Genetic engineering strain of high-yield secondary metabolite Fumagillin as well as construction method and application of genetic engineering strain

By constructing genetically engineered strains of Aspergillus fumigatus with HosA deficiency or catalytic active site mutations, the Fumagillin biosynthesis gene cluster was activated, solving the problem of low Fumagillin yield in Aspergillus fumigatus strains and achieving efficient Fumagillin production.

CN121975641APending Publication Date: 2026-05-05NANJING NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512025328.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-30
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

In existing technologies, Aspergillus fumigatus strains produce low yields of Fumagillin under traditional fermentation conditions, which is difficult to meet the needs of industrial production and clinical research. Furthermore, existing strategies to increase yield are inefficient and yield uncertain.

Method used

By targeting and deleting or mutating the catalytic active site of the histone deacetylase HosA in Aspergillus fumigatus, genetically engineered strains with HosA deficiency or catalytic active site mutations are constructed using homologous recombination technology, thereby activating the transcriptional expression of the Fumagillin biosynthetic gene cluster.

Benefits of technology

Significantly increased the fermentation yield of Fumagillin, with the wild-type strain yielding approximately 25 times more and the point mutant strain yielding 6-15 times more than the wild-type, achieving highly efficient Fumagillin production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121975641A_ABST
    Figure CN121975641A_ABST
Patent Text Reader

Abstract

The invention discloses a genetic engineering strain of high-yield secondary metabolite Fumagillin as well as a construction method and application of the genetic engineering strain, and the genetic engineering strain is obtained by taking aspergillus fumigatus as a chassis bacterium through hosA gene knockout or hosA catalytic active site mutation. According to the method, a hosA gene knockout strain (delta hosA) and catalytic active site mutation strains (HosAD133A, HosAH175A and HosAD210A) are constructed by means of molecular biology, and the mutant strains are subjected to liquid or solid fermentation under the culture condition of 37 DEG C, so that the yield of Fumagillin can be remarkably increased. According to the method disclosed by the invention, the inhibition on a Fumagillin biosynthetic pathway is relieved and the metabolic flux is enhanced by utilizing the activity change of histone deacetylase caused by hosA defects, and an efficient and directional production method for high-yield Fumagillin is provided, so that the method has an important industrial application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] A genetically engineered strain that produces high levels of the secondary metabolite Fumagillin, its construction method, and its applications. Background Technology

[0002] Fumagillin is an important fungal secondary metabolite, initially discovered in *Aspergillus fumigatus*. Fumagillin and its derivatives, such as TNP-470 (also known as Fumagillol), have attracted widespread attention in the pharmaceutical industry due to their unique anti-angiogenic activity. Because it specifically inhibits methionine aminopeptidase 2 (MetAP2), Fumagillin shows great potential for applications in cancer treatment and anti-parasitic (microsporidiasis) treatments. Currently, Fumagillin is mainly produced through microbial fermentation. However, the yield of Fumagillin from existing wild-type *Aspergillus fumigatus* strains under traditional fermentation conditions is generally low, making it difficult to meet the needs of industrial production and clinical research, resulting in high production costs.

[0003] Traditional strategies for increasing yield, such as fermentation medium optimization and non-directed mutagenesis breeding, suffer from drawbacks including byproduct accumulation, massive screening workload, low efficiency, and uncertainty in results. Therefore, a strategy to enhance Fumagillin yield through targeted gene modification and metabolic pathway enhancement is urgently needed. Epigenetic regulatory mechanisms, especially histone modifications, play a crucial role in the regulation of fungal secondary metabolism. Histone deacetylases (HDACs) are an important class of regulatory factors that inhibit the expression of related genes by removing acetyl groups from histones, causing chromatin condensation. However, no literature has yet reported on the use of targeted gene modification to enhance Fumagillin yield. HosA A technical solution for high-yield Fumagillin by combining genes with specific culture temperatures. Summary of the Invention

[0004] Objective of the invention: To address the problems of low yield, complex regulation, and unclear epigenetic regulation mechanisms of fungal secondary metabolites in existing technologies, this invention provides a genetically engineered strain that produces high yields of the secondary metabolite Fumagillin. This invention targets and deletes or mutates the HosA catalytic active site of histone deacetylase in Aspergillus fumigatus, thereby disrupting its deacetylation activity, relieving transcriptional repression of the Fumagillin biosynthetic gene cluster, and activating the Fumagillin synthesis pathway and significantly increasing its yield.

[0005] The present invention also provides a method for constructing and applying the genetically engineered strain.

[0006] Technical solution: To achieve the above objective, the present invention provides a genetically engineered strain that produces a high yield of the secondary metabolite Fumagillin, wherein the genetically engineered strain is Aspergillus fumigatus FGSC A1151 (… Aspergillus fumigatus ) is a chassis bacterium, through hosA Genetic defects or hosA Obtained by mutation of catalytic active site, the hosA The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0007] Among them, the hosA Catalytic active site mutation hosA Mutations in the gene encoding amino acids, including any one or more of D133A, H175A, and D210A.

[0008] Wherein, the *Aspergillus fumigatus* is a wild type or a derivative strain, and the *Aspergillus fumigatus* is Aspergillus fumigatus FGSC A1151.

[0009] Among them, the genetically engineered strain is hosA Gene-deficient strains were constructed using homologous recombination technology. hosA Replace the gene coding region with an resistance selection marker or hosA Mutation of conserved catalytic active sites.

[0010] The method for constructing a genetically engineered strain that produces the high-yield secondary metabolite Fumagillin according to the present invention includes the following steps: 1) The design includes hosA Knockout vectors for upstream and downstream homologous arms or designing and constructing vectors containing the generatrix. hosA Mutation of catalytic active site hosA The ORF region was used to recombinantly replace the hygromycin resistance gene ( hph ) as a filter tag; 3) Linearization hosA Knockout fragments or hosA The active site mutation replacement fragment was transformed into Aspergillus fumigatus protoplasts, and positive transformants were obtained through PEG-mediated transformation; HosA knockout strain Δ was constructed. hosA Alternatively, mutant strains with catalytically active sites are genetically engineered strains that produce high yields of the secondary metabolite Fumagillin.

[0011] The application of the genetically engineered strain of Fumagillin, which produces high yields of the secondary metabolite described in this invention, in the production of high-yield Fumagillin.

[0012] In this method, genetically engineered strains are fermented at 30-40℃ to induce the accumulation of the secondary metabolite Fumagillin.

[0013] The fermentation culture is a liquid shake flask fermentation.

[0014] Among them, the hosA Genetically defective Aspergillus fumigatus ( Aspergillus fumigatus The application of strain ) in the production of Fumagillin, wherein the application was carried out under culture conditions at 37°C.

[0015] Among them, the yield of Fumagillin under the 37℃ culture condition was significantly higher than that of wild-type Aspergillus fumigatus under the same 37℃ culture condition.

[0016] The yield of Fumagillin was 25 times that of the wild-type strain.

[0017] The extraction of Fumagillin is performed using an organic solvent extraction method, with methanol being the preferred organic solvent.

[0018] The quantitative analysis of Fumagillin was performed using high performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS).

[0019] The present invention hosA Application of genes in regulating the production of the secondary metabolite Fumagillin by Aspergillus fumigatus.

[0020] Among them, through hosA Genetic defects or hosA Mutations in the gene's catalytically active site increase the production of the secondary metabolite Fumagillin by Aspergillus fumigatus.

[0021] The HosA-deficient strain constructed in this invention exhibits stable growth and a significantly increased Fumagillin fermentation yield under 37°C culture conditions, and this effect can be achieved without the addition of exogenous inducers or epigenetic regulatory compounds. This invention provides a novel epigenetic modification strategy for enhancing the yield of secondary metabolites from medicinal fungi, and has potential industrial application value.

[0022] This invention also provides a method using Aspergillus fumigatus ( Aspergillus fumigatus A method for producing high yields of the secondary metabolite Fumagillin from HosA-deficient strains (under 37°C culture conditions), the method comprising the following steps: (1) Using wild-type Aspergillus fumigatus strain FGSC A1151 as the chassis strain, homologous recombination was used to knock out the strain. hosA Gene or hosA Catalytic active site mutation yielded HosA-deficient strain Δ hosA Or HosA D133A HosA H175A HosAD210A ; (2) Δ hosA The strain was cultured at 37°C in a liquid fermentation medium containing glucose to induce the efficient accumulation of the secondary metabolite Fumagillin. (3) The yield of Fumagillin was quantitatively determined by analyzing the fermentation supernatant by high performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS).

[0023] Among them, the steps described in step (1) hosA The gene sequence is SEQ ID NO.1. By knocking out... hosA or hosA Mutations at catalytically active sites can significantly increase the number of key synthetic enzymes in the Fumagillin biosynthetic gene cluster (fma cluster). fmaC , fmaF and transcription factors fapR This reduces the mRNA level, thereby breaking the silencing state and promoting Fumagillin synthesis.

[0024] In step (2), the culture medium is preferably Aspergillus basic culture medium, with 10% glucose as the carbon source and 0.6% sodium nitrate as the nitrogen source; the culture temperature is 37℃ and the culture time is 72 hours; the shaking speed is 200 rpm.

[0025] Furthermore, the HosA-deficient strain Δ described in this invention hosA It can be constructed using the following method: 1) The design includes hosA A knockout vector with approximately 1.5 kb homologous arms upstream and downstream was used to select the hygromycin resistance gene as a marker. 2) The linearized knockout fragment was transformed into Aspergillus fumigatus FGSC A1151 protoplasts, and positive transformants were obtained by PEG-mediated transformation; 3) Verification via PCR hosA The gene has been completely knocked out.

[0026] Furthermore, the HosA-deficient strain HosA described in this invention D133A HosA H175A HosA D210A It can be constructed using the following method: 1) Design and construct a system containing specified point mutations. hosA The recombinant vector of the ORF region uses the hygromycin resistance gene as a selection marker; 2) The linearized knockout fragment was transformed into Aspergillus fumigatus FGSC A1151 protoplasts, and positive transformants were obtained by PEG-mediated transformation; 3) Verification via Sanger sequencing hosA The gene has been correctly mutated.

[0027] Optionally, the present invention also provides a replacement strain of the HosA-deficient strain. hosA C This is used to verify the specificity of the phenotype. Reintroduced into the complement strain. hosA After gene therapy, Fumagillin production returned to wild-type levels, thus confirming that high Fumagillin production is related to... hosA The absence is directly related.

[0028] The application of the HosA-deficient strain described in this invention in the production of the secondary metabolite Fumagillin.

[0029] The present invention hosA Application of genes in regulating Fumagillin production in strains possessing Fumagillin biosynthesis gene clusters.

[0030] This invention relates to a technique and its application that utilizes the HosA defect to relieve epigenetic repression and activate the Fumagillin biosynthesis gene cluster. It is applicable to all fungal species capable of synthesizing Fumagillin and containing the Fumagillin biosynthesis gene cluster.

[0031] This invention proposes a method to increase Fumagillin fermentation yield by deleting the histone deacetylase HosA. HosA, as an important epigenetic regulator in fungal cells, typically maintains chromatin compactness through deacetylation activity and inhibits the transcriptional activity of gene clusters synthesizing various secondary metabolites, including Fumagillin. This invention utilizes *Aspergillus fumigatus* (… Aspergillus fumigatus The chassis strain was used to obtain the HosA knockout strain (Δ) through homologous recombination. hosA ) and point mutant strains (HosA D133A HosA H175A HosA D210A In this invention, HosA deficiency or active site mutation significantly enhances the expression levels of key genes in the Fumagillin biosynthetic gene cluster, including... fmaC , fmaF and transcription factors fapR This promotes the biosynthesis and accumulation of Fumagillin.

[0032] To further verify the function of HosA in the regulation of Fumagillin biosynthesis, this invention constructed HosA knockout strains (Δ... hosA ), point mutant strain (HosA) D133A HosA H175A HosAD210A ) and replenishment strains ( hosA C Liquid fermentation and metabolite analysis revealed that knockout and point mutant strains showed significantly increased Fumagillin production at 37°C, while the yield returned to wild-type levels in the replenished strains, indicating that HosA has a negative regulatory effect on Fumagillin biosynthesis. HPLC results showed that the HosA-deficient strain fermentation supernatant exhibited a single characteristic peak at 24 min, consistent with the Fumagillin standard; LC-MS analysis detected a molecular ion peak [M+H]. + = 459.2, consistent with the molecular characteristics of Fumagillin, proving that the HosA defect promotes the accumulation of Fumagillin products.

[0033] Specifically, this invention verifies and realizes the mechanism by which the HosA defect affects the high yield of Fumagillin through the following steps: Using Aspergillus fumigatus FGSC A1151 genomic DNA as a template, construct hosA Homologous recombination fragments upstream and downstream of the gene were used to replace the target gene, resulting in the HosA knockout strain Δ. hosA ; based on hosA The gene sequence was analyzed, and site-directed mutations were performed on the codons corresponding to amino acids 133, 175, and 210. The mutated sequences were then integrated back into the genome via homologous recombination to construct a point-mutant strain (HosA). D133A HosA H175A HosA D210A ); by hosA Using genes as templates, the original hosA The sequences were randomly reintegrated into the genome to obtain complemented and overexpressing strains for verification of phenotype specificity; wild-type strains, Δ hosA strains, point mutant strains and hosA C The strain was cultured in liquid fermentation medium at 37℃, and the fermentation supernatant was collected. Fumagillin was detected and quantified by HPLC and LC-MS. RT-qPCR analysis was performed on genes related to the Fumagillin biosynthesis gene cluster in the strain. fmaC , fmaF and transcription factors fapR Changes in transcriptional levels confirmed hosA The expression of these genes was significantly upregulated in the defective strains.

[0034] The above-mentioned HosA-deficient strains can be constructed using genetic engineering methods: 1) Using a knockout vector containing a hygromycin resistance marker, the HosA open reading frame (ORF) is replaced by homologous recombination, and the knockout strain Δ is obtained by PCR verification. hosA 2) Wild type hosA Using the gene as a template, site-directed mutations were performed on the codons corresponding to amino acids 133, 175, and 210, and the mutated genes were then... hosA The sequence was integrated into the genome via homologous recombination, and the corresponding point mutant strain was obtained after sequencing verification; 3) by introducing Δ hosA The knockout strain was infused with the hosA gene fragment and integrated into its genome to obtain a complement strain. hosA C .

[0035] Subsequently, this invention employed the HosA-deficient strain for fermentation at 37°C, significantly enhancing the biosynthesis of Fumagillin. Compared to the wild-type strain, the HosA-deficient strain exhibited approximately 25-fold increased Fumagillin yield under the same fermentation conditions. Further research revealed that HosA deficiency leads to the overall activation of the Fumagillin gene cluster, resulting in product accumulation.

[0036] In fact, there are currently no literature reports on how altering epigenetic regulatory factors can induce or restore Fumagillin production under high growth temperature conditions (such as 37°C) in Aspergillus fumigatus. The systematic study of this invention demonstrates that knocking out the histone deacetylase gene in Aspergillus fumigatus... hosA or hosA Introducing mutations at catalytically active sites (D133A, H175A, and D210A) into the gene pool could all break the silencing of the Fumagillin biosynthesis gene cluster at 37°C, enabling wild-type strains that previously produced almost no Fumagillin at this temperature to resume and stably produce the metabolite. Further analysis showed that the activation effect at this temperature was accompanied by widespread transcriptional upregulation of genes related to secondary metabolism, suggesting that HosA-mediated epigenetic repression is closely related to the metabolic state and temperature response of Aspergillus fumigatus.

[0037] Specifically, this invention uses Aspergillus fumigatus FGSC A1151 as the chassis strain: (1) knocking out the genome of the chassis strain hosA Genes were used to obtain HosA-deficient strain Δ hosA To relieve the epigenetic inhibition effect; or hosA Introducing point mutations (D133A, H175A, or D210A) into the catalytically active site of a gene to inactivate it, thereby obtaining a gene with... hosA Point mutant strains with knockout strain phenotypes (2) were subjected to HosA-deficient strains (including Δ) at 37°C. hosA The strains (including point mutant strains) were cultured in liquid fermentation. By increasing the chromatin acetylation level, the expression of the Fumagillin biosynthesis gene cluster was activated, promoting the accumulation of Fumagillin products, and ultimately a high-yielding Fumagillin strain and production method were obtained.

[0038] Meanwhile, this invention provides an application of the above-mentioned high-yield Fumagillin method, including the following steps: Step S1: Construct a HosA loss-of-function strain. This is achieved through homologous recombination deletion. hosA Genes were used to obtain the HosA knockout strain Δ hosA or hosA Point mutations (such as D133A, H175A, or D210A) are introduced into the catalytically active site of a gene to disable its enzyme activity, thereby obtaining a point mutant strain with a HosA loss-of-function phenotype.

[0039] Step S2: Δ hosA Alternatively, point mutant strains were cultured in liquid fermentation at 37°C, and the yield of Fumagillin in the fermentation broth was detected by HPLC.

[0040] This invention utilizes hosA The epigenetic regulation unblocking effect caused by the gene defect activated the previously silenced Fumagillin biosynthetic gene cluster, thereby significantly increasing Fumagillin production. The results showed that HosA loss of function could unblock the temperature-dependent inhibition of this gene cluster under 37°C culture conditions, breaking the limitation that wild-type strains could not produce Fumagillin at this temperature and promoting the resumption and stable production of this metabolite. These findings indicate that HosA-mediated epigenetic repression plays a crucial role in the temperature-responsive metabolic regulation of fungi, and its deficiency can overcome the temperature-limited effect on Fumagillin synthesis, thus enabling the efficient production of this metabolite under high-temperature conditions.

[0041] This invention is based on Aspergillus fumigatus FGSC A1151 is a chassis strain. By genetically modifying it to enhance the metabolic flux in the Fumagillin biosynthesis process, the fermentation yield of Fumagillin was significantly increased. This method is simple, highly operable, and widely applicable, providing a new approach for the epigenetic regulation and metabolic engineering of fungal secondary metabolites.

[0042] Beneficial effects: Compared with the prior art, the present invention has the following advantages: This invention reveals for the first time the negative regulatory role of histone deacetylase HosA in the biosynthesis of Fumagillin in Aspergillus fumigatus, through knockout... hosA Mutations in genes or catalytically active sites can break epigenetic silencing and effectively activate the transcriptional expression of the Fumagillin biosynthetic gene cluster, thereby significantly increasing the fermentation yield of Fumagillin.

[0043] This invention demonstrates that HosA deficiency significantly promotes Fumagillin synthesis in *Aspergillus fumigatus* at 37°C. Specifically, the HosA knockout strain exhibits approximately 25-fold increased Fumagillin production compared to the wild-type strain; while... hosA Strains obtained by introducing point mutations (D133A, H175A, D210A) into the catalytic active sites exhibited yields approximately 6–15 times higher than the wild type, indicating that HosA deficiency can promote the allocation of metabolic flux to the Fumagillin biosynthesis pathway, achieving efficient product accumulation. The high-yield strategy based on epigenetic regulation proposed in this invention is universal and can be extended to other fungal species containing similar biosynthetic gene clusters besides Fumagillin. The method of this invention is simple to operate; HosA-deficient strains can be obtained using conventional genetic engineering techniques, achieving high yields without additional inducers or special fermentation conditions, demonstrating strong reproducibility and industrialization potential. This invention, by revealing the mechanism by which HosA deficiency promotes Fumagillin biosynthesis, establishes an epigenetically regulated high-yield fungal metabolite fermentation system, providing a new technical approach and theoretical basis for the efficient production of Fumagillin and related secondary metabolites. Attached Figure Description

[0044] Picture 1 As described in this invention hosA HPLC (left) and LC-MS (right) analysis results of the fermentation extract of the defective strain.

[0045] Picture 2 As described in this invention hosA A schematic diagram of the construction of genetically engineered strains, including hosA Gene knockout strains (Δ hosA Point mutant strains with catalytically active sites (D133A, H175A, D210A) and hosA Replacement strains ( hosA C The construction strategy and verification results of ).

[0046] Picture 3 This is a comparison of Fumagillin production between the genetically engineered strain constructed in this invention and the wild-type chassis strain (wherein... (This represents p < 0.01, and ns represents no significant difference). Picture 4A comparative analysis at 28°C revealed that the wild-type strain could naturally produce Fumagillin at low temperatures, with a yield of 1.80 ± 0.05 μg / mL. In contrast, the yield of the ΔhosA strain under the same conditions was 2.02 ± 0.04 μg / mL, which was similar to the wild-type strain but only slightly higher. Detailed Implementation

[0047] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0048] Unless otherwise specified, all materials and reagents used in the embodiments of this invention are commercially available. Experimental methods not specifically described in the embodiments are generally performed under standard conditions or as recommended by the manufacturer.

[0049] 1. The wild-type strain of Aspergillus fumigatus used in this invention, FGSC A1151, was purchased from the FGSC Fungal Collection Center in the United States and is a universal wild-type strain for Aspergillus fumigatus gene research and fermentation production.

[0050] The gene names in the reference genome of the genes involved in the construction of the genetically engineered strains in this invention are shown in Table 1. Tables 2 and 3 respectively list the strain names and the primers used in the design of this invention.

[0051] Table 1. Genes involved in the construction of genetically engineered strains

[0052] Table 2 Summary of strain information

[0053] Table 3 Summary of primer information

[0054] The amplification PCR reaction system, diagnostic PCR reaction system, fusion PCR reaction program, and PCR reaction program for each strain are shown in Table 4-7.

[0055] Table 4 Amplification PCR Reaction System

[0056] Table 5 Diagnostic PCR Reaction System

[0057] Table 6 Fusion PCR Reaction System

[0058] Table 7 PCR reaction procedure

[0059] 2. The process of analyzing the fermentation broth of each strain in this invention includes two steps: fermentation culture and concentration. The specific steps are as follows: Fermentation medium and fermentation process: S1: The culture medium composition is as follows: each 1 L of medium contains 10 g glucose, 1 mL trace elements, and 50 mL 20 × 10⁻⁶ salt solution. Adjust the pH of the medium to 6.5 using sodium hydroxide. S2: The trace element solution composition is as follows: zinc sulfate heptahydrate (ZnSO4·7H2O) 22 g / L, boric acid (H3BO3) 11 g / L, manganese chloride tetrahydrate (MnCl2·4H2O) 5 g / L, ferrous sulfate heptahydrate (FeSO4·7H2O) 5 g / L, cobalt chloride pentahydrate (CoCl2·5H2O) 1.6 g / L, copper sulfate pentahydrate (CuSO4·5H2O) 1.6 g / L, ammonium molybdate tetrahydrate ((NH4)6Mo7O 24 1.1 g / L of ethylenediaminetetraacetic acid (EDTA) was added in sequence after weighing. Finally, 50 g / L of EDTA was added. After all reagents were dissolved, potassium hydroxide was added to adjust the pH to between 6.5 and 6.8 and the solution was brought to volume. S3:20 × The salt solution composition is as follows: sodium nitrate (NaNO3) 120 g / L, potassium chloride (KCl): 10.4 g / L, potassium dihydrogen phosphate (KH2PO4): 30.4 g / L, magnesium sulfate heptahydrate (MgSO4·7H2O) 10.4 g / L; S4: The fermentation process is as follows: Inoculate with 1 × 10 8 One Aspergillus fumigatus spore was cultured in 100 mL of culture medium at 37°C and 220 rpm for 72 hours.

[0060] 3. In the embodiments of the present invention, the molecular weights of Fumagillin and its corresponding standards were detected and analyzed using LC-MS based on the LC1290 / MS6470B (Agilent Technologies) platform. The detection method is as follows: Chromatographic conditions: AQ-C18 column (4.6 × 250 mm, Yuexu), multi-wavelength detector (MWD) for detection of 300 nm wavelength light signal with a bandwidth of 4 nm. Sample injection volume was 10 µL, column temperature was not controlled. An AJS ESI (electrospray ionization) ion source was used to detect ions with molecular weights between 100 and 1000 in positive mode. Gas temperature was set at 300°C, gas flow rate at 5 L / min, and nebulizer pressure maintained at 40 psi.

[0061] Sample processing: The obtained fermentation extract was filtered through a 0.22 μm organic nylon filter membrane.

[0062] Preparation of Fumagillin standard: Fumagillin standard was prepared into a stock solution of 2.5 mg / mL using methanol as solvent, and then diluted to a sample solution with a concentration of 250 μg / mL. The sample solution was then filtered through a 0.22 μm organic nylon filter membrane.

[0063] Mobile phase: The mobile phase consisted of 0.05% formic acid (A) and acetonitrile (B), with a flow rate of 0.6 mL / min. The elution gradient (A / B percentage) was as follows: from 75 / 25 to 35 / 65 over 20 min, held at 35 / 65 for 20 min, then decreased to 75 / 25 over 1 min, held at 75 / 25 for 4 min, for a total duration of 45 min. Both mobile phases (organic and aqueous phases) were filtered using 0.22 μm microporous membranes.

[0064] Data acquisition time: 45 min.

[0065] 4. In this embodiment of the invention, the yield of Fumagillin was detected and analyzed using HPLC. The detection method is as follows: Chromatographic conditions: AQ-C18 column (4.6×250 mm, Yuexu), multi-wavelength detector (MWD) for detecting light signals at a wavelength of 300 nm with a bandwidth of 4 nm. Sample injection volume was 10 µL, and column temperature was controlled at 20℃.

[0066] Sample processing: The obtained fermentation extract was filtered through a 0.22 μm organic nylon filter membrane.

[0067] Mobile phase: The mobile phase consisted of 0.05% formic acid (A) and acetonitrile (B) at a flow rate of 1 mL / min. The elution gradient (A / B percentage) was: from 75 / 25 to 35 / 65 over 20 min, held at 35 / 65 for 8 min, and then decreased to 75 / 25 over 7 min, for a total duration of 35 min. The sample injection volume was 20 µL, and the column temperature was maintained at 20°C. Both mobile phases were filtered using 0.22 μm microporous membranes (organic and aqueous phases).

[0068] Data acquisition time: 35 min.

[0069] 5. This invention demonstrates the biological function of HosA in the biosynthesis of Fumagillin and provides a method for using wild-type Aspergillus fumigatus strain FGSC A1151 as a chassis cell and applying homologous recombination substitution technology to introduce HosA into the genome of the chassis strain. hosA The entire gene was replaced with a hygromycin resistance gene. hphA genetically engineered strain that produces high levels of Fumagillin (Δ) was obtained. hosA The specific construction process is as follows: The upstream and downstream regions of the gene were amplified using primers HosA P1 / P3 and P4 / P6, respectively. The hygromycin resistance gene was amplified using hph F / R with pAN7-1 plasmid (Miaoling Biotechnology, P0302) as a template. The upstream, resistance, and downstream regions of the gene were fused together by bridge PCR using primers HosAP2 / P5 to obtain a recombinant DNA fragment. Approximately 10 μg of the recombinant fragment was mixed with Aspergillus fumigatus protoplasts and incubated on ice for 50 min. Take solid transformation medium (containing sorbitol: 218.6 g / L; glucose: 10 g / L; salts (20×): 50 mL / L; trace elements (trace (1000×): 1 mL / L; yeast extract: 2 g / L; low-melting-point agar 7.5 g / L for the upper transformation layer and ordinary agar 15 g / L for the lower transformation layer), melt it, and add 200 μg / mL hygromycin B (Yisheng Biotechnology, 60224ES03) as needed. Pour the lower layer medium. Take 15 mL centrifuge tubes, label them, and add 1.25 mL of PEG (PEG 4000 60%, CaCl2 2.35 g / L, Tris-HCl 50 mM, pH adjusted to 7.5 with HCl) to each tube. Transfer the protoplasts that have been ice-bathed to the 15 mL tubes, invert and mix well, and incubate at 37℃ for 30 min. After completion, add 10 mL of melted, drug-added, and appropriately heated conversion supernatant medium, invert to mix thoroughly. Pour the supernatant onto the bottom medium and incubate at 37°C for 2-3 days.

[0070] 6. The preparation of bacterial protoplasts shall be carried out according to existing conventional methods, as follows: (1) Obtaining bacterial cells: First, take approximately 1 × 10 9 Spores of the background strain were suspended in 100 mL of MM medium. The medium was placed on a shaker and incubated at 37°C and 220 rpm until the mycelium was flocculent but did not aggregate into spheres. The medium containing logarithmic-phase cells in the conical flask was transferred to a new 50 mL centrifuge tube and centrifuged at 8000 rpm for 8 min. After centrifugation, the liquid medium was discarded, and the cells at the bottom were retained.

[0071] (2) Preparation of enzyme hydrolysate: Weigh SIGMA ® Lysing Enzymes from Trichoderma harzianumDissolve 30 mg of TaKaRa Yatalase and 20 mg of TaKaRa Yatalase completely in 10 mL of OM solution (10 mM phosphate buffer, 144.48 g / L magnesium sulfate, pH adjusted to 5.8 with disodium hydrogen phosphate) (2 M phosphate buffer: 163.4 g / L sodium dihydrogen phosphate, 90.9 g / L disodium hydrogen phosphate, pH adjusted to 7.0); filter the prepared enzymatic hydrolysate through a 0.22 μm sterile filter and place it in a 50 mL Erlenmeyer flask.

[0072] (3) Enzymatic hydrolysis: Add the cultured and isolated bacterial cells to a conical flask containing 50 mL of enzymatic hydrolysate, mix well, place the conical flask in a constant temperature shaker at 28℃ and 80 rpm for enzymatic hydrolysis, remove the conical flask every 2 hours, mix well by blowing and taking samples for microscopic examination of the protoplast state; when the enzymatic hydrolysis is carried out until concentric spheres are visible under the microscope, these are protoplasts, remove the enzymatic hydrolysate conical flask from the shaker.

[0073] (4) Take ice and tilt a 50 mL centrifuge tube to pre-cool it. Pour the protoplasts into the 50 mL centrifuge tube, and slowly add 10 mL of Trapping buffer (109.3 g / L sorbitol, 12.11 g / L tris(hydroxymethyl)aminomethane, pH adjusted to 7.0 with HCl) while the tube adheres to the wall. The Trapping Buffer should be on top, with a clear boundary between the layer and the bottom layer. Pre-cool the centrifuge and centrifuge at 4°C and 5000 rpm for 15 min. At this point, the protoplasts will be located at the boundary. Use a pipette tip to aspirate the protoplasts from the layer containing them and transfer them to a new 50 mL tube. Add an equal volume of STC (218.6 g / L sorbitol, 1.11 g / L calcium chloride, 1.211 g / L tris(hydroxymethyl)aminomethane, pH adjusted to 7.5 with HCl) and mix gently. Centrifuge at 4°C and 6000 rpm for 15 min. At this point, the protoplasts will adhere to the bottom or wall of the tube. Discard the liquid. Finally, add a small amount of STC again and gently rinse the tube walls with a small pipette, avoiding damage to the protoplasts while flushing them down. Examine the protoplasts under a microscope to determine their mass, adjust the protoplast concentration, and store on ice.

[0074] Example 1 hosA Construction of gene knockout strains: First, primers HosA-P1 / HosA-P3 and HosA-P4 / HosA-P6 were designed and used to amplify the gene knockout strains using Aspergillus fumigatus FGSC A1151 genomic DNA as a template via PCR. hosA The gene has left and right homologous arms, each covering approximately 1500 bp of sequence upstream of the start codon and downstream of the stop codon, respectively. (This is related to) resistance selection markers. hphThe gene fragment was amplified using primers hph-F / hph-R with plasmid pAN7-1 as a template. Primers HosA-P2 and HosA-P5 were used to amplify the left homologous arm, hph The resistance gene and right homologous arm were mixed and used as a template for fusion PCR amplification into a continuous linear recombinant DNA fragment. The constructed recombinant fragment was transformed into Aspergillus fumigatus FGSC A1151 protoplasts, and Δ fragments were obtained by hygromycin resistance plate selection. hosA strain ( Picture 1 A). PCR verification of the transformant strain was performed using diagnostic primers HosA-P1 / hph-R and HosA-self-F / HosA-self-R: the homologous arm region could be amplified to the expected band, while... hosA The absence of amplified bands in the ORF region indicates that... hosA The gene has been successfully knocked out. Picture 1 B).

[0075] Example 2 hosA Construction of gene point mutant strains: Using Aspergillus fumigatus FGSC A1151 genomic DNA as a template, amplification was performed using primers HosA-TB-P1 / P3 and HosA-TB-P4 / P6 to obtain the gene point mutant strains. hosA The left and right homologous arms, approximately 1500 bp upstream and downstream of the stop codon. Selection markers. hph The gene fragment was amplified using primers hph-F / hph-R with pAN7-1 as a template. The left homologous arm was amplified using primers HosA-TB-P2 / P5. hph The resistance gene and the right homologous arm were fused and amplified by PCR to form a continuous linear recombinant DNA fragment. Picture 1C). Subsequently, the recombinant DNA fragment was ligated into a blunt-ended cloning vector using the SinoMol Zero Blunt cloning kit (Nanjing Spom, KBT101). After PCR verification, site-directed mutagenesis was performed using the Mut Express II Fast Mutagenesis Kit (Novizan, C214-01). The site-directed mutagenesis primers were designed based on the target amino acid sites (D133A, H175A, or D210A) to induce the expected codon substitution. Mutation PCR was performed according to the kit instructions. After amplification, the methylated template plasmid was removed by DpnI digestion, retaining only the newly synthesized circular plasmid containing the mutation site. The mutant plasmid was transformed into *E. coli* for amplification, and sequencing verified the correct introduction of the mutation site and the absence of additional non-specific mutations. The primer sequences used for each mutation site are as follows: HosA-D133A-F: GCCTGTCCCATCTTCAACGGGTTGTACAACTA; HosA-D133A-R: TTGAAGATGGGACAGGCGTCGCCGAAATTGAACCG; HosA-H175A-F: CCTGCACGCCGCCAAAAAGGCCGAAGCCAGCGG; HosA-H175A-R: TTTTTGGCGGCGTGCAGGCCGCCCGACCAGTTC; HosA-D210A-F: ATATCGACATCGCCGTGCACCACGGCGACGGC; HosA-D210A-R: CACGGCGATGTCGATATACATGACGCGTGGGT. The plasmid containing the point mutation was transformed into protoplasts of *Aspergillus fumigatus* FGSC A1151, and selection was performed using a hygromycin resistance marker. Sequencing further confirmed that the mutant fragment had been accurately integrated into the genome, yielding... hosA Point mutant strain (HosA) D133A HosA H175A HosA D210A () Picture 1 D).

[0076] Example 3 hosA Construction of the complement strain: Genomic DNA of Aspergillus fumigatus FGSC A1151 was used as a template and amplified using amplification primers HosA-phle-F / HosA-phle-R to obtain the complement strain. hosA The ORF region and its upstream and downstream 1500 bp gene sequences were obtained, including the gene, its original promoter, and terminator; resistance selection markers were also included. phleThe gene fragment was amplified using primers phle-F / phle-R with pTEF1-Zeo plasmid (Miaoling Biotechnology, P83809) as a template. Using primers HosA-phel-F / phel-R, the gene fragment containing the promoter and terminator was then amplified with… phle The resistance gene fragment was amplified by fusion PCR to obtain the linear recombinant DNA fragment used for gene complementation. Picture 1 E). The constructed linear complemented gene fragment is transformed into Δ. hosA In the protoplasts of the strain, the correct colonies were selected using two resistance plates: hygromycin and bleomycin. The obtained resistant strains ( hosA C The culture was performed, genomic DNA was extracted, and PCR identification was conducted using diagnostic primers HosA-phle-F / HosA-phle-R to confirm that the complement fragment had been successfully integrated into the Δ. hosA Genome ( Picture 1 F).

[0077] Example 4 hosA Functional and efficacy verification of Fumagillin synthesis by defective strains under high temperature conditions wild type, hosA Gene knockout strains (Δ hosA ), three plants hosA Point mutant strain (HosA) D133A HosA H175A HosA D210A ) and replenishment strains ( hosA C Following the aforementioned steps, liquid fermentation was performed to obtain the fermentation extract. The metabolites were then analyzed using liquid chromatography-mass spectrometry (LC-MS / HPLC). The results showed that at 37℃, Δ... hosA The molecular weight of the compounds accumulated by the strain and the fragment ion peaks were consistent with those of the Fumagillin standard. Picture 2 ),show hosA Gene deletion allows the strain to synthesize Fumagillin under high-temperature conditions. Quantitative analysis showed that Δ hosA The Fumagillin yield of the strain at 37℃ was 3.50 ± 0.38 μg / mL, while that of the wild type was only 0.14 ± 0.04 μg / mL. The yields of the three point mutant strains (1.67 ± 0.20, 0.90 ± 0.01, and 2.17 ± 0.08 μg / mL) were also significantly higher than that of the wild type, all showing a trend of partial de-inhibition. hosA After replenishment, the yield recovered to 0.24 ± 0.02 μg / mL, close to the wild-type level. Picture 3 Further comparative analysis at 28℃ revealed that the wild-type strain could naturally produce Fumagillin under low-temperature conditions, with a yield of 1.80 ± 0.05 μg / mL, while Δ hosA The yield of the strain under the same conditions was 2.02 ± 0.04 μg / mL, similar to the wild type but only slightly higher. Picture 4 The above results indicate that hosA The deletion does not generally increase yield at low temperatures, but its significant effect is mainly observed at high temperatures of 37°C. In summary, HosA is an important negative regulator of Fumagillin biosynthesis. Its deletion or impaired catalytic site function can relieve the inhibition of Fumagillin biosynthesis, enabling the strain to synthesize Fumagillin in large quantities at 37°C, a condition where Fumagillin is normally not produced or produced at very low levels.

Claims

1. A genetically engineered strain that produces a high yield of the secondary metabolite Fumagillin, characterized in that, The genetically engineered strain was obtained by knocking out the hosA gene or mutating the hosA catalytic active site using Aspergillus fumigatus as the substrate fungus. The nucleotide sequence of the hosA gene is shown in SEQ ID NO.

1.

2. The genetically engineered strain producing high yields of the secondary metabolite Fumagillin according to claim 1, characterized in that, The mutation of the hosA catalytic active site is a mutation of the amino acid encoded by the hosA gene, including any one or more of D133A, H175A, and D210A.

3. The genetically engineered strain producing high yields of the secondary metabolite Fumagillin according to claim 1, characterized in that, The Aspergillus fumigatus strain is wild-type or a derivative thereof, and the Aspergillus fumigatus strain is Aspergillus fumigatus FGSC A1151.

4. The genetically engineered strain producing high yields of the secondary metabolite Fumagillin according to claim 1, characterized in that, The genetically engineered strain is a hosA gene-deficient strain, constructed using homologous recombination technology, by replacing the hosA gene coding region with an resistance selection marker or by mutating the hosA catalytic active site.

5. A method for constructing a genetically engineered strain that produces a high yield of the secondary metabolite Fumagillin, characterized in that, Includes the following steps: 1) Design a knockout vector containing the upstream and downstream homologous arms of hosA or design and construct a recombinant replacement vector containing the hosA ORF segment with a mutation of the hosA catalytic active site, and use the hygromycin resistance gene (hph) as a selection marker. 2) Transform the linearized hosA knockout fragment or the hosA active site mutation replacement fragment into Aspergillus fumigatus protoplasts, and obtain positive transformants through PEG-mediated transformation; construct the HosA knockout strain ΔhosA or the catalytic active site mutant strain, which is a genetically engineered strain that produces the high-yield secondary metabolite Fumagillin.

6. The use of a genetically engineered strain of Fumagillin, which produces high yields of the secondary metabolite as described in claim 1, in the production of high-yield Fumagillin.

7. The application according to claim 6, characterized in that, The genetically engineered strain was fermented at 30-40℃ to induce the accumulation of the secondary metabolite Fumagillin.

8. The application according to claim 7, characterized in that, The fermentation culture is a liquid shake flask fermentation.

9. The use of the hosA gene as described in claim 1 in regulating the production of the secondary metabolite Fumagillin by Aspergillus fumigatus.

10. The application according to claim 9, characterized in that, The production of the secondary metabolite Fumagillin by Aspergillus fumigatus can be enhanced by knocking out the hosA gene or by mutating the hosA catalytic active site.