Oryza oryzae OrLRR1 gene and application thereof in improving rice blast resistance of rice

By overexpressing the OrLRR1 gene in rice, the problem of insufficient rice blast resistance gene resources in rice varieties has been solved, significantly improving the resistance of rice to rice blast, providing a new breeding method and simplifying the operation process.

CN121975856APending Publication Date: 2026-05-05SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610437102.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-03
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

The existing rice varieties have limited resources of rice blast resistance genes. The resistance of a single R gene is easily overcome, resulting in low breeding selection efficiency. Furthermore, the superposition of multiple genes causes growth inhibition, making it difficult to cultivate highly efficient and broad-spectrum disease-resistant varieties.

Method used

By utilizing the OrLRR1 gene of common wild rice, the resistance of rice to rice blast can be improved by introducing a recombinant vector into rice to overexpress the OrLRR1 gene. The specific method involves introducing a recombinant vector into rice varieties Nipponbare or Zhonghua 11, inserting the OrLRR1 nucleotide sequence, and then performing gene editing using CRISPR/Cas9 technology.

Benefits of technology

It significantly improves rice resistance to rice blast, provides new genetic resources for breeding high-efficiency, broad-spectrum disease-resistant varieties, is easy to operate, and has important application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121975856A_ABST
    Figure CN121975856A_ABST
Patent Text Reader

Abstract

The invention discloses a common wild rice OrLRR1 gene and application thereof in improving rice blast resistance of rice, and belongs to the technical field of genetic engineering and phytopathology. The nucleotide sequence of the oryza vulgaris OrLRR1 gene is as shown in SEQ ID NO: 1. It is found that the OrLRR1 gene plays an important role in rice blast resistance of rice. The deletion of the OrLRR1 gene reduces the resistance of the rice to the magnaporthe oryzae, and the over-expression of the OrLRR1 gene can improve the resistance of the rice to the magnaporthe oryzae. The invention provides an application of an OrLRR1 gene or an encoding protein thereof in improving the resistance of rice to rice blast, and a method for cultivating rice blast-resistant rice by regulating and controlling the expression of OrLRR1. The invention provides a new gene resource and a theoretical basis for cultivating a new rice variety with high rice blast resistance, and has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and plant pathology, specifically relating to the OrLRR1 gene of common wild rice and its application in improving rice resistance to rice blast. Background Technology

[0002] Rice blast is a fungal disease caused by *Magnaporthe oryzae*, which chronically damages rice growth and occurs annually in both northern and southern rice-growing regions of my country. As a major disease in rice production, rice blast is characterized by its high prevalence, large affected area, and severe damage, occurring throughout the entire rice growth cycle and potentially causing yield losses of 10% to 35%. Compared to chemical control methods, identifying and utilizing blast-resistant genes from rice germplasm resources is the most economical and environmentally friendly strategy for controlling rice blast.

[0003] Currently, many R genes or loci for rice blast resistance have been identified in cultivated rice, but few possess durable, broad-spectrum resistance. Vertical resistance from a single R gene is insufficient to address physiological race diversity; over 60% of existing major varieties contain only 1-2 resistance loci, and the genetic linkage between disease resistance and agronomic traits leads to low breeding selection efficiency. Although gene aggregation technology can delay resistance breakthroughs, the growth inhibition effect caused by multiple gene stacking limits practical application. Common wild rice (Oryzarufipogon Griff.) is the ancestral species of rice, containing a large number of superior genes lost during rice domestication, especially at gene loci related to resistance to biotic and abiotic stresses. Discovering and utilizing new disease-resistant QTLs or genes from abundant wild rice germplasm resources to expand the genetic resources for disease resistance breeding in cultivated rice, and cultivating efficient, broad-spectrum, and environmentally friendly disease-resistant varieties, is a crucial approach to breaking through the bottleneck in rice disease resistance breeding. Summary of the Invention

[0004] The purpose of this invention is to provide a novel application of the OrLRR1 gene in common wild rice in regulating rice resistance to rice blast, providing a theoretical basis and technical support for breeding new rice varieties with high resistance to rice blast. Research has found that the OrLRR1 gene in common wild rice plays a crucial role in rice resistance to rice blast. Deletion of the OrLRR1 gene reduces the basic defense capacity of rice against rice blast fungus, while overexpression of the OrLRR1 gene can enhance the resistance of rice to rice blast fungus.

[0005] To achieve the above-mentioned objectives, the present invention is implemented through the following technical solution: This invention provides the application of the OrLRR1 gene from common wild rice in improving rice resistance to rice blast, and the nucleotide sequence of the OrLRR1 gene is shown in SEQ ID NO: 1.

[0006] The present invention also provides a breeding method for improving the resistance of rice to rice blast, including increasing the expression level of the OrLRR1 gene in rice.

[0007] Furthermore, the increase in the expression level of the OrLRR1 gene in rice is achieved by introducing a recombinant vector into rice.

[0008] Furthermore, the recombinant vector is obtained by inserting the nucleotide sequence shown in SEQ ID NO: 1 between the restriction endonuclease KpnI recognition sites of the WMV023 vector.

[0009] Furthermore, the rice variety is either Nipponbare or Nakahana 11. Beneficial effects

[0010] This invention, through systematic research, has discovered that the OrLRR1 gene in common wild rice plays a key positive regulatory role in rice blast defense, and knocking out the OrLRR1 gene significantly reduces rice's resistance to rice blast fungus. This invention, by overexpressing the OrLRR1 gene in rice, significantly improves rice's resistance to rice blast, providing a new gene resource for breeding new rice varieties resistant to rice blast; moreover, the method is simple and can be directly applied in rice breeding, possessing significant application value. Attached Figure Description

[0011] Figure 1 Phenotypic diagram of plants after inoculation with rice blast fungus; Note: From left to right: Nipponbare, OrLLR1-OE, NIL.

[0012] Figure 2 Image showing leaf lesions in rice inoculated with rice blast fungus; Note: From left to right: Nipponbare, NIL, NIL-lrr1-KO1, NIL-lrr1-KO2.

[0013] Figure 3 This is a graph showing the length of fungal plaques after inoculation with rice blast fungus; Note: From left to right, they are Nipponbare, NIL, OrLLR1-OE, Nipponbare, NIL-lrr1-KO1, and NIL-lrr1-KO2. Detailed Implementation

[0014] To enable those skilled in the art to better understand the technical solutions of this invention, the present application will be further described in detail below with reference to embodiments.

[0015] Example 1: Obtaining OrLRR1 gene overexpression lines The WMV023 vector (from Weimi Biotechnology Co., Ltd.) was linearized using the restriction endonuclease KpnI. The nucleotide sequence of the OrLRR1 gene (SEQ ID NO: 1) was amplified from the genome of wild rice AC50036 using primers SEQ ID NO: 2 (CTTGAGAGAGAAGTGTGCCA) and SEQ ID NO: 3 (TGGGAGATCGCCGGAATTAA), and then ligated into the linearized WMV023 vector using homologous recombination to obtain an OrLRR1 gene overexpression vector. The constructed plasmid was transformed into *E. coli* using heat stimulation, and positive clones were selected for detection. The correctly sequenced plasmid was transferred to Weimi Biotechnology Co., Ltd., transformed into *Agrobacterium*, and then introduced into callus tissue of the rice variety Zhonghua 11. The positive detection of T0 generation transformed seedlings was performed using upstream primer SEQ ID NO:4 (GCAGAGCAGTTGATCCCTG) and downstream primer SEQ ID NO:5 (TGCACGTCAGAGATGATCGA), and the rice OrLRR1 gene overexpression line (OrLLR1-OE) was obtained.

[0016] Example 2: Construction of OrLRR1 near-isogenic lines Common wild rice AC50036 was crossed with cultivated rice Nipponbare, and then backcrossed with Nipponbare. Using a molecular marker closely linked to the OrLRR1 gene (LOC_Os01g67314) of common wild rice, four generations of backcrossing and five generations of self-pollination were carried out in the BC4F5 population to obtain near-isogenic lines (NILs) that carry only the wild rice OrLRR1 gene and have all other genetic backgrounds of Nipponbare.

[0017] Example 3: Construction of osllr1 knockout mutant in near-isogenic OrLRR1 line The nucleotide sequence of the OrLRR1 gene in common wild rice is shown in SEQ ID NO: 1. We used CRISPR / Cas9 technology to perform targeted knockout of the OrLRR1 gene in the NIL obtained in Example 2, thereby obtaining the NIL-lrr1 mutant.

[0018] Knockout targets were designed using the CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Two targets with high target scores, low off-target efficiency, and located in the first exon were selected. The nucleotide sequence of the first target is SEQ ID NO: 6 (5'-CTAGGCAACTAGTAGTACTAATCCTGA-3'), and the nucleotide sequence of the second target is SEQ ID NO: 7 (5'-GAAGAAGGCAGCAGCGCCGGC-3').

[0019] The constructed knockout vector was transformed into the NIL obtained in Example 2 using Agrobacterium genetic transformation. The obtained gene-edited rice orlrr1 genomic DNA was amplified by PCR using a primer set consisting of SEQ ID NO: 8 (CTTGAGAGAGAAGTGTGCCA) and SEQ ID NO: 9 (TGGGAGATCGCCGGAATTAA), and the PCR product was sequenced to obtain knockout lines (NIL-lrr1-KO1, NIL-lrr1-KO2).

[0020] Example 4: Effects of the OrLRR1 gene on rice blast resistance To verify the involvement of the OrLRR1 gene in the defense response of rice against rice blast, we examined the resistance of near-isogenic lines (NIL) under the OrLRR1 Nipponbare background, knockout lines (NIL-lrr1-KO1, NIL-lrr1-KO2) under the NIL background, and lines overexpressing the OrLRR1 gene to rice blast races. The specific procedures are as follows: Strain culture and spore suspension preparation: Rice blast fungus strains FJ07-6 and FJ07-8 were activated on oat medium. They were cultured in the dark for 3 days and then in the light for 4 days at 25℃. Sterile ddH2O was added to the culture dish, and the mycelia were gently scraped off with an inoculation loop to elute the rice blast fungus spores from the medium. The eluent was filtered through a filter cloth to obtain a spore suspension. The spore suspension was placed in a 2mL centrifuge tube and centrifuged at 12000rpm for 2min. The supernatant was discarded, and sterile ddH2O was added to adjust the spore concentration to no less than 10⁵ spores / mL. Tween-20 was added to the spore suspension to a final concentration of 0.01%, which was used for rice blast fungus inoculation.

[0021] Spray inoculation: Homozygous knockout lines NIL-KO1 and KO2 (Nipponbare, NIL, T2 generation) and lines overexpressing the OrLRR1 gene were cultured in rice nutrient solution for 14 days. The pre-cultured and prepared conidial suspension was evenly sprayed onto the leaves of rice seedlings. After inoculation, the seedlings were placed at a constant temperature of 25℃ in the dark for 24 hours, with a relative humidity maintained at 90%. Subsequently, an alternating light / dark cycle of 12 hours was implemented. Leaf disease was observed 5 days after inoculation. Each experiment was repeated three times.

[0022] In vitro inoculation: Homozygous knockout lines NIL-KO1 and KO2 (Nipponbare, NIL, T2 generation) and lines overexpressing the OrLRR1 gene were cultured in rice nutrient solution until the four-leaf stage. Six-cm leaf segments were cut from the same part of the seedlings, and three epidermal wounds were created on each leaf by gently pricking the leaves with a 10μl pipette tip, pricking every 2.0cm. The leaves were then placed in a Petri dish, allowing them to float on the surface of a 10μg / ml 6-benzylaminopurine aqueous solution at pH 7.0. Five μl of the prepared conidial suspension was pipetted onto the pricking sites on the leaves. After inoculation, the Petri dish was covered and placed in a 25℃ constant temperature and light incubator. After 24 hours of dark incubation, the dish was incubated for 5 days in an alternating 12-hour light / 12-hour dark mode, and then the disease incidence was observed. Each experiment was repeated three times.

[0023] Mycelial biomass determination: Total DNA was extracted from rice lesions using the CTAB method. The rice gene OsUbiquitin (LOC_Os03g13170) was used as an internal reference gene to detect the amount of the Mopot2 gene (MGG_13294) of the rice blast fungus. Fungal biomass was analyzed by real-time quantitative PCR. The relative expression level of the gene was calculated using the 2-ΔΔCT method. The primer sequences were SEQ ID NO: 10 (qOsUBQ-F: 5'-AAGAAGCTGAAGCATCCAGC-3'), SEQ ID NO: 11 (qOsUBQ-R: 5'-CCAGGACAAGATGATCTGCC-3'), SEQ ID NO: 12 (Mopot2-F: 5'-ACGACCCGTCTTTACTTATTTGG-3'), and SEQ ID NO: 13 (Mopot2-R: 5'-AAGTAGCGTTGGTTTTGTTGGAT-3').

[0024] Inoculation results showed that, compared with the wild type, the lines overexpressing the OrLRR1 gene had significantly fewer lesions and NILs. Figure 1 And the plaque length is significantly smaller than that of the wild type ( Figure 3 NIL lesion area is significantly smaller than wild type ( Figure 2 ), showing significant resistance to rice blast; the area of ​​bacterial plaque in the knockout lines was significantly larger than that in NIL ( Figure 2 Furthermore, the plaque length was significantly greater than that of strains overexpressing the OrLRR1 gene and NIL ( Figure 3 The resistance to rice blast was significantly weakened. This indicates that OrLRR1 is essential for rice resistance to rice blast.

Claims

1. The application of the OrLRR1 gene from common wild rice in improving rice resistance to rice blast, characterized in that, The nucleotide sequence of the OrLRR1 gene is shown in SEQ ID NO:

1.

2. A breeding method for improving the resistance of rice to rice blast, characterized in that, This includes increasing the expression level of the OrLRR1 gene as described in claim 1 in rice.

3. The method according to claim 2, characterized in that, The expression level of the OrLRR1 gene in rice is increased by introducing a recombinant vector into rice.

4. The method according to claim 3, characterized in that, The recombinant vector was obtained by inserting the nucleotide sequence shown in SEQ ID NO: 1 between the restriction endonuclease KpnI recognition sites of the WMV023 vector.

5. The method according to claim 2, characterized in that, The rice variety mentioned is either Nipponbare or Zhonghua 11.

Citation Information

Patent Citations

  • New rice NBS-LRR coding gene Piyn and application thereof in rice blast resistance breeding

    CN117511957A

  • Application and method of rice gene OsLRR6 in improving bacterial leaf blight and rice blast resistance of rice

    CN118620948A

  • Rice OsLRG1 gene and application thereof in rice blast resistance

    CN119752941A

  • Application of rice OsHsfA1 gene in regulation and control of resistance of rice to magnaporthe oryzae

    CN120060330A