Oligonucleotide delivery ligand compounds, conjugates and uses thereof

By designing ligand compounds and oligonucleotide conjugates, the challenge of delivering small nucleic acid drugs to extrahepatic tissues, especially the eye and nerve tissues, has been solved, achieving effective drug delivery and therapeutic effects.

CN121930274APending Publication Date: 2026-04-28RIGERNA THERAPEUTICS (BEIJING) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610031908.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-01-23
Filing Date
2026-01-12
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Existing technologies struggle to effectively deliver small nucleic acid drugs to extrahepatic tissues such as the eye, white adipose tissue, and nerve tissue, especially the eye.

Method used

A ligand compound and a conjugate are provided to enhance the delivery capability of small nucleic acid drugs in these tissues by conjugation with oligonucleotides, specifically including the conjugation of a ligand compound with a specific structure to a drug active molecule to form a conjugate with a specific structure.

Benefits of technology

It has achieved efficient delivery of small nucleic acid drugs in extrahepatic tissues, especially improving the delivery capability to ocular, adipose and nerve tissues, which can alleviate or treat pathological conditions caused by abnormal expression of specific genes in tissue cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121930274A_ABST
    Figure CN121930274A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of small nucleic acid drug targeted delivery, and particularly provides an oligonucleotide delivery ligand compound, a conjugate and application thereof. The ligand compound provided by the invention has the effect of improving the delivery capacity of oligonucleotide in extrahepatic tissues such as eye tissues, adipose tissues, nervous tissues and skeletal muscle tissues, and can effectively deliver siRNA drugs to target tissues; it is helpful to alleviate, prevent and / or treat pathological conditions or diseases caused by abnormal expression of specific genes in tissue cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure belongs to the field of small nucleic acid drug targeted delivery technology, and specifically discloses an oligonucleotide delivery ligand compound, conjugate and their uses. Background Technology

[0002] Small nucleic acid drugs have demonstrated broad application potential in various disease areas. However, they still face a number of technical and application challenges, such as how to effectively deliver them to extrahepatic tissues (e.g., ocular tissue, white adipose tissue, skeletal muscle tissue, and nerve tissue), especially ocular tissue. Therefore, there is still a need in the field to develop more suitable delivery systems to more effectively deliver small nucleic acid drugs to these extrahepatic tissues. Summary of the Invention

[0003] This disclosure provides a ligand compound, conjugate, and uses thereof for oligonucleotide delivery.

[0004] In a first aspect, this disclosure provides a ligand compound for oligonucleotide delivery, having the structure shown in formula (I), or a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof: (I) R1 is selected from H or hydroxyl protecting groups; In some embodiments of this disclosure, the hydroxyl protecting group is selected from triphenylmethyl, 4-methoxytriphenylmethyl, 4,4'-dimethoxytriphenylmethyl, or 4,4',4''-trimethoxytriphenylmethyl.

[0005] In some embodiments of this disclosure, the hydroxyl protecting group is selected from 4,4',4''-trimethoxytriphenylmethyl.

[0006] In some embodiments of this disclosure, R2 is selected from H, reactive phosphorus groups, or -C(O)-R. 2a -C(O)-R 2b Among them, R 2a Selected from C 1-6 Alkylene, C 2-6 imide or C 2-6 Ethyne group; R 2b Selected from -OH or -NH- solid supports; and R1 and R2 are not both H.

[0007] In some embodiments of this disclosure, the reactive phosphorus group is selected from... or .

[0008] In some embodiments of this disclosure, the R 2aSelected from -CH2CH2-; R 2b Selected from -OH or , Represents resin or glass beads with controllable pore size.

[0009] In some embodiments of this disclosure, p and q are each independently selected from 0, 1, 2 or 3.

[0010] In some embodiments of this disclosure, each R3 is independently selected from H, deuterium, halogen, C. 1-6 Alkyl or C 1-6 Halogenated alkyl groups.

[0011] In some embodiments of this disclosure, all R3s are H.

[0012] In some embodiments of this disclosure, m is selected from integers from 0 to 9 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, or 9).

[0013] In some embodiments of this disclosure, m is 9.

[0014] In some embodiments of this disclosure, L1 is selected from -C(O)-, -C(O)O-, -C(O)NH-, or any combination thereof.

[0015] In some embodiments of this disclosure, L1 is selected from -C(O)-.

[0016] In some embodiments of this disclosure, each R4 is independently selected from substituted or unsubstituted C. 1-10 Alkylene, C 2-10 imide or C 2-10 Ethyne group; wherein the R4 group may optionally contain one or more of the following substituents: C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl groups, amide groups, halogens, -OH, -SH, -NH2.

[0017] In some embodiments of this disclosure, R4 is selected from C. 1-10 Alkylene.

[0018] In some embodiments of this disclosure, R4 is selected from C. 2-8 Alkylene.

[0019] In some embodiments of this disclosure, R4 is selected from C. 3-7 Alkylene.

[0020] In some embodiments of this disclosure, R4 is selected from C. 4-6 Alkylene.

[0021] In some embodiments of this disclosure, R4 is selected from C5 alkylene groups.

[0022] In some embodiments of this disclosure, L2 is selected from chemical bonds, -O-, -NH-, -C(O)-, -NHC(O)-, -C(O)NH-, , Or any combination of at least two of the said substituents.

[0023] In some embodiments of this disclosure, L2 is selected from chemical bonds, -NHC(O)-, -C(O)NH-, or .

[0024] In some embodiments of this disclosure, L2 is selected from chemical bonds, -NHC(O)-, or -C(O)NH-.

[0025] In some embodiments of this disclosure, L2 is selected from -NHC(O)-.

[0026] In some embodiments of this disclosure, n is selected from 0, 1, 2 or 3.

[0027] In some embodiments of this disclosure, n is selected from 0, 1, or 2.

[0028] In some embodiments of this disclosure, n is selected from 0 or 1.

[0029] In some embodiments of this disclosure, n is selected from 0, and the ligand compound has the structure shown in formula (IA), or a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof: (IA).

[0030] In some embodiments of this disclosure, n is selected from 1, and the ligand compound has the structure shown in formula (IB), or a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof: (IB).

[0031] In some embodiments of this disclosure, n1 is selected from an integer between 1 and 6 (e.g., 1, 2, 3, 4, 5 or 6), preferably 4, 5 or 6.

[0032] In some embodiments of this disclosure, R5 is selected from C-type carbon containing 1 to 6 unsaturated bonds. 6-30 Unsaturated hydrocarbon groups (e.g., C) 6-30 Alkenes or C 6-30 Alkynes, etc. The hydrogen atom in R5 may optionally be replaced by one or more substituents selected from the following: C 1-6 Alkyl, C 1-6Alkoxy, C 1-6 Halogenated alkyl, amino, amide, halogen, -OH, -SH, -NHC(O)-R a or -C(O)NH-R a R a Selected from deuterium, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkenyl group.

[0033] In some embodiments of this disclosure, R5 is selected from the following alkenes containing 1, 2, 3, 4, 5, or 6 carbon-carbon double bonds: C 10-29 Olefins, C 10-28 Olefins, C 10-27 Olefins, C 10-26 Olefins, C 10-25 Olefins, C 10-24 Olefins, C 10-23 Olefins, C 10-22 Olefins, C 10-21 Olefins, C 10-20 Olefins, C 10-19 Olefins, C 10-18 Olefins, C 10-17 Olefins, C 11-30 Olefins, C 11-29 Olefins, C 11-28 Olefins, C 11-27 Olefins, C 11-26 Olefins, C 11-25 Olefins, C 11-24 Olefins, C 11-23 Olefins, C 11-22 Olefins, C 11-21 Olefins, C 11-20 Olefins, C 11-19 Olefins, C 11-18 Olefins, C 11-17 Olefins, C 12-30 Olefins, C 12-29 Olefins, C 12-28 Olefins, C 12-27 Olefins, C 12-26 Olefins, C 12-25 Olefins, C 12-24 Olefins, C 12-23 Olefins, C 12-22 Olefins, C 12-21 Olefins, C 12-20 Olefins, C 12-19 Olefins, C 12-18 Olefins, C 12-17 Olefins, C 13-30 Olefins, C 13-29 Olefins, C 13-28 Olefins, C 13-27 Olefins, C 13-26Olefins, C 13-25 Olefins, C 13-24 Olefins, C 13-23 Olefins, C 13-22 Olefins, C 13-21 Olefins, C 13-20 Olefins, C 13-19 Olefins, C 13-18 Olefins, C 13-17 Olefins, C 14-30 Olefins, C 14-29 Olefins, C 14-28 Olefins, C 14-27 Olefins, C 14-26 Olefins, C 14-25 Olefins, C 14-24 Olefins, C 14-23 Olefins, C 14-22 Olefins, C 14-21 Olefins, C 14-20 Olefins, C 14-19 Olefins, C 14-18 Olefins, C 14-17 Olefins, C 15-30 Olefins, C 15-29 Olefins, C 15-28 Olefins, C 15-27 Olefins, C 15-26 Olefins, C 15-25 Olefins, C 15-24 Olefins, C 15-23 Olefins, C 15-22 Olefins, C 15-21 Olefins, C 15-20 Olefins, C 15-19 Olefins, C 15-18 Olefins, C 15-17 Olefins, C 16-30 Olefins, C 16-29 Olefins, C 16-28 Olefins, C 16-27 Olefins, C 16-26 Olefins, C 16-25 Olefins, C 16-24 Olefins, C 16-23 Olefins, C 16-22 Olefins, C 16-21 Olefins, C 16-20 Olefins, C 16-19 Olefins, C 16-18 Olefins, C 16-17 Olefins, C 17 Olefins.

[0034] In some embodiments of this disclosure, R5 is selected from C atoms containing 1-6 carbon-carbon double bonds. 12-24 Olefins.

[0035] In some embodiments of this disclosure, R5 is selected from C atoms containing 1-4 carbon-carbon double bonds. 12-22 Olefins; In some embodiments of this disclosure, R5 is selected from C atoms containing 1-3 carbon-carbon double bonds. 14-22 Olefins; In some embodiments of this disclosure, R5 is selected from C atoms containing 1-2 carbon-carbon double bonds. 14-20 Olefins; In some embodiments of this disclosure, R5 is selected from C atoms containing one or two carbon-carbon double bonds. 16-20 Straight-chain olefins.

[0036] In some embodiments of this disclosure, R5 is selected from C containing 1-4 unsaturated bonds. 12-C22 Olefins (preferably C) 15 Olefins, C 16 Olefins, C 17 Olefins, C 18 Olefins, C 19 Olefins, C 20 Olefins, C 21 Olefins, C 22 (olefins).

[0037] In some embodiments of this disclosure, R5 is selected from C atoms containing one, two, or three carbon-carbon double bonds. 14-20 Olefins; In some embodiments of this disclosure, R5 is selected from C atoms containing one or two carbon-carbon double bonds. 16-20 Straight-chain olefins.

[0038] In some embodiments of this disclosure, the R5 structure is Where n2 is selected from integers between 0 and 8 (preferably 0, 1, 2, 3, 7, 8); n3 is selected from integers between 1 and 6 (preferably 1, 2, 3, 5, 6); and n4 is selected from integers between 0 and 11 (preferably 0, 1, 2, 3, 4, 5, 6, 8, 9, 10, 11).

[0039] In some embodiments of this disclosure, n2=7, n3=1, and n4=6.

[0040] In some embodiments of this disclosure, n2=8, n3=1, and n4=4.

[0041] In some embodiments of this disclosure, n2=8, n3=1, and n4=6.

[0042] In some embodiments of this disclosure, n2=0, n3=1, and n4=11.

[0043] In some embodiments of this disclosure, n2=7, n3=2, and n4=3.

[0044] In some embodiments of this disclosure, n2=7, n3=3, and n4=0.

[0045] In some embodiments of this disclosure, n2=3, n3=5, and n4=0.

[0046] In some embodiments of this disclosure, n2=2, n3=6, and n4=0.

[0047] In some specific embodiments of this disclosure, R5 is selected from the following groups: , , , , , , , ; The hydrogen atom in R5 may optionally be replaced by one or more substituents selected from the following: C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl, amino, amide, halogen, -OH.

[0048] In specific embodiments of this disclosure, the ligand compound is selected from any of the structures shown below, or their tautomers, stereoisomers, or pharmaceutically acceptable salts thereof: , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , ; in, Represents a solid-phase carrier.

[0049] In a second aspect, this disclosure provides a conjugate comprising a pharmaceutically active molecule and a ligand compound described in the first aspect of this disclosure conjugated and linked to the pharmaceutically active molecule.

[0050] In some embodiments of this disclosure, the conjugate has the structure shown in formula (II), or a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof: (II) Among them, two " "Each independently represents a linking site connecting the active drug molecule or a linking site connecting a hydrogen atom, and at least one" " represents the linking site that connects to the active drug molecule; p, q, R3, m, L1, n, R4, L2, R5 are as defined in the first aspect of this disclosure.

[0051] In some embodiments of this disclosure, the pharmaceutically active molecule is selected from small molecule drugs, antibodies, or oligonucleotides.

[0052] In some embodiments of this disclosure, the active pharmaceutical molecule is selected from oligonucleotides, and the oligonucleotides are selected from one or more combinations of small interfering RNA (siRNA), small activating RNA (saRNA), short hairpin RNA (shRNA), antisense oligonucleotides (ASO), microRNA (microRNA or miRNA), anti-microRNA, antimir, supermir, antagomir, ribozymes, triplet oligonucleotides, decoy oligonucleotides, splice switch oligonucleotides, immunostimulatory oligonucleotides, RNA activators, U1 adaptors, and CRISPR-Cas.

[0053] In some embodiments of this disclosure, the oligonucleotide is selected from single-stranded oligonucleotides or double-stranded oligonucleotides.

[0054] In some embodiments of this disclosure, the single-chain oligonucleotide is selected from ASO.

[0055] In some embodiments of this disclosure, the double-stranded oligonucleotide is selected from siRNA, saRNA, or shRNA. In some specific embodiments of this disclosure, the double-stranded oligonucleotide is selected from siRNA.

[0056] In some embodiments of this disclosure, the conjugate has any of the following structures, or tautomers, or stereoisomers, or pharmaceutically acceptable salts thereof: , , , , , , , , , , , , , , , .

[0057] The two “ in the above structure” "Each independently represents a linking site connecting the active drug molecule or a linking site connecting a hydrogen atom, and at least one" "Represents the linking site that connects to the active drug molecule."

[0058] In some embodiments of this disclosure, one or more ligand compounds described in the first aspect are attached to the 5' end of the sense strand of the double-stranded oligonucleotide, and / or the 3' end of the sense strand, and / or the 3' end of the antisense strand. In other embodiments of this disclosure, one or more ligand compounds described in the first aspect are attached to the 5' end of the sense strand and / or the 3' end of the sense strand.

[0059] In some embodiments of this disclosure, the 5' end and / or 3' end of the positive chain are respectively connected to one or two ligand compounds described in the first aspect.

[0060] In some embodiments of this disclosure, the pharmaceutically active molecule is selected from double-stranded oligonucleotides, which include a sense strand and an antisense strand, each strand having 14-30 nucleotides, and the antisense strand contains a sequence complementary to the bases of the sense strand and the target mRNA; wherein the sense strand and / or antisense strand contains one or more ligand compounds as described in the first aspect of this disclosure.

[0061] In some embodiments of this disclosure, the conjugate has the structure shown in formula (III), or a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof: (III).

[0062] In some embodiments of this disclosure, the oligonucleotide conjugate has the structure shown in formula (ⅢA), or a tautomer thereof, or a stereoisomer thereof, or a pharmaceutically acceptable salt thereof: (ⅢA).

[0063] In some embodiments of this disclosure, the oligonucleotide conjugate has the structure shown in formula (ⅢB), or a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof: (ⅢB).

[0064] in, The terms represent double-stranded oligonucleotides, SS represents the sense strand of the double-stranded oligonucleotide, and AS represents the antisense strand of the double-stranded oligonucleotide; Z1 and Z2 each independently represent a hydroxyl or a thiol group; j1 and j2 each independently select an integer from 0 to 3 (e.g., 0, 1, 2 or 3), and j1 + j2 ≥ 1; p, q, R3, m, L1, n, R4, L2, R5, n1 are as defined in the first aspect of this disclosure.

[0065] In some embodiments of this disclosure, j1 and j2 are each independently selected from integers between 0 and 1, and j1 + j2 ≥ 1.

[0066] In some specific embodiments of this disclosure, j1=1, j2=0.

[0067] In some specific embodiments of this disclosure, j1=0, j2=1.

[0068] In some specific embodiments of this disclosure, j1=1, j2=1.

[0069] In some embodiments of this disclosure, the 5' end of the antisense chain is coupled with a 5'-terminal phosphorylation modification group; the 5'-terminal phosphorylation modification group is selected from 5'-(E)-vinylphosphonate (5'-(E)-VP) modification, 5'-methylphosphonate (5'-MP) modification, (S)-5'-C-methyl analog modification and 5'-thiophosphate (5'-PS) modification or analogs thereof.

[0070] Thirdly, this disclosure provides the use of the ligand compound described in the first aspect of this disclosure and / or the oligonucleotide conjugate described in the second aspect of this disclosure in the preparation of a medicament for treating and / or preventing pathological conditions or diseases caused by the abnormal expression of specific genes in tissue cells.

[0071] In some embodiments of this disclosure, the tissue cells include at least one of ocular cells, adipocytes (e.g., gonadal white adipose tissue cells, subcutaneous adipocytes, etc.), skeletal muscle cells (e.g., biceps brachii cells, quadriceps femoris cells, triceps femoris cells, etc.) or neural tissue (CNS) cells.

[0072] In some embodiments of this disclosure, the tissue cells are selected from ocular cells, adipocytes, or nerve tissue cells.

[0073] Fourthly, this disclosure provides a pharmaceutical composition comprising the ligand compound described in the first aspect of this disclosure and / or the oligonucleotide conjugate described in the second aspect of this disclosure, and one or more pharmaceutically acceptable carriers or excipients.

[0074] Fifthly, this disclosure provides a method for inhibiting the expression of a specific gene in a cell, the method comprising contacting the relevant cells with a ligand compound described in the first aspect of this disclosure, and / or an oligonucleotide conjugate described in the second aspect of this disclosure, and / or a pharmaceutical composition described in the third aspect of this disclosure.

[0075] In some embodiments of this disclosure, the cells include at least one of ocular cells, adipocytes, skeletal muscle cells, or CNS cells.

[0076] This disclosure provides an oligonucleotide delivery ligand compound that enhances the delivery of oligonucleotides to extrahepatic tissues such as ocular tissue, adipose tissue, nerve tissue, and skeletal muscle tissue. This compound can effectively deliver siRNA drugs to target tissues and help alleviate, prevent, and / or treat pathological conditions or diseases caused by the abnormal expression of specific genes in tissue cells. Attached Figure Description

[0077] Figure 1This refers to the relative mRNA expression levels of the target gene TTR in the retinal tissue of C57BL / 6j mice after administration of siRNA conjugates R687001 and R687002, respectively.

[0078] Figure 2 This refers to the relative mRNA expression levels of the target gene TTR in the choroid and sclera tissues of C57BL / 6j mice after administration of siRNA conjugates R687001 and R687002, respectively. Detailed Implementation

[0079] Those skilled in the art can refer to the content of this document to appropriately improve the process parameters. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this disclosure. The methods and applications of this disclosure have been described through preferred embodiments, and those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this disclosure to implement and apply the technology of this disclosure.

[0080] Terminology Explanation In this disclosure, the terms “comprising” or “including” are open-ended expressions, meaning that they include the contents specified in this disclosure but do not exclude other contents.

[0081] In this disclosure, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0082] In this disclosure, the term "optionally substituted" is used to define a variable that may be unsubstituted or substituted.

[0083] In this disclosure, the term "unsubstituted" means that the specified group does not contain substituents.

[0084] In this disclosure, the terms “substituted,” “substituted,” and “replaced” are used interchangeably to indicate that any one or more hydrogen atoms in the given structure are specifically substituented (e.g., C). 1-3 Alkyl, C 1-3 The substituted group may be replaced by an alkoxy or halogen group, provided that the normal valence of the specified atom does not exceed the valence of the substituted atom and the substitution produces a stable compound. Unless otherwise indicated, a substituted group may have one substituent at each substituted position of the group. When more than one position in the given structural formula can be substituted by one or more substituents selected from a particular group, then the substituents may be substituted at each substituted position in the same or different manner.

[0085] In this disclosure, when listing numerical ranges, each value and subranges within the range are implicitly included. For example, "C 1-6 Alkyl groups include C1, C2, C3, C4, C5, C6, and C6. 1-6 C 1-5 C 1-4 C 1-3 C 1-2 C 2-6 C 2-5 C 2-4 C 2-3 C 3-6 C 3-5 C 3-4 C 4-6 C 4-5 and C 5-6 alkyl.

[0086] In this disclosure, "C" 1-6 "Alkyl" refers to a straight-chain or branched saturated hydrocarbon group having 1-6 carbon atoms. 6-30 "Alkyl" refers to a straight-chain or branched saturated hydrocarbon group having 1-30 carbon atoms. 1-6 Alkyl groups, for example, include: methyl (C1), ethyl (C2), n-propyl (C3), isopropyl (C3), n-butyl (C4), tert-butyl (C4), sec-butyl (C4), isobutyl (C4), n-pentyl (C5), 3-pentyl (C5), pentyl (C5), neopentyl (C5), 3-methyl-2-butyl (C5), tert-pentyl (C5), and n-hexyl (C6). The term "C" is used in conjunction with the alkyl group. 1-6 "Alkyl" also includes heteroalkyl groups, wherein one or more (e.g., 1, 2, 3 or 4) carbon atoms are replaced by heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus), and the alkyl group may be substituted by one or more substituents.

[0087] In this disclosure, "C" 6-30 "Alkene" refers to a straight-chain or branched hydrocarbon group having 6-30 carbon atoms and at least one carbon-carbon double bond. The alkene group may be substituted by one or more substituents, for example, by 1-5 substituents, 1-3 substituents or 1 substituent.

[0088] In this disclosure, "C" 1-10 "alkylene" refers to the alkylene group after removing C 1-10The alkylene group is a divalent group formed by the other hydrogen atom of an alkyl group, and may be substituted or unsubstituted. Unsubstituted alkylene groups include, but are not limited to: methylene (-CH2-), ethylene (-CH2CH2-), propylene (-CH2CH2CH2-), butylene (-CH2CH2CH2CH2-), pentylene (-CH2CH2CH2CH2CH2-), hexylene (-CH2CH2CH2CH2CH2CH2-), etc. Exemplary substituted alkylene groups include, but are not limited to: alkylene groups substituted with one or more alkyl groups (such as methyl).

[0089] In this disclosure, the terms “each…independently selected”, “…independently selected”, and “…independently selected” are interchangeable and should be interpreted broadly. They can mean that the specific options expressed by the same symbols in different groups do not affect each other, or that the specific options expressed by the same symbols in the same group do not affect each other.

[0090] In this disclosure, the term "stereoisomer" refers to compounds having the same chemical structure but with different spatial arrangements of atoms or groups. Stereoisomers include enantiomers, diastereomers, conformational isomers (rotational isomers), geometrical isomers (cis / trans) isomers, hindered isomers, and so on.

[0091] In this disclosure, the term "chirality" refers to a molecule that has the property of not being superimposed on its mirror image; while "chirality" refers to a molecule that is superimposed on its mirror image.

[0092] In this disclosure, the term "enantiomer" refers to two non-overlapping but mirror-image isomers of a compound.

[0093] In this disclosure, the term "diastereomer" refers to a stereoisomer that has two or more chiral centers and whose molecules are not mirror images of each other. Diastereomers have different physical properties, such as melting point, boiling point, spectral properties, and reactivity. Mixtures of diastereomers can be separated by high-resolution analytical operations such as electrophoresis and chromatography, for example, HPLC.

[0094] In this disclosure, the term "tautomer" refers to a functional group isomer resulting from the rapid movement of an atom in a molecule between two positions. For example, a compound containing a carbonyl group exhibits enol tautomerism if its carbonyl carbon has a hydrogen atom at the adjacent (α-position).

[0095] In this disclosure, the term "pharmaceutically acceptable salt" includes pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

[0096] In this disclosure, the term "double-stranded oligonucleotide" refers to a double-stranded structure formed by two oligonucleotides through partial or complete base pairing. The two oligonucleotides include a sense strand and an antisense strand, which may or may not be of the same length. As long as at least some base-pairing regions exist to form a double-stranded region, the oligonucleotide having a double-stranded structure is considered a double-stranded oligonucleotide as described in this disclosure. The nucleotides constituting the double-stranded oligonucleotide in this disclosure can be modified or unmodified nucleotides. When referring to modified nucleotides, unless otherwise specified, the modification does not specifically refer to the modified site. In addition to the modification of the nucleotides, the linking bonds between the nucleotides in the double-stranded oligonucleotide in this disclosure may also be modified. Double-stranded oligonucleotides containing modified linking bonds between nucleotides are also considered double-stranded oligonucleotides as described in this invention. Besides the nucleotide portion, the double-stranded oligonucleotide in this disclosure may also contain compounds or modifiers acceptable in the art to improve the properties of the double-stranded oligonucleotide, such as linking ligands to form conjugates.

[0097] In this disclosure, the terms "ligand" or "ligand compound" or "carrier" refer to an atom or group of atoms bound to an oligonucleotide or other oligomer. Generally, a conjugating group modifies one or more properties of the compound to which it is attached, including but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge, and / or clearance properties. When referring to a link between two molecules, the term "link" as used herein means that the two molecules are directly or indirectly connected by a covalent bond, or that the two molecules are associated by a non-covalent bond (e.g., a hydrogen bond or an ionic bond).

[0098] In this disclosure, the terms "pharmaceutical composition" or "composition" can refer to something used for the treatment of a disease or for use in in vitro cell culture experiments. When used for the treatment of a disease, the term "pharmaceutical composition" generally refers to a unit dose form and can be prepared by any method well known in the pharmaceutical industry. All methods involve the step of combining the active ingredient with excipients constituting one or more adjunct components. Typically, compositions are prepared by uniformly and adequately combining active siRNA with liquid excipients, finely pulverized solid excipients, or both.

[0099] In this disclosure, the term "pharmaceutical acceptable" means that a substance or composition must be chemically and / or toxicologically compatible with other components of the formulation and / or the mammals to which it is treated. Preferably, "pharmaceutical acceptable" as used in this disclosure means approved by a federal regulatory agency or national government, or listed in the United States Pharmacopeia or other generally recognized pharmacopoeia for use in animals, particularly in humans.

[0100] In this disclosure, the term "pharmaceutically acceptable carrier or excipient" may include any solvent, solid excipient, diluent, or other liquid excipient, etc., suitable for a specific target dosage form. The use of any conventional excipients that are incompatible with the siRNA of this disclosure, such as those that produce any adverse biological effects or interactions with any other component of the pharmaceutically acceptable composition in a harmful manner, is also within the scope of this disclosure.

[0101] In this disclosure, the term "small interfering RNA (siRNA)" is a double-stranded RNA of 17 to 25 nucleotides in length, comprising a sense strand and an antisense strand. siRNA mediates targeted cleavage of RNA transcripts via the RISC pathway by forming an RNA-induced silencing complex (RISC). Specifically, siRNA directs the specific degradation of mRNA sequences through a known RNA interference (RNAi) process, inhibiting the translation of mRNA into amino acids and its conversion into proteins.

[0102] In this disclosure, the terms “treatment,” “relief,” or “improvement” are used interchangeably. These terms refer to methods of achieving beneficial or desired outcomes, including, but not limited to, treatment benefits. A “treatment benefit” means the eradication or improvement of the underlying disorder being treated. Here, a treatment benefit is achieved by eradicating or improving one or more physical symptoms associated with the underlying disorder, thereby observing improvement in the subject, although the subject may still be suffering from the underlying disorder.

[0103] In this disclosure, the terms “prevention” and “avoidance” are used interchangeably to refer to methods for obtaining beneficial or desired results, including but not limited to preventive benefits. To obtain a “preventive benefit,” the conjugate or composition may be given to a subject at risk of developing a specific disease, or to a subject who reports one or more physiological symptoms of a disease, even if a diagnosis of the disease may not have been made.

[0104] In this disclosure, the term "administration" generally refers to the introduction of a pharmaceutical preparation of this disclosure into the body of a subject by any route of introduction or delivery. Any method known to those skilled in the art for contacting cells, organs, or tissues with the drug may be employed. Administration may include, but is not limited to, intravenous, intra-arterial, intranasal, intraperitoneal, intramuscular, subcutaneous, or oral administration. A daily dose may be divided into one, two, or more doses in suitable forms to be administered at one, two, or more times during a period of time.

[0105] In addition to any conventional excipients, the use of any range of siRNAs incompatible with the present disclosure, such as any adverse biological effects produced or interactions with any other component of a pharmaceutically acceptable composition in a harmful manner, is also within the scope of this disclosure.

[0106] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below with reference to examples.

[0107] Biological testing experiments Unless otherwise stated, all siRNAs used in this disclosure were synthesized by Suzhou Beixin Biotechnology Co., Ltd.

[0108] Unless otherwise stated, the synthesis of all PCR primers used in this disclosure was outsourced to Beijing Qingke Biotechnology Co., Ltd. Unless otherwise stated, all experimental animals, C57BL / 6J mice, used in this disclosure were purchased from Spiford (Beijing) Biotechnology Co., Ltd.

[0109] Unless otherwise stated, all reagents, consumables, and instruments used in this disclosure are commercially available. Specifically, the CPG carrier used in this disclosure (also known as aminosilanized CPG, model C3006-1000, particle size 100-200 mesh, loading 80 μmol / g) was purchased from Beijing Coupling Technology Co., Ltd. The CPG carrier is denoted as... ; This represents glass spheres with controllable pore size (CPG). The main sources of reagents and consumables are shown in Table 1, and the main sources of instruments and equipment are shown in Table 2.

[0110] Table 1 Main Reagents and Consumables Table 2 Main Instruments and Equipment Preparation Example 1: Synthesis of compounds LD311, LD311D, and LD311Z: In this preparation example, the synthetic routes for compounds LD311, LD311D, and LD311Z are shown below: (1-1) Synthesis of compound LD311-2: Compound LD311-1 (5.5 g, 28.1 mmol, 1.0 eq, CAS No. 2408968-41-0) and saturated sodium bicarbonate aqueous solution (15 ml) were added to a 1,4-dioxane (50 ml) solution. Then, a 1,4-dioxane solution (10 ml) of fluorenyl chloroformate (7.9 g, 42.1 mmol, 1.5 eq, English name Fmoc-Cl, CAS No. 28920-43-6) was added dropwise under ice bath conditions. After the addition was complete, the mixture was stirred at 25 °C for 12 hours until the reaction was complete. The reaction solution was concentrated under reduced pressure, and extracted with 50 mL of ethyl acetate and 30 mL of water to obtain the organic phase. The organic phase was dried over anhydrous sodium sulfate and filtered. The organic phase was purified by normal-phase column chromatography (elution: methanol / dichloromethane = 6 / 94, v / v) to give a pale yellow solid, LD311-2 (6.7 g, yield 65%), which was used directly in the next reaction without further purification. MS ESI (m / z) = 382 [M + H] + . (1-2) Synthesis of compound LD311-3: Compound LD311-2 (6.7 g, 17.5 mmol, 1.0 eq) was dissolved in 40 mL of pyridine. 4,4'-bismethoxytriphenylmethyl chloride (6.5 g, 26.25 mmol, 1.5 eq, abbreviated as DMTrCl, CAS No. 40615-36-9) was added under ice bath conditions. The reaction was carried out at 25 °C for 12 hours, and then quenched with 20 mL of methanol. The reaction mixture was concentrated under reduced pressure and extracted three times with ethyl acetate (20 mL each time). The mixture was purified by normal-phase column chromatography (elution: ethyl acetate / petroleum ether = 28 / 72, v / v) to give compound LD311-3 (7.6 g, yield 65%) as a pale yellow solid. MS ESI (m / z) = 683 [M + H] + . (1-3) Synthesis of compound LD311-4: Compound LD311-3 (3.7 g, 5.42 mmol, 1.0 eq) was dissolved in 15 mL of acetonitrile, and 10 mL of tetrahydropyrrole was added. The mixture was stirred at 25 °C for 1 hour until the reaction was complete. The reaction solution was concentrated under reduced pressure and purified by normal-phase column chromatography (eluent: methanol / dichloromethane containing 1% ammonia = 5 / 95, v / v) to give compound LD311-4 (1.8 g, 90% yield) as a white solid. MS ESI (m / z) = 462 [M + H] + . (1-4) Synthesis of compound LD311-5: Compound LD311-4 (1.5 g, 1.0 eq), N-benzyloxycarbonyl-6-aminohexanoic acid (1.1 g, 1.2 eq, CAS No. 1947-00-8), and N,N-diisopropylethylamine (1.25 g, 3.0 eq, DIEA) were dissolved in 1 mL of DMF (5 mL). 2-(7-azobenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.6 g, 1.3 eq, HATU) was added, and the mixture was stirred at room temperature under a nitrogen atmosphere for 3 hours until the reaction was complete. The reaction solution was purified by reversed-phase chromatography (elution: acetonitrile / water = 70 / 30, v / v) to give compound LD311-5 (2.2 g, yield 33%) as a white solid. MS ESI (m / z) = 709 [M + H] + . (1-5) Synthesis of compound LD311-6: Compound LD311-5 (2.2 g, 1.0 eq) was dissolved in methanol (15 ml), and Pd / C (220 mg) was added. H2 was bubbled through the solution at room temperature, and the reaction was allowed to proceed for 3 hours until completion. The reaction solution was filtered and concentrated to obtain compound LD311-6. Compound LD311-6 was used directly in the next reaction without purification. MS ESI (m / z) = 574 [M + H] + . (1-6) Synthesis of compound LD311-7: Compound LD311-6 (800 mg, 1.0 eq), oleic acid (470 mg, 1.2 eq, CAS No. 112-80-1), and DIEA (540 mg, 3.0 eq) were dissolved in DMF (15 ml). HATU (690 mg, 1.3 eq) was added, and the mixture was stirred at room temperature under a nitrogen atmosphere for 3 hours until the reaction was complete. The reaction solution was purified by reversed-phase chromatography (eluent: acetonitrile) to give a white oily compound LD311-7 (1 g). MS ESI (m / z) = 839 [M + H] + . (1-7) Synthesis of compound LD311: Compound LD311-7 (400 mg, 1 eq) was dissolved in anhydrous dichloromethane (10 mL), and 4,5-dicyanimidazole (50 mg, 0.8 eq, DCI) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (180 mg, 1.2 eq, CAS No. 102691-36-1) were added separately. The mixture was stirred at room temperature under a nitrogen atmosphere for 2 hours until the reaction was complete. A saturated sodium bicarbonate aqueous solution (20 mL) was added to the reaction solution, and the mixture was extracted three times with dichloromethane (20 mL each time). The organic phases were separated and combined, and then purified by drying, concentration, and reversed-phase chromatography (eluent: acetonitrile / water = 72 / 28, v / v) to obtain a pale yellow oily compound LD311 (380 mg). MS ESI (m / z) = 1038 [M + Na] + . (1-8) Synthesis of compound LD311D: Compound LD311-7 (300 mg, 1 eq) was dissolved in anhydrous dichloromethane (10 mL), and succinic anhydride (100 mg, 3 eq) and TEA (72 mg, 2 eq) were added. The mixture was stirred at room temperature for 12 hours until the reaction was complete. The reaction solution was concentrated and dried, and purified by reversed-phase chromatography (eluent: acetonitrile / water = 95 / 5, v / v) to give compound LD311D (300 mg) as a white solid. MS ESI (m / z) = 938 [M + H] + . (1-9) Synthesis of compound LD311Z: Compound LD311D (20.7 mg, 22 μmol, 1.0 eq) was dissolved in anhydrous acetonitrile (10 mL), and benzotriazole-N,N,N',N'-tetramethylurea hexafluorophosphate (16.6 mg, 2.0 eq, abbreviated as HBTU, CAS No. 94790-37-1), DIEA (31 μL, 4.0 eq), and LCAA-CPG (1000 mg, 74 μol, 3.4 eq) were added. The mixture was purged with nitrogen three times and reacted in a shaker at room temperature for 12 hours. The filter cake was washed three times with acetonitrile (10 mL each time). The filter cake was placed in a 50 mL centrifuge tube, and Cap1 (5.0 mL) and Cap2 (5.0 mL) were added. The mixture was shaken in a shaker at room temperature for 4 hours. The mixture was then filtered and washed three times with acetonitrile (10 mL each time). The mixture was dried under vacuum for 12 hours to obtain a white powder, compound LD311Z (980 mg, yield 96%). The measured loading value was 18.8 μol / g.

[0111] Unless otherwise stated, Cap1 is a pyridine / acetonitrile mixed solution of N-methylimidazolium with a concentration of 20% by volume, wherein the volume ratio of pyridine to acetonitrile is 3:5, and Cap2 is an acetonitrile solution of acetic anhydride with a concentration of 20% by volume.

[0112] Preparation Example 2: Preparation of siRNA conjugates (2-1) Synthesis of the Justice Chain (SS) The phosphoramide solid-phase synthesis method for nucleic acids involves initiating a cycle using a solid support (e.g., compound LD311Z) and sequentially linking nucleoside monomers along the 3'-5' direction according to the nucleotide sequence. During the synthesis, compound LD311 is treated as a single nucleotide.

[0113] Each connection of a nucleoside monomer involves four steps: deprotection, coupling, capping, and oxidation or sulfidation. The synthetic conditions are given below: The nucleoside monomer was prepared into an acetonitrile solution with a concentration of 0.1 M.

[0114] The deprotection reaction conditions were the same for each step. The deprotection reaction conditions were: temperature 25℃, reaction time 70 seconds, deprotection reagent was a dichloroacetic acid solution in dichloromethane (3% by volume), and the molar ratio of dichloroacetic acid to the 4,4'-dimethoxytriphenylmethyl protecting group on the solid support was 5:1.

[0115] The conditions for each coupling reaction were identical. The coupling reaction conditions were as follows: temperature 25℃, molar ratio of nucleic acid sequence to nucleoside monomer on the solid-phase support 1:10, molar ratio of nucleic acid sequence to coupling reagent on the solid-phase support 1:65, reaction time 600 seconds, coupling reagent 0.5M acetonitrile solution of 5-ethylthio-1H-tetrazole, and thioreagent 0.2mol / L acetonitrile / pyridine mixed solution of hydrogenated xanthanin (acetonitrile and pyridine volume ratio 1:1).

[0116] The conditions for each capping reaction were identical. The conditions for the capping reaction were: temperature 25℃; reaction time 2 minutes; the capping reagent solution was a 1:1 molar ratio mixture of Cap1 and Cap2, where Cap1 was a 20% (v / v) N-methylimidazole pyridine / acetonitrile mixture with a pyridine to acetonitrile volume ratio of 3:5, and Cap2 was a 20% (v / v) acetic anhydride acetonitrile solution; the molar ratio of N-methylimidazole in Cap1 and acetic anhydride in Cap2 to the nucleic acid sequence linked on the solid-phase support was 1:1:1.

[0117] The conditions for each oxidation reaction were identical. The oxidation reaction conditions were: temperature 25°C; reaction time 3 seconds; oxidizing agent concentration of 0.05M iodine solution, with a molar ratio of iodine to the nucleic acid sequence linked on the solid support in the coupling reaction of 30:1; the oxidation reaction was carried out in a water / pyridine mixed solvent (water to pyridine volume ratio 1:9). The sulfidation reaction conditions were: temperature 25°C; reaction time 360 ​​seconds; thioreagent concentration of 0.2M hydroflavin in pyridine solution, with a molar ratio of thioreagent to the nucleic acid sequence linked on the solid support in the coupling reaction of 4:1; the thioreagent reaction was carried out in a water / pyridine mixed solvent (water to pyridine volume ratio 1:9).

[0118] After the last nucleoside monomer was ligated, the nucleic acid sequence ligated on the solid-phase support was sequentially cut, deprotected, purified, and desalted, and then freeze-dried to obtain the positive strand, wherein: The cleavage and deprotection conditions were as follows: The synthesized nucleotide sequence linked to a solid-phase support was added to 25% (w / w) ammonia solution at a concentration of 0.5 mL / μmol. The reaction was carried out at 55 °C for 16 hours. The solvent was removed, and the solution was concentrated to dryness under vacuum. After ammonia treatment, the product was dissolved in 0.4 mL / μmol N-methylpyrrolidone relative to the amount of single-stranded nucleic acid. Subsequently, 0.3 mL / μmol triethylamine and 0.6 mL / μmol triethylamine trifluoride were added to remove the 2'-O-TBDMS protection from the ribose.

[0119] Purification and desalting conditions: Nucleic acid purification was performed using a preparative ion chromatography column (Source 15Q) with a NaCl gradient elution. Specifically: eluent 1 was 20 mM sodium phosphate (pH=8.1), and the solvent was a water / acetonitrile mixture (water to acetonitrile volume ratio 9:1); eluent 2 was 1.5 M sodium chloride and 20 mM sodium phosphate (pH=8.1), and the solvent was a water / acetonitrile mixture (water to acetonitrile volume ratio 9:1); the elution gradient was eluent 1: eluent 2 = (100:0) - (50:50). The product eluates were collected and combined, and desalting was performed using a reverse chromatographic purification column. Desalting conditions included using a dextran gel column (g25 packing material) and elution with deionized water.

[0120] Detection: Purity was determined using ion exchange chromatography (IEX-HPLC); molecular weight was determined using liquid chromatography-mass spectrometry (LC-MS). The measured molecular weight was compared with the theoretical value. If the measured value and the theoretical value were consistent, it indicated that the compound was conjugated to the 3' end of the positive strand of siRNA.

[0121] (2-2) Synthesis of antisense strand (AS) The antisense chain was synthesized using a general solid-phase support. The deprotection, coupling, capping, oxidation or sulfidation reaction conditions, cleavage and deprotection conditions, purification and desalting conditions of the solid-phase synthesis method of the antisense chain are the same as those of the synthesis of the sense chain in step (2-1).

[0122] Detection: Purity was determined using ion exchange chromatography (IEX-HPLC); molecular weight was determined using liquid chromatography-mass spectrometry (LC-MS). The measured molecular weight was compared with the theoretical value. If the measured value and the theoretical value were consistent, it indicated that the siRNA antisense strand had been obtained.

[0123] (2-3) Synthesis of siRNA conjugates The sense strand synthesized in step (2-1) and the antisense strand synthesized in step (2-2) were mixed in an equimolar ratio, dissolved in water for injection, and heated to 95°C. The mixture was then slowly cooled to room temperature and kept at room temperature for 10 minutes to allow the sense and antisense strands to form a double-stranded structure through hydrogen bonds, thereby obtaining the siRNA conjugate with the sense and antisense strands shown in Table 3.

[0124] Table 3 Sequence information of siRNA conjugates The unmodified naked nucleotide sequence information for forming the above siRNA conjugate is as follows: Justice chain sequence (5'-3'): AACAGUGUUCUUGCUCUAUAA (SEQ ID NO.5); Antisense sequence (5'-3'): UUAUAGAGCAAGAACACUGUUUU (SEQ ID NO.6).

[0125] Unless otherwise specified, the base composition and modification meanings in this disclosure are as follows: uppercase letters A, U, G, C, and T represent the base composition of nucleotides; lowercase letter m indicates that the nucleotide to its left adjacent uppercase letter is modified with 2'-O-methyl (2'-O-Me); lowercase letter f indicates that the nucleotide to its left adjacent uppercase letter is modified with 2'-fluoro (2'-F); (moe) indicates that the nucleotide to its left adjacent uppercase letter is modified with 2'-O-methoxyethyl (2'-O-MOE); lowercase letter s indicates that the internucleotide bond between two adjacent nucleotides is a phosphate thioester bond. VP indicates that the 5' end phosphorylation modification group of the antisense strand in siRNA is 5'-(E)-vinylphosphonate (5'-(E)-VP).

[0126] The structural formula of (Uhd) is: .

[0127] The structural formula of VPUm is: .

[0128] The structural formula of the nucleotide modified with 2'-O-methyl is .

[0129] The structural formula of the 2'-fluorinated nucleotide is .

[0130] The structural formula of the nucleotide modified with 2'-O-methoxyethyl is: .

[0131] Where Base represents nucleoside A, U, G, C or T.

[0132] LD311Z is located at the 3' end of the justice chain, and its structural formula is: .

[0133] LD311 is located at the 5' end of the justice chain, and its structural formula is: .

[0134] Methods for assessing the inhibitory activity of target genes in the mouse eye Six- to eight-week-old C57BL / 6J mice (all female) were randomly assigned to several experimental groups (including an siRNA conjugate test group and a PBS control group) based on body weight. Mice in each group were administered the drug via unilateral (right-sided) intravitreal injection. In the siRNA conjugate test group, each mouse received PBS buffer containing the siRNA conjugate at a volume of (1-2) μL / mouse and a dose of 7.5 μg (based on siRNA) / mouse. The PBS control group received PBS buffer without the siRNA conjugate at a volume of (1-2) μL / mouse. The day of administration was designated as day 0 (D0). At a predetermined time after administration, five mice from each group were sacrificed, and the eyeballs were enucleated. The retinal, choroid, and scleral tissues were separated, and the tissue samples were preserved using RNA Later.

[0135] RNA Extraction: Tissue samples from different test groups were taken from the RNA later section and placed in 2 mL centrifuge tubes. 1 mL of TRIZOL reagent and a steel ball were added to each tube. The tissue samples were homogenized for 60 seconds using a Tissuelyser II automated tissue homogenizer. The homogenate was then incubated at room temperature for 3 minutes. Subsequently, 200 µL of chloroform was added to each 1 mL TRIZOL sample, and the tube was mixed by hand-tilting. After incubation at room temperature for 3 minutes, the mixture was centrifuged at 4°C and 12,000 rpm for 10 minutes. After separating the aqueous phase, the upper aqueous phase (approximately 400 µL) was transferred to a centrifuge tube containing an equal volume of isopropanol. The mixture was mixed and incubated at room temperature for 10 minutes. The mixture was then centrifuged again at 4°C and 12,000 rpm for 10 minutes to precipitate the RNA. After discarding the supernatant, the precipitate was washed with 1 mL of RNase-free 75% ethanol, followed by centrifugation at 4°C and 12,000 rpm for 5 minutes to remove as much supernatant as possible. After drying the precipitate (air drying at room temperature or vacuum drying for 5-10 minutes), add an appropriate amount of RNase-free water to dissolve the RNA precipitate and store it below -70℃.

[0136] mRNA expression level detection: 1 μg of total RNA was taken and a 20 μL reverse transcription system was prepared using a reverse transcription kit (Promega, Reverse Transcription System, A3500) with Oligo (dT)15 reverse transcription primers, following the instructions of the reverse transcription kit. After the reaction, 80 μL of RNase-free water was added to the reverse transcription system to obtain a cDNA solution. The expression level of the target gene mRNA in the tissue sample was then detected using a real-time quantitative PCR kit (ABI, SYBR™ Select Master Mix, Catalog number: 4472908). In this real-time quantitative PCR method, primers targeting the target gene and primers targeting the internal reference gene were used to detect the target gene and the internal reference gene, respectively. Prepare a 20 μL Real-time PCR reaction system for each PCR well according to the instructions of the Real-time PCR kit. Each reaction system contains 5 μL of cDNA solution obtained from the reverse transcription reaction, 10 μL of SYBR™ Select Master Mix, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, and 4 μL of LNase-Free H2O. Place the prepared reaction system on a Real-time PCR instrument (ABI, StepOnePlus™) and perform Real-time PCR amplification using a three-step method. The amplification program is: 95℃ pre-denaturation for 10 min, followed by 95℃ denaturation for 30 s, 60℃ annealing for 30 s, and 72℃ extension for 30 s. Repeat the denaturation, annealing, and extension process for 40 cycles. In this Real-time PCR method, the ΔΔCt method is used to calculate the relative quantitative levels and inhibition rates of the target gene mRNA in each test group. The calculation method is as follows: ΔCt(test group) = Ct(target gene in test group) – Ct(internal reference gene in test group) ΔCt(control group) = Ct(target gene in control group) – Ct(internal reference gene in control group) ΔCt(test group) = ΔCt(test group) – ΔCt(control group average) ΔCt(control group) = ΔCt(control group) – ΔCt(control group average) Here, ΔCt (control group mean) is the arithmetic mean of the ΔCt (control group) values ​​of the five mice sacrificed at the same time point in the control group. Therefore, each mouse in both the test group and the control group corresponds to a ΔCt value.

[0137] Using the control group as a baseline, the expression level of the target gene mRNA in the test group was normalized, and the expression level of the target gene mRNA in the control group was defined as 100%.

[0138] The relative expression level of the target gene mRNA in the test group = 2 -ΔΔCt (Test group) × 100% The inhibition rate of target gene mRNA expression in the test group = 100% – the relative expression level of target gene mRNA in the test group Unless otherwise stated, all in vivo activity data are expressed as X±STDEV, and all data were plotted and analyzed using GraphPadprism 8.0 software.

[0139] Example 1: Evaluation of the inhibitory activity of siRNA conjugates of LD311 and Uhd vectors on the transthyretin (TTR) gene in the mouse eye. This embodiment uses the "Method for Evaluating the Inhibitory Activity of Target Genes in the Mouse Eye" to evaluate the inhibitory activity of the Uhd vector-conjugated siRNA conjugate R687001 and the LD311 vector-conjugated siRNA conjugate R687002 on the target gene TTR in the mouse eye.

[0140] Six- to eight-week-old C57BL / 6j mice were randomly divided into three groups of five mice each, based on body weight. Each group received the drug via unilateral (right-sided) intravitreal injection. In the PBS control group, each mouse received 1 μL of the drug, while in the siRNA conjugate test group, each mouse received 7.5 μg of the drug (based on siRNA) at a volume of 1 μL. Day 0 (D0) was designated as the day of administration. On day 14 (D14), all five mice in each group were sacrificed, their eyes were enucleated, and the retinas were separated and preserved using RNA later. RNA extraction, reverse transcription, and quantitative real-time PCR were performed as described above. Gene expression differences were calculated using the ΔΔCt method. Primers used are shown in Table 4.

[0141] Table 4 Primer sequence listing: The experimental results of Example 1 show that, for the inhibition of the TTR gene in retinal tissue, the LD311 vector-conjugated siRNA sequence R687002 is slightly superior to the Uhd vector-conjugated siRNA sequence R687001; simultaneously, for the inhibition of the TTR gene in choroidal and scleral tissues, the LD311 vector-conjugated siRNA sequence R687002 is significantly superior to the Uhd vector-conjugated siRNA sequence R687001. Figures 1-2 (Table 5).

[0142] Table 5. Inhibitory activity of the target gene TTR in the retinal, choroidal, and scleral tissues of C57BL / 6j mice after administration of siRNA conjugates R687001 and R687002, respectively, in Example 1. The above specific embodiments are merely illustrative of the present invention and do not represent a limitation thereof. For those skilled in the art, various modifications and improvements can be made without departing from the spirit and substance of this disclosure, and these modifications and improvements are also considered to be within the scope of protection of this disclosure.

Claims

1. A ligand compound for oligonucleotide delivery, characterized in that, The ligand compound has the structure shown in formula (I), or a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof: (I) R1 is selected from H or hydroxyl protecting groups; R2 is selected from H, reactive phosphorus groups, or -C(O)-R. 2a -C(O)-R 2b Among them, R 2a Selected from C 1-6 Alkylene, C 2-6 imide or C 2-6 Ethyne group; R 2b Selected from -OH or -NH- solid supports; and R1 and R2 are not both H; p and q are each independently selected from 0, 1, 2 or 3; m is selected from integers from 0 to 9; Each R3 is independently selected from H, deuterium, halogen, and C. 1-6 Alkyl or C 1-6 Halogenated alkyl groups; L1 is selected from -C(O)-, -C(O)O-, -C(O)NH- or any combination thereof; n is selected from 0, 1, 2, or 3; Each R4 is independently selected from substituted or unsubstituted C4. 1-10 Alkylene, C 2-10 imide or C 2-10 Ethyne group; wherein the R4 group may optionally contain one or more of the following substituents: C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl groups, amide groups, halogens, -OH, -SH, -NH2; L2 is selected from chemical bonds, -O-, -NH-, -C(O)-, -NHC(O)-, -C(O)NH-, , Or any combination of at least two of the said substituents; R5 is selected from C5 containing 1 to 6 unsaturated bonds. 6-30 Unsaturated hydrocarbon groups; The hydrogen atom in R5 may optionally be replaced by one or more substituents selected from the following: C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl, amino, amide, halogen, -OH, -SH, -NHC(O)-Ra or -C(O)NH-Ra, where Ra is selected from deuterium, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkenyl group.

2. The ligand compound according to claim 1, characterized in that, L1 is selected from -C(O)-; L2 is selected from chemical bonds, -NHC(O)-, -C(O)NH-, or ; R5 is selected from C5 atoms containing 1-3 carbon-carbon double bonds. 14-22 Olefins; The hydrogen atom in R5 may optionally be replaced by one or more substituents selected from the following: C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl, amino, amide, halogen, -OH; n is selected from 0, 1, or 2; R4 is selected from C 1-10 Alkylene; m is 9, and R3 is all H.

3. The ligand compound according to claim 2, characterized in that, L2 is selected from chemical bonds, -NHC(O)- or -C(O)NH-; n is selected from 0 or 1; R5 is selected from C atoms containing one or two carbon-carbon double bonds. 14-20 Olefins.

4. The ligand compound according to claim 1, characterized in that, The compound has the structure shown in formula (IB), or a stereoisomer thereof, or a tautomer thereof, or a pharmaceutically acceptable salt thereof: (ONE) n1 is selected from integers from 1 to 6; R1, R2, p, and q are defined in the same way as in equation (I); R5 is selected from C5 containing one or two carbon-carbon double bonds. 16-20 Straight-chain olefins.

5. The ligand compound according to claims 1-4, characterized in that, The ligand compound is selected from any of the structures shown below, or their tautomers, stereoisomers, or pharmaceutically acceptable salts thereof: 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 ; in, Represents a solid-phase carrier.

6. A conjugate, characterized in that, The conjugate comprises a pharmaceutically active molecule and a ligand compound of claims 1-5, or a tautomer thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof, conjugated to the pharmaceutically active molecule. The conjugate comprises the structure shown in formula (II), or its tautomer, its stereoisomer, or its pharmaceutically acceptable salt: (Ⅱ) Among them, two " "Each site independently represents a linking site that connects to the active drug molecule or a linking site that connects to a hydrogen atom, and at least one..." "Represents the linking site that connects to the active drug molecule; p, q, R3, m, L1, n, R4, L2, R5 as defined in any one of claims 1-5; The active pharmaceutical molecule is selected from small molecule drugs, antibodies, or oligonucleotides; The oligonucleotide is selected from single-stranded oligonucleotides or double-stranded oligonucleotides; the single-stranded oligonucleotide is selected from antisense oligonucleotides; the double-stranded oligonucleotide is selected from small interfering RNA, small activating RNA or short hairpin RNA.

7. The conjugate according to claim 6, characterized in that, The conjugate comprises any of the following structures, or tautomers, or stereoisomers, or pharmaceutically acceptable salts thereof: 、 、 、 、 、 、 、 。 8. The conjugate according to claim 7, characterized in that, The active pharmaceutical molecule is selected from double-stranded oligonucleotides, which include a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, and the antisense strand contains a sequence complementary to the bases of the sense strand and the target mRNA; wherein the sense strand and / or antisense strand contains one or more ligand compounds as described in claims 1-5; One or more ligand compounds according to claims 1-5 are attached to the 5' end of the sense strand of the double-stranded oligonucleotide, and / or the 3' end of the sense strand, and / or the 3' end of the antisense strand; more particularly selected from the 5' end of the sense strand and / or the 3' end of the sense strand.

9. Use of the ligand compound as described in any one of claims 1-5, and / or the conjugate as described in any one of claims 6-8, in the preparation of a medicament for treating and / or preventing pathological conditions or diseases caused by the abnormal expression of specific genes in tissue cells; The tissue cells are selected from ocular cells, fat cells, or nerve tissue cells; more specifically from retinal tissue, choroidal tissue, and scleral tissue.

10. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a ligand compound as described in any one of claims 1-5, and / or a conjugate as described in any one of claims 6-8, and one or more pharmaceutically acceptable carriers or excipients.