

Benefits of technology

It significantly improved the production efficiency of nisin, achieving a high yield of 24000±300 IT/mL, reduced production costs, and expanded the scope of application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121914948A_ABST
    Figure CN121914948A_ABST
Patent Text Reader

Abstract

The invention relates to an engineering bacterium for producing nisin, and belongs to the field of synthetic biology. Specifically, the invention provides an engineering bacterium which can efficiently produce nisin and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to an engineered bacterium that produces nisin, belonging to the field of synthetic biology. Background Technology

[0002] Nisin is a natural antimicrobial peptide produced by the metabolism of Lactococcus lactis, belonging to the bacteriocin class of substances. It exerts a broad-spectrum antibacterial effect by inhibiting bacterial cell wall synthesis and disrupting cell membrane stability, and is particularly effective against Gram-positive bacteria (such as Clostridium botulinum and Listeria monocytogenes). It is widely used in food preservation, medical treatment, and animal husbandry.

[0003] Currently, Nisin production mainly relies on wild-type or selected strains of Lactococcus lactis. However, these natural strains have limited Nisin synthesis capacity and are susceptible to factors such as bacteriophage infection and environmental stress during fermentation, resulting in low yields and high production costs, making it difficult to meet the growing market demand.

[0004] In existing technologies, modifying production strains through metabolic engineering is one of the effective strategies for increasing Nisin yield. For example, overexpressing Nisin biosynthesis-related genes (such as nisA and nisFEG), optimizing precursor amino acid supply, or enhancing the function of regulatory factors can improve yield to some extent. However, such modifications often rely on known model strains (such as *Lactococcus lactis* subsp. *lactococcus*), whose genetic background is clear, but the efficiency of genetic modification and the potential for improving production performance are limited. Furthermore, wild-type strains contain abundant untapped resources, which may include natural species with unique antibacterial properties or higher production potential. Therefore, developing new wild-type *Lactococcus lactis* strains with excellent antibacterial properties and suitable for genetic modification, and improving their Nisin synthesis capacity through rational design, is of great significance for reducing production costs and expanding application scope.

[0005] This invention isolates a type of lactococcus from fermented soybean meal, which exhibits significant antibacterial effects against various pathogenic bacteria. Through further engineering modifications, a new engineered strain was obtained, possessing the ability to efficiently produce nisin. Summary of the Invention

[0006] The present invention provides a lactococcus lactis, characterized in that the 16S rDNA sequence of the lactococcus lactis is shown in SEQ ID NO. 1.

[0007] The present invention also provides an expression cassette, characterized in that the expression cassette is formed by sequentially connecting a promoter of the sequence shown in SEQ ID NO. 3, a nucleic acid molecule encoding an amino acid of the sequence shown in SEQ ID NO. 6, and a terminator of the sequence shown in SEQ ID NO. 7.

[0008] In some implementations, the above-mentioned nucleic acid molecular sequence is shown in SEQ ID NO. 5.

[0009] This invention provides an engineered bacterium, characterized in that the engineered bacterium is modified from the above-mentioned Lactococcus lactis as follows:

[0010] (1) The above expression cassette was inserted between the sequences shown in SEQ ID NO. 8 and SEQ ID NO. 9, and the above expression cassette was inserted between bases 814-988 of SEQ ID NO. 10;

[0011] (2) The EndogenoTs Plasmid2 and EndogenoTs Plasmid3 plasmids in Lactococcus lactis were eliminated.

[0012] The engineered bacteria is strain with preservation number CCTCC NO: M2026039.

[0013] In some embodiments, the above-described method of eliminating Plasmid3 and Plasmid4 plasmids in Lactococcus lactis is to interfere with the function of the RepB gene, the sequence of which is shown in SEQ ID NO. 24 and SEQ ID NO. 25.

[0014] The present invention also provides a method for preparing the above-mentioned engineered bacteria, characterized in that the method involves expressing the protein shown in SEQ ID NO. 18 and the RNA shown in SEQ ID NO. 19-23 in the above-mentioned Lactococcus lactis, while introducing the following three nucleic acid fragments:

[0015] i: A nucleic acid fragment formed by sequentially linking the expression cassette according to any one of claims 4-5 and SEQ ID NO. 13;

[0016] ii: A nucleic acid fragment formed by sequentially linking the expression cassette according to any one of claims 4-5 and SEQ ID NO. 15;

[0017] iii: A nucleic acid fragment formed by sequentially linking the expression cassette according to any one of claims 4-5 and SEQ ID NO. 17;

[0018] Select strains that have been identified as meeting the characteristics of the engineered bacteria described above.

[0019] The present invention also provides a microbial agent, characterized in that the microbial agent contains at least one of the above-mentioned Lactococcus lactis or the above-mentioned engineered bacteria or their cultures, metabolites, exosomes, and fermentation products.

[0020] The present invention also provides a method for producing nisin, characterized in that the above-mentioned engineered bacteria are fermented and cultured, and nisin is collected after 24 hours of fermentation;

[0021] The culture medium used for fermentation is formulated as follows: 20 g / L sucrose + 3 g / L~9 g / L corn steep liquor + 15 g / L yeast extract + 15 g / L tryptone + 20 g / L potassium dihydrogen phosphate + 2.6 g / L L-cysteine ​​+ 1.5 g / L sodium chloride + 0.15 g / L magnesium sulfate heptahydrate; the pH of the fermentation medium is 6.8~8.8; and the fermentation temperature is 20℃~37℃.

[0022] In some embodiments, the pH of the fermentation medium is 7.8, and the fermentation temperature is 30°C.

[0023] The present invention also provides the above-mentioned Lactococcus lactis, or the above-mentioned expression cassette, or the above-mentioned engineered bacteria, or the above-mentioned method, or the above-mentioned bacterial agent, or the application of the above-mentioned method in the production of nisin.

[0024] The beneficial effects of this invention are as follows: This invention isolates a type of *Lactococcus lactis* from fermented soybean meal, which exhibits significant antibacterial effects against various pathogenic bacteria. Through further engineering modifications, a new engineered strain is obtained, possessing the ability to efficiently produce nisin. Attached Figure Description

[0025] Figure 1 Results of PCR amplification of 16S rDNA. M, molecular weight standard; 1, amplification product.

[0026] Figure 2 The antibacterial effect of LL09. M. lTteTs is Micrococcus luteus, S. aTreTs is Staphylococcus aureus, V. parahaemolyticTs is Vibrio parahaemolyticus, and V. alginolyticTs is Vibrio alginolyticus.

[0027] Figure 3 Promoter activity assay. A. Schematic diagram of Nisin gene cluster; B. Schematic diagram of plasmid expression of mCherry; C. Fluorescence microscope image of plasmid expression of mCherry; D. Effect of promoter on expression of fluorescent protein mCherry.

[0028] Figure 4 pMG36e vector image.

[0029] Figure 5 Comparison of Nisin titers produced by different engineered strains. LL09: LL09 wild-type strain; LL09::nisA: LL09 engineered strain integrating one nisA expression cassette; LL09::2nisA: LL09 engineered strain integrating two nisA expression cassettes; LL09::3nisA: LL09 engineered strain integrating three nisA expression cassettes; LL09::3nisA-∆Plasmid2\3: LL09 engineered strain integrating three nisA expression cassettes and eliminating Plasmid3 and Plasmid4.

[0030] Figure 6 Distribution of integration sites on the LL09 genome. Sites are indicated by arrows, located within the G331 gene, the G550 gene, and between the G1085 and G1086 genes, respectively.

[0031] Figure 7 Schematic diagram of gene integration. A. Schematic diagram of nisA expression cassette for gene integration; B. PCR verification of nisA gene integration.

[0032] Figure 8 A simplified diagram of the genome. Plasmids pE-TnpB-ωRNA4 and pE-TnpB-ωRNA5 were continuously electroporated into Lactococcus to target Plasmid3 and Plasmid4.

[0033] Figure 9 Growth curves of engineered strains LL09 and LL09::3nisA-∆Plasmid2\3.

[0034] Figure 10 The impact of carbon sources on Nisin production. A. Compare the impact of different types of carbon sources on Nisin production; B. The impact of different corn steep liquor addition amounts on Nisin production.

[0035] Figure 11 Changes in Nisin titer, pH value, and viable cell concentration in fermentation broth from 4 to 28 h. Each data point represents the Nisin titer, pH value, and viable cell concentration at 4 h, 8 h, 12 h, 16 h, 20 h, 24 h, and 28 h, respectively.

[0036] Figure 12 The effects of fermentation temperature and pH on Nisin production. A. Nisin potency at different temperatures with pH=7.8; B. Nisin potency at different pH values ​​at 30℃. Detailed Implementation

[0037] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0038] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook J & R.T. Ssell DW, 2001), or according to the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available and conventional methods well known to those skilled in the art.

[0039] Example 1: Obtaining and performing lactic acid bacteria strain LL09

[0040] The inventors isolated lactic acid bacteria strains from fermented soybean meal, and the specific process was as follows:

[0041] Take 10 g of sample from fermented soybean meal and add it to 100 mL of physiological saline. Mix well and then serially dilute the mixture (10 g to 100 mL). -3 10- 4 10 -5 The isolates were plated on GM17 agar plates containing 1.5% calcium carbonate and incubated at 30°C for 24 h. Colonies exhibiting characteristics consistent with lactic acid bacteria, such as round, raised colonies with smooth or slightly rough surfaces, milky white color, and a calcium-dissolving zone, were selected. After five streaking tests, purified single colonies were obtained and subjected to Gram staining. Gram-positive strains were preserved in 30% glycerol tubes. The genome of the isolated strain was extracted, and its 16S rDNA was amplified using universal primers 27F and 1492R, revealing a 1500 bp band. Figure 1 The PCR amplification product was sequenced, and the full 16S rDNA sequence was obtained as shown in SEQ ID NO. 1. The strain was identified as *Lactococcus lactis* by comparison with the NCBI database and named *Lactococcus lactis* LL09.

[0042] The inventors conducted in vitro antibacterial experiments using the Oxford cup method and found that LL09 has significant antibacterial effects against a variety of pathogenic bacteria, including Micrococcus luteus, Staphylococcus aureus, and common aquatic pathogens such as Vibrio parahaemolyticus and Vibrio alginolyticus. The experimental results are as follows: Figure 2 As shown.

[0043] The antibiotic susceptibility of LL09 was further determined using the disk diffusion method. Lactococcus lactis strain LL09, activated twice, was cultured overnight for 24 h and then inoculated at 1% onto GM17 agar plates. Disks for antibiotic susceptibility testing (rifampin, erythromycin, kanamycin, tetracycline, chloramphenicol, amoxicillin, ciprofloxacin, clindamycin, etc.) were evenly applied to the surface of the GM17 plates. The disks were gently pressed with tweezers to prevent them from falling off, and then incubated at 37℃ for 24 h. The diameter of the inhibition zone on each disk was measured, and three measurements were taken, with the average value used to assess the antibiotic susceptibility of LL09. The results showed that LL09 was sensitive to most of the 33 antibiotics tested; it was particularly sensitive to erythromycin, tetracycline, chloramphenicol, and amoxicillin; while its sensitivity to polymyxin B, trimethoprim-sulfamethoxazole, and streptomycin was weak or resistance was observed (Table 1).

[0044]

[0045] The inventor used LL09 to produce nisin, and the specific production process is as follows:

[0046] Prepare the initial fermentation medium: 15 g yeast extract, 15 g tryptone, 20 g potassium dihydrogen phosphate, 20 g glucose, 3 g corn steep liquor, 2.6 g L-cysteine, 1.5 g sodium chloride, and 0.15 g magnesium sulfate heptahydrate. Make up to 1 L, adjust the pH to 7.8, and sterilize at 115℃ for 20 min.

[0047] LL09 was fermented in shake flasks for 24 hours using the initial fermentation medium. After extracting Nisin, the culture medium for indicator bacteria was added and the mixture was incubated at 37°C for 24 hours. The size of the inhibition zone was measured and the titer was obtained by substituting the results into the standard curve. The titer was 3600±100 IT / mL.

[0048] The above results indicate that the LL09 strain has limited performance in producing nisin and needs further improvement.

[0049] Example 2: Identification of promoter activity in the lactic acid nisin synthesis pathway

[0050] The nisin synthesis pathway contains 11 genes, and the transcription and translation of the entire pathway are regulated by 3 promoters, of which only promoter P... nisR It is a constitutive promoter, P nisA P nisF All are induced promoters ( Figure 3 A). The inventors identified the genome of strain LL09 and cloned it into P. nisR P nisA P nisF Promoters (sequences shown in SEQ ID NO. 2-4 respectively). To improve the yield of nisin, the inventors tested the activity of these three promoters.

[0051] First, the shuttle plasmid pMG36e (vector image shown) was used... Figure 4 A red fluorescent protein expression box was constructed on it. Figure 3 B) Different promoters are used to express mCherry, including the plasmid-based original promoter P. 32 The three promoters P of the Nisin gene cluster nisA P nisR and P nisF The four constructed expression plasmids were electroporated into *L. lactis* LL09. The activated bacterial culture was then used to prepare slides for observation under a fluorescence microscope. It was observed that all four strains expressing fluorescent proteins showed red fluorescence under the microscope, but the fluorescence intensity varied significantly. Figure 3 C). With the exposure time standardized to 1 second, the results showed that the fluorescence signal intensity from strongest to weakest was LL09::P. nisA -mCherry、LL09::P 32 -mCherry、LL09::P nisF -mCherry、LL09::P nisR -mCherry. To further validate the results of the microscopic observation, real-time quantitative PCR was performed, using relative quantitative 2- ΔΔCT The relative gene expression level of the red fluorescent protein mCherry was analyzed using a method. Calculations revealed that strain LL09::P... nisA -mCherry had the highest mCherry expression level, strain LL09::P nisR -mCherry had the lowest mCherry expression level in strain LL09::P nisA -mCherry and LL09::P nisF There were also significant differences in mCherry expression levels among -mCherry. Figure 3 D).

[0052] The above results indicate that P nisA The activity of this promoter is the strongest, and it can be used to drive the substrate gene nisA (sequence shown in SEQ ID NO. 5) of the lactic acid synthesis pathway to increase the production efficiency of lactic acid.

[0053] Example 3: Selection of Integration Location

[0054] The inventors constructed P nisA -nisA expression box, including promoter P nisA Gene nisA, Ter terminator nisA The proposed protein is to be inserted into the LL09 genome to express the nisA protein. The inventors first tested P... nisA The effect of the number of -nisA expression cassettes on the yield of nisin production is as follows: Figure 5 As shown. Integrating P nisA -nisA expression cassettes do indeed increase Nisin production in engineered strains, with the integration of P nisA Increasing the number of -nisA expression cassettes improved the level of Nisin production by the engineered strain. However, when more than three expression cassettes were integrated, the integration success rate decreased significantly. Therefore, inserting three expression cassettes is optimal for nisin production.

[0055] To find three suitable insertion sites, the inventors further analyzed the genome sequence and annotation information. The results showed that the LL09 genome contains a bleomycin (G550) and tetracycline (G331) resistance gene. Resistance genes are mobile components acquired by bacteria during evolution, and their presence increases the risk of horizontal gene transfer between bacteria. Therefore, the researchers chose to insert the gene into the bleomycin (G550) and tetracycline (G331) resistance genes to interfere with their function simultaneously. At the same time, another copy was inserted between G1085 and G1086 without interfering with the function of these two genes. A schematic diagram of the insertion sites is shown below. Figure 6 The sequences of G550 and G331 are shown in SEQ ID NO. 8 and SEQ ID NO. 9. The sequences of G1085 and G1086, as well as the intergenic sequences, are shown in SEQ ID NO. 10, where bases 1-813 are G1085, bases 989-1642 are G1086, and bases 814-988 are the intergenic sequences.

[0056] The inventors intend to use the SisTnpB1 gene editing system to edit P nisA-nisA was integrated into the above-mentioned site. The sequence of the SisTnpB1 gene is shown in SEQ ID NO. 11. TTTAA was selected as the TAM sequence, and the homologous arm length was set to 1 kb. Among them, the sequences of homologous arms L and R of G550 are shown in SEQ ID NO. 12 and SEQ ID NO. 13; the sequences of homologous arms L and R of G331 are shown in SEQ ID NO. 14 and SEQ ID NO. 15; and the sequences of homologous arms L and R between G1085 and G1086 are shown in SEQ ID NO. 16 and SEQ ID NO. 17. P nisA The -nisA expression cassette was inserted between the L and R homologous arms at three sites, along with the SisTnpB1 gene expression cassette (for expressing SisTnpB1 protein, sequence shown in SEQ ID NO. 18), and ωRNA expression cassettes targeting three sites (the three ωRNA sequences are shown in SEQ ID NO. 19~21), to construct the pE-TnpB-nisA integrative plasmid. The constructed plasmid was electroporated into L. lactis LL09 ( Figure 7 A) Transformants were picked after growing on GM17 solid plates supplemented with 5 μg / mL erythromycin for approximately 48 h. The transformants were activated in liquid medium and then amplified by PCR using primers YZ-nisA-F and YZ-nisA-R (F1: TGGAGATCGTCAGTTAGAAGTCTTTAA, R1: CTGCCTTTAATGACAGTTTTAAGGAC; F2: CAAGAATTTAAACGTGAGCTTGAAG, R2: AACAATTTCTGGCCCAACAGTT; F3: CAAATCCGTTTTCAGTCAAGGATA, R3: ATAAATTAAACCCCGCTTCGG). The results showed that P nisA -nisA expression cassette has been successfully integrated into a specific site in the LL09 genome. Figure 7 B).

[0057] Example 4: Genome Simplification of Lactococcus lactis

[0058] The bacterial genome contains numerous mobile elements, including insertion sequences (IS), transposons, integrons, self-transmissible broad host range plasmids, genomic islands, and phages. In chassis cell construction, non-essential genes in the bacterial genome are often deleted to streamline the genome and improve certain production performance characteristics of the strain. Therefore, this study utilized a gene editing system to eliminate non-essential genes, specifically removing two circular plasmids from the LL09 genome. Figure 8 The specific method involves constructing ωRNA4 and ωRNA5 (sequences shown in SEQ ID NO. 22-23) targeting the replication protein RepB on the endogenous circular plasmids EndogenoTs Plasmid2 and EndogenoTs Plasmid3 on the pE-TnpB plasmid. The total length of the endogenous circular plasmids EndogenoTs Plasmid2 and EndogenoTs Plasmid3 is approximately 62 kb. After pE-TnpB expresses ωRNA and TnpB, it can cleave the RepB gene (replication protein) (sequence shown in SEQ ID NO. 24-25) on the EndogenoTs Plasmid2 and EndogenoTs Plasmid3 plasmids, preventing the replication of EndogenoTs Plasmid2 and EndogenoTs Plasmid3 plasmids. This eliminates the EndogenoTs Plasmid2 and EndogenoTs Plasmid3 plasmids during cell proliferation, thereby simplifying 62 kb of DNA in the genome. The engineered strain LL09::3nisA-∆Plasmid2\3 with a simplified genome was obtained through the above method.

[0059] The strains were activated for two generations in GM17 medium, and the OD values ​​of different strains were adjusted. 600 After reaching 1.0, the culture medium was inoculated at a ratio of 2% into fresh GM17 medium. Finally, the medium was aliquoted into 96-well plates, 200 μL per well, and incubated at 30°C for 24 hours using an automated growth curve analyzer. Growth curves were then plotted. The results showed that LL09::3nisA-∆Plasmid2\3 exhibited a greater growth advantage than LL09. Figure 9 ).

[0060] The strain LL09::3nisA-∆Plasmid2\3 has been deposited at the China Center for Type Culture Collection (address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province). The culture name and distinguishing characteristics are: LL09::3nisA-∆Plasmid23, LactococcTs lactis, accession number CCTCC NO: M2026039, deposit date: January 8, 2026.

[0061] Example 5: Detection of Nisin Production

[0062] The indicator strain *Micrococcus luteus* was removed from cryovials and activated for two generations. It was then inoculated at a ratio of 2% into a suitable temperature-controlled indicator medium, mixed thoroughly, and poured onto plates with Oxford cups. After the medium solidified, Nisin extract was added, and the plates were incubated upright at 37°C for 24 hours. The size of the clear zone was then calculated. The size of the inhibition zone was also analyzed, and the potency was calculated based on the standard. The results showed that compared to the wild-type strain, the engineered probiotic LL09::3nisA-∆Plasmid2\3 exhibited a stronger antibacterial effect, demonstrating that this engineered strain can produce more nisin (…). Figure 5 ).

[0063] To further improve the efficiency of this engineered strain in producing nisin, the inventors optimized the specific production process, including aspects such as carbon source, fermentation time, and fermentation volume. The specific optimization process is as follows:

[0064] 1. Carbon source optimization: The effects of four carbon sources (glucose, sucrose, fructose, and lactose, all at 20 g / L) on Nisin production were compared. The results showed that all four carbon sources could be used to produce Nisin, but sucrose was the most effective, increasing production by approximately 1.6 times compared to glucose. Figure 10 A); Changing the amount of corn steep liquor between 3 g / L and 9 g / L had no effect on Nisin yield. Figure 10 B).

[0065] 2. Fermentation Time: LL09::3nisA-∆Plasmid2\3 was inoculated into sucrose fermentation medium. Nisin titer, pH, and viable cell concentration were measured every 4 hours. No significant Nisin production was observed in the first 20 hours, followed by a substantial increase in Nisin yield, indicating that the colonies were in their growth phase during the first 20 hours. Fermentation of Nisin only began after nutrients were depleted. Over time, the number of viable cells in the fermentation broth gradually increased, reaching its maximum at 20 hours, after which it began to decrease. The pH decreased slowly from 0 to 12 hours, with the rate of decrease gradually increasing from 12 hours onwards. Figure 11 ).

[0066] 3. Temperature and pH: The Nisin yield of LL09::3nisA-∆Plasmid2\3 at 20℃, 25℃, 30℃, 37℃, and 45℃ was tested. The results showed that the Nisin yield of the strain was relatively high between 20℃ and 37℃, with the highest Nisin yield at 30℃. Figure 12 A); Nisin yield remained high when pH ranged from 6.8 to 8.8, with the highest yield at pH 7.8. Figure 12 B).

[0067] Based on the above test results, it was ultimately determined that the optimal conditions for producing nisin using the engineered strain LL09::3nisA-∆Plasmid2\3 were when the carbon source was 20 g / L sucrose and 3 g / L–9 g / L corn steep liquor, the fermentation temperature was 30℃, and the pH was 7.8, after 24 hours of fermentation. One typical specific operational step is as follows:

[0068] 1. Culture medium preparation

[0069] Fermentation medium formula: 20 g / L sucrose, 3 g / L corn steep liquor, 15 g / L yeast extract, 15 g / L tryptone, 20 g / L potassium dihydrogen phosphate, 2.6 g / L L-cysteine, 1.5 g / L sodium chloride, 0.15 g / L magnesium sulfate heptahydrate, bring the volume to 1L, adjust the pH to 7.8, and sterilize at 115℃ for 20 min.

[0070] Preparation steps:

[0071] a. Calculate the total volume of culture medium required (based on the fermenter capacity, for example, a 5 L fermenter requires approximately 4 L of culture medium, leaving space for inoculation and foaming).

[0072] b. Add an appropriate amount of deionized water to the preparation container and heat to 50-60℃ to promote dissolution.

[0073] c. Add sucrose, corn syrup and other ingredients in sequence, and stir until completely dissolved.

[0074] d. Adjust the initial pH of the culture medium to 7.8 with 1 M NaOH or 1 M H2SO4 (calibrate using a pH meter).

[0075] e. Adjust the volume to the target volume using deionized water.

[0076] f. Dispense the culture medium into fermenters, seal them, and autoclave at 115°C for 20 minutes. Cool to 30°C after sterilization for later use.

[0077] 2. Seed culture (inoculum preparation)

[0078] The seed culture medium used is GM17 medium, and the inoculation steps are as follows:

[0079] a. Take a loopful of colony from the preserved strain (LL09::3nisA-∆Plasmid2\3) and inoculate it into the seed culture medium.

[0080] b. Incubate at 30℃ and 200 rpm in a shaker for 12-16 hours until OD is reached. 600 Reaching 1.0-1.5 (indicating that the strain has entered the logarithmic growth phase).

[0081] c. Check the purity of the seed solution (e.g., by microscopic observation) to ensure it is free of contamination.

[0082] 3. Fermentation process

[0083] Equipment preparation:

[0084] Use a standard fermenter (e.g., 5 L capacity) equipped with temperature, pH, and dissolved oxygen control systems.

[0085] Calibrate the pH probe and temperature sensor to ensure accuracy.

[0086] Vaccination:

[0087] a. Aseptically transfer the seed culture to the fermenter at an inoculum volume of 5-10% (v / v). For example, for 4 L of fermentation medium, inoculate with 200-400 mL of seed culture.

[0088] b. Record the inoculation time (defined as 0 hours of fermentation).

[0089] Fermentation condition control:

[0090] Temperature: Maintain the fermentation temperature at 30℃ (automatically controlled by the jacketed water bath or electric heating system of the fermenter).

[0091] Stirring and aeration: Set the stirring speed to 200-300 rpm and the aeration rate to 0.5-1.0 vvm (volume ratio / min) to maintain dissolved oxygen at 20-30% saturation (adjust according to the oxygen demand of the strain).

[0092] Foam control: Add defoamer (such as silicone-based defoamer) if necessary to prevent foam overflow.

[0093] Monitoring and sampling:

[0094] Samples were taken every 4 hours, and the following parameters were measured:

[0095] Nisin potency: determined using a bioassay (inhibition zone method).

[0096] pH value: Measured using a pH meter and cross-validated with fermenter readings.

[0097] Viable bacterial concentration: determined by plate count (CFT / mL) or OD. 600 Measurement.

[0098] Fermentation time: The total fermentation time is 24 hours. Nisin yield reaches its optimal level after 24 hours, at which point fermentation ends.

[0099] 4. Harvesting and Downstream Processing

[0100] Fermentation broth harvest:

[0101] a. Stop stirring and aerating after 24 hours of fermentation.

[0102] b. Transfer the fermentation broth to a collection container and cool it to 4°C to stabilize Nisin.

[0103] c. Remove bacterial cells by centrifugation (8000 rpm, 15 minutes) or microfiltration, and collect the supernatant (containing Nisin).

[0104] d. The supernatant can be further purified (e.g., by ammonium sulfate precipitation, chromatographic purification, etc.) or used directly as a crude product.

[0105] Cleaning and storage:

[0106] a. Clean the fermentation tank and equipment in preparation for the next use.

[0107] b. Preservation of strains: If it is necessary to preserve engineered strains, samples can be taken from the fermentation broth and frozen in glycerol at -80°C.

[0108] The lactic acid nisin produced using the above method can reach 24000±300 IT / mL, which is the highest known production level of lactococcus lactis.

[0109] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A type of lactic acid probiotic, characterized in that, The 16S rDNA sequence of the lactococcus lactis is shown in SEQ ID NO.

1.

2. An expression box, characterized in that, The expression cassette is composed of a promoter of the sequence shown in SEQ ID NO. 3, a nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO. 6, and a terminator of the sequence shown in SEQ ID NO. 7, connected sequentially.

3. The expression box according to claim 2, characterized in that, The nucleic acid molecule sequence is shown in SEQ ID NO.

5.

4. Engineered bacteria, characterized in that, The engineered bacteria described herein are modified from the Lactococcus lactis of claim 1 as follows: (1) Insert between the sequences shown in SEQ ID NO. 8 and between the sequences shown in SEQ ID NO. 9 The expression cassette according to any one of claims 2-3 is provided, wherein the expression cassette according to any one of claims 2-3 is inserted between bases 814-988 of SEQ ID NO. 10; (2) The EndogenoTs Plasmid2 and EndogenoTs Plasmid3 plasmids in Lactococcus lactis were eliminated; Optionally, the engineered bacteria is a strain with the preservation number CCTCC NO: M2026039.

5. The engineered bacteria according to claim 4, characterized in that, The method for eliminating Plasmid3 and Plasmid4 plasmids in Lactococcus lactis is to interfere with the function of the RepB gene, the sequence of which is shown in SEQ ID NO. 24 and SEQ ID NO.

25.

6. The method for preparing engineered bacteria according to any one of claims 4-5, characterized in that, The method involves expressing the protein shown in SEQ ID NO. 18 and the RNA shown in SEQ ID NO. 19-23 in the *Lactococcus lactis* of claim 1, while simultaneously introducing the following three nucleic acid fragments: i: A nucleic acid fragment formed by sequentially linking the expression cassette according to any one of claims 4-5 and SEQ ID NO. 13; ii: A nucleic acid fragment formed by sequentially linking the expression cassette according to any one of claims 4-5 and SEQ ID NO. 15; iii: A nucleic acid fragment formed by sequentially linking the expression cassette according to any one of claims 4-5 and SEQ ID NO. 17; Select strains that have been identified as meeting the characteristics of the engineered bacteria described in any one of claims 4-5.

7. A microbial agent, characterized in that, The bacterial agent contains at least one of the following: Lactococcus lactis as described in claim 1, or engineered bacteria as described in any one of claims 4-5, or their culture, metabolites, exosomes, or fermentation products.

8. A method for producing nisin, characterized in that, The engineered bacteria according to any one of claims 4-5 are fermented and cultured, and nisin is collected after 24 hours of fermentation. The culture medium used for fermentation is formulated as follows: 20 g / L sucrose + 3 g / L~9 g / L corn steep liquor + 15 g / L yeast extract + 15 g / L tryptone + 20 g / L potassium dihydrogen phosphate + 2.6 g / L L-cysteine ​​+ 1.5 g / L sodium chloride + 0.15 g / L magnesium sulfate heptahydrate; the pH of the fermentation medium is 6.8~8.8; and the fermentation temperature is 20℃~37℃.

9. The method according to claim 8, characterized in that, The fermentation medium has a pH of 7.8, and the fermentation temperature is 30°C.

10. The use of the *Lactococcus lactis* of claim 1, or the expression cassette of any one of claims 2-3, or the engineered bacteria of any one of claims 4-5, or the method of claim 6, or the bacterial agent of claim 7, or the method of any one of claims 8-9 in the production of nisin.