Potato StCYP481 gene, promoter as well as vector, recombinant bacterium and application of potato StCYP481 gene and promoter

By providing the potato StCYP481 gene and its promoter proStCYP481, a recombinant vector and recombinant bacteria were constructed, enabling the recognition and enhanced resistance of potatoes to salt stress. This solved the problems of plant growth inhibition and yield reduction under salt stress, and improved the salt tolerance of plants.

CN121991981APending Publication Date: 2026-05-08ANHUI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610213609.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-13
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Potato cultivation faces challenges such as growth inhibition and yield reduction due to soil salinization, and current technologies lack effective methods for screening and breeding genes to resist salt stress.

Method used

We provided the potato StCYP481 gene and its promoter proStCYP481, and overexpressed this gene in plants by constructing recombinant vectors and recombinant bacteria, thereby improving the plants' recognition and resistance to salt stress.

Benefits of technology

It significantly improves the salt stress recognition ability of plants and enhances their salt tolerance by increasing Fv/Fm value, proline and soluble sugar content, and reducing ion leakage rate and reactive oxygen species accumulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121991981A_ABST
    Figure CN121991981A_ABST
Patent Text Reader

Abstract

The invention discloses a potato StCYP481 gene, a promoter as well as a vector, recombinant bacteria and application thereof, and relates to the technical field of plant genetic engineering. The promoter and the nucleotide sequence of the promoter are as shown in SEQ ID NO. 1 and SEQ ID NO. 2. The invention also provides a plant expression recombinant vector. The plant expression recombinant vector comprises an StCYP481 promoter and proStCYP481-GUS and 35S: StCYP481-GFP plasmid, wherein the proStCYP481-GUS and the 35S: StCYP481-GFP plasmid are constructed by a gene sequence; the invention relates to a genetically engineered host cell. The host cell comprises a gene StCYP481, the invention also discloses an application of the gene StCYP481 in cultivation of salt stress resistant transgenic plants. The StCYP481 can effectively enhance the salt tolerance of transgenic plants by maintaining the photosynthesis capability, promoting the biosynthesis of osmotic regulation substances and reducing the accumulation of active oxygen, thereby laying a theoretical foundation for subsequently improving the salt stress resistance of potatoes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and more particularly to a potato. StCYP481 Genes, promoters and their vectors, recombinant bacteria and their applications. Background Technology

[0002] potato( Solanum tuberosum Potatoes are an annual herbaceous plant whose tubers are edible. Rich in carbohydrates, dietary fiber, and various micronutrients, potatoes are widely cultivated globally, becoming the fourth largest food crop after rice, corn, and wheat. However, as a staple crop susceptible to abiotic stresses, potato cultivation faces increasingly severe threats from climate change, often resulting in significant yield reductions and quality declines under adverse environmental conditions. Soil salinization, as a major abiotic stress, severely inhibits plant growth and development, leading to substantial crop losses. Salt stress significantly inhibits potato growth and reduces yield, thus threatening agricultural production and global food security. Therefore, screening for potato salt stress resistance genes has become a key research direction for its breeding improvement. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to provide a potato StCYP481 Genes, promoters and their vectors, recombinant bacteria and their applications.

[0004] The present invention solves the above-mentioned technical problems through the following technical means:

[0005] The first aspect of this invention provides a potato salt stress resistance gene. StCYP481 and its promoter proStCYP481 The proStCYP481 The nucleotide sequence is shown in Seq ID NO.1. StCYP481 The CDS sequence is shown in Seq ID NO.2.

[0006] This invention is the first discovery of a potato gene. StCYP481 and its promoter proStCYP481 And its application in the breeding and selection of transgenic plants tolerant to salt stress.

[0007] The potato promoter proStCYP481Cloning steps: (1) Extract potato genomic DNA; (2) Design specific amplification primers proStCYP481-F and proStCYP481-R; (3) Perform PCR amplification using potato genomic DNA as a template to obtain the promoter proStCYP481 sequence; wherein, the specific amplification primers proStCYP481-F and proStCYP481-R sequences are shown as Seq ID NO.3 and Seq ID NO.4, respectively.

[0008] The potato gene StCYP481 Cloning steps: (1) Extract total RNA from potatoes and reverse transcribe it into cDNA; (2) Design specific amplification primers StCYP481-F and StCYP481-R; (3) Perform PCR amplification using cDNA as a template to obtain the target gene. StCYP481 The specific amplification primers StCYP481-F and StCYP481-R sequences are shown in Seq ID NO.5 and Seq ID NO.6, respectively.

[0009] The second aspect of the present invention provides the above-described promoter. proStCYP481 Applications in identifying soil salt stress and cultivating transgenic plants resistant to salt stress.

[0010] The application is overexpression in plants. proStCYP481 It can enhance the plant's ability to recognize soil salt stress.

[0011] The specific steps for this application are as follows: (1) Cloning the potato promoter proStCYP481 ; (2) Constructing the potato promoter proStCYP481 Overexpression vector; (3) Potato promoter proStCYP481 Transgenic plants were transformed with overexpression vectors and identified as transgenic plants with enhanced ability to recognize soil salt stress.

[0012] A third aspect of the present invention provides a recombinant vector 1, the recombinant vector 1 comprising the above-described promoter. proStCYP481 .

[0013] The recombinant vector 1 is pBI121-proStCYP481::GUS.

[0014] The method for constructing the recombinant vector 1 is as follows: The promoter is generated using homologous recombination. proStCYP481 The sequence was inserted into the restriction site of the vector pBI121.

[0015] The enzyme cleavage site is Hind III and Bam HI.

[0016] A fourth aspect of the present invention provides a recombinant bacterium 1, wherein the recombinant bacterium comprises the above-mentioned recombinant vector pBI121-proStCYP481::GUS.

[0017] The recombinant bacteria are constructed as follows: the above-mentioned potato salt stress response promoter is used... proStCYP481 The constructed recombinant vector pBI121-proStCYP481::GUS was introduced into bacterial cells.

[0018] The bacteria in question are Agrobacterium.

[0019] The fifth aspect of the present invention provides the above-mentioned gene. StCYP481 Applications in improving plant salt tolerance.

[0020] The application is overexpression in plants. StCYP481 Genes can enhance a plant's resistance to salt stress.

[0021] The specific steps for this application are as follows: (1) Cloning potato genes StCYP481 ; (2) Constructing potato genes StCYP481 Overexpression vector; (3) Potato genes StCYP481 Transgenic plants with enhanced salt stress resistance were obtained by overexpression vector transformation.

[0022] A sixth aspect of the present invention provides a recombinant vector 2, the recombinant vector 2 comprising the above-mentioned gene. StCYP481 .

[0023] The recombinant vector 2 is 35S::StCYP481-GFP.

[0024] The method for constructing the recombinant vector 2 is as follows: using homologous recombination... StCYP481 The gene sequence was inserted into the restriction site of the vector pRI101.

[0025] The enzyme cleavage site is Sal I and Bam HI.

[0026] A seventh aspect of the present invention provides a recombinant bacterium 2, the recombinant bacterium 2 comprising the above-mentioned recombinant vector 35S::StCYP481-GFP.

[0027] The construction method of the recombinant bacteria 2 is as follows: The above-mentioned potato salt stress resistance gene... StCYP481 The constructed recombinant vector 35S::StCYP481-GFP was introduced into bacterial cells.

[0028] The bacteria in question are Agrobacterium.

[0029] The beneficial effects of this invention are as follows: 1. This invention provides a potato salt stress response promoter. proStCYP481 This promoter can respond significantly to salt stress treatment and has the potential to be applied in identifying soil salt stress and cultivating salt stress-resistant transgenic plants.

[0030] 2. This invention provides a potato salt stress resistance gene. StCYP481 Overexpression in Arabidopsis StCYP481 It can significantly increase the plant's Fv / Fm, proline and soluble sugar content, reduce ion leakage rate, and decrease reactive oxygen species (H2O2 and O2). - Accumulation of these substances enhances the plant's salt tolerance.

[0031] Of course, implementing any product or method of the present invention does not necessarily require achieving all of the advantages described above at the same time. Attached Figure Description

[0032] Figure 1 In Embodiment 2 of the present invention StCYP481 Analysis of gene expression levels under NaCl treatment; Figure 2 Analysis of the transient conversion salt stress response of tobacco in the proStCYP481::GUS recombinant vector in Example 1 of this invention; Figure 3 This is a graph showing the salt stress response analysis of the proStCYP481::GUS transgenic Arabidopsis thaliana in Example 1 of this invention. Figure 4 The image shows the semi-quantitative (A) and quantitative PCR (B) detection results of wild-type plants and transgenic plants in Example 2 of this invention (WT and CK are wild-type control plants, and OE1~6 are transgenic plants obtained through screening). Figure 5 The figures for wild-type and overexpressing transgenic Arabidopsis thaliana in Example 2 of this invention are the seed germination rate and taproot length under different concentrations of NaCl treatment (WT is the wild-type control, and OE2 / 3 / 5 are transgenic plants); where A is the germination rate phenotype after 7 days of treatment, B is the germination rate statistics after 1-7 days of treatment, C is the root length phenotype after 7 days of treatment, and D is the root length statistics after 7 days of treatment.

[0033] Figure 6 Phenotypes (A) and chlorophyll fluorescence diagrams (B) of wild-type and overexpressing transgenic Arabidopsis thaliana after salt treatment in Example 2 of this invention; Figure 7Examples 2 of this invention show the Fv / Fm values ​​(A), ion leakage rate (B), soluble sugar (C), and proline (D) of wild-type and overexpressing transgenic Arabidopsis thaliana after salt treatment; WT represents the wild-type control, and OE2 / 3 / 5 represents transgenic plants. The analysis includes relevant indicators after normal growth and treatment with 200 mM NaCl for 5 days. p<0.01; Figure 8 The images show DAB and NBT staining patterns of wild-type and overexpressing transgenic Arabidopsis thaliana after salt treatment in Example 2 of this invention. Detailed Implementation

[0034] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical terms used below have the same meaning as understood by those skilled in the art.

[0035] Unless otherwise specified, the test materials and reagents used in the following examples are commercially available or prepared by known methods.

[0036] Unless otherwise specified, all techniques or conditions described in the embodiments can be performed in accordance with the techniques or conditions described in the literature in this field or in the product manual. Unless otherwise specified, the quantitative experiments in the following embodiments are all repeated three times or more, and the results are averaged.

[0037] Example 1: 1. Promoter proStCYP481 Clones: (1) Potato DM material test-tube seedlings were grown in a light incubator. After 4-5 weeks of growth, leaf samples were taken and immediately placed in liquid nitrogen and stored at -80℃.

[0038] (2) Genomic DNA was extracted from the leaves using the Tiangen plant genomic DNA extraction kit; (3) proStCYP481 The sequence is shown as Seq ID NO.1, according to proStCYP481 Sequences were used to design specific amplification primers proStCYP481-F and proStCYP481-R. The specific sequences are shown in Seq ID NO.3 and Seq ID NO.4. (4) Using genomic DNA as a template, PCR amplification was performed using high-protection enzymes; the amplification system was: DNA 1 μL, GXL DNA Polymerase 0.2 μL, specific primers (proStCYP481-F and proStCYP481-R) 0.4 μL each, dNTP Mix 1.6 μL, 5×Buffer 4 μL, ddH2O 12.4 μL; the amplification program was: 98℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 68℃ extension for 80 s, for 38 cycles.

[0039] (5) Perform agarose gel electrophoresis on the PCR amplification products, and use a gel extraction kit to extract the target fragment to obtain the promoter. proStCYP481 .

[0040] (6) The target fragment was constructed into the pMD19 vector, transformed into E. coli, and the target gene sequence was obtained after sequencing by the company.

[0041] 3. Construction of the recombinant vector proStCYP481::GUS: (1) Design adapter primers based on the pBI121 vector sequence and restriction sites. The specific sequences are shown in Seq ID NO.7 and Seq ID NO.8. Use high-protection enzyme to amplify the target fragment with adapters. The amplification system and procedure are the same as the cloning steps.

[0042] (2) Using restriction endonucleases Hind III and Bam The pBI121 vector was double-digested with HI to obtain a linearized vector; (3) The target fragment with adapter and the linearized vector fragment were recovered using a gel recovery kit, and the target fragment was ligated to the pBI121 vector using a homologous recombination kit (purchased from Hanheng Biotechnology Co., Ltd.); Ligation system: 0.8 μL gel recovery product, 1.2 μL linearized vector, 5 μL HB-infusion Master Mix (2x), and ddH2O to 10 μL; Reaction program: 50℃ for 20 min, and stored at 4℃.

[0043] 4. Construction of recombinant strain 1: (1) Remove the competent states from the -80℃ freezer and place them on ice to thaw; (2) Pipette 10 μL of the ligation product into the competent cells and gently mix. (3) Ice bath for 25 min, then heat shock at 42℃ for 45 s, then ice bath for 3 min; (4) Add 250 µL of antibiotic-free LB medium to the clean bench, mix well and incubate at 37°C in a shaker for 1 h; (5) Take 100 µL of reaction solution and spread it on a solid culture medium containing kanamycin. Invert the plate and incubate overnight at 37°C.

[0044] 5. Transient overexpression of proStCYP481::GUS in tobacco: (1) The recombinant bacteria were extracted using a plasmid extraction kit and transformed into Agrobacterium GV3101; (2) Transient overexpression of tobacco was achieved using leaf injection; (3) After water (0 mM, control) and salt stress treatment, GUS staining was performed on the leaves (WT was the wild-type control plant, 35S::GUS was the unloaded leaf, and proStCYP481::GUS was the leaf injected with the promoter recombination vector). Figure 2 As shown, tobacco leaves injected with proStCYP481::GUS showed enhanced GUS signal after salt stress treatment, preliminarily proving... proStCYP481 It exhibits salt stress responsiveness.

[0045] 6. Overexpression proStCYP481 Obtaining Arabidopsis thaliana strains: (1) The recombinant bacteria were extracted using a plasmid extraction kit and transformed into Agrobacterium GV3101; (2) Arabidopsis thaliana was infected by the flower-dipping method, and T0 generation seeds were harvested; (3) Using MS medium containing kanamycin to treat T1 and T2 generations proStCYP481 Screening and identification of transgenic plants; (4) The obtained T3 generation homozygotes proStCYP481 Transgenic lines were subjected to salt stress treatment. Figure 3 GUS staining results of transgenic plants at different time points under salt stress treatment. Figure 3 It can be seen that: overexpression proStCYP481 The transgenic Arabidopsis lines showed a significant deepening of GUS color after salt stress treatment, further demonstrating the promoter... proStCYP481 It can respond to soil salt stress.

[0046] In summary, the present invention provides proStCYP481 The promoter can respond significantly to salt stress treatment and has the ability to identify soil Application prospects in soil salt stress and the cultivation of transgenic plants resistant to salt stress.

[0047] Example 2: 1. StCYP481 Gene expression analysis under NaCl treatment: (1) Potato DM material test tube seedlings were treated with 200 mM NaCl, and leaf samples were taken at 0, 3, 6, 12 and 24 h respectively. The samples were immediately placed in liquid nitrogen and stored at -80℃. (2) The corresponding kits were used for both leaf RNA extraction and cDNA synthesis; (3) Detection at different time points by quantitative PCR StCYP481 Gene expression levels. For example... Figure 1 As shown, salt stress treatment can significantly induce StCYP481 Gene expression.

[0048] 2. Steps for cloning the StCYP481 gene: (1) Potato DM material test-tube seedlings were grown in a light incubator. After 4-5 weeks of growth, leaf samples were taken and immediately placed in liquid nitrogen and stored at -80℃.

[0049] (2) The corresponding kits were used for both leaf RNA extraction and cDNA synthesis; (3) StCYP481 The gene CDS sequence is shown in Seq ID NO.2. Based on the target gene CDS sequence, specific amplification primers StCYP481-F and StCYP481-R were designed, and their specific sequences are shown in Seq ID NO.5 and Seq ID NO.6. (4) Using cDNA as a template, PCR amplification was performed using a high-protection enzyme; the amplification system was: 1 μL cDNA, 0.2 μL GXL DNAPolymerase, 0.4 μL each of specific primers (StCYP481-F and StCYP481-R), 1.6 μL dNTP Mix, 4 μL 5×Buffer, and 12.4 μL ddH2O; the amplification program was: 98℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 68℃ extension for 80 s, and 38 cycles.

[0050] (5) Perform agarose gel electrophoresis on the PCR amplification products, and use a gel extraction kit to extract the target fragment to obtain the target gene. StCYP481 CDS fragments.

[0051] (6) The target fragment was constructed into the pMD19 vector, transformed into E. coli, and the target gene sequence was obtained after sequencing by the company.

[0052] 3. Construction of the recombinant vector 35S::StCYP481-GFP: (1) Design adapter primers based on the pRI101 vector sequence and restriction sites. The specific sequences are shown in Seq ID NO.9 and Seq ID NO.10. Use high-protection enzyme to amplify the target fragment with adapters. The amplification system and procedure are the same as the cloning steps.

[0053] (2) Using restriction endonucleases Sal I and Bam The pRI101 vector was double-digested with HI to obtain a linearized vector. (3) The target fragment with adapter and the linearized vector fragment were recovered using a gel recovery kit, and the target fragment was ligated to the pRI101 vector using a homologous recombination kit (purchased from Hanheng Biotechnology Co., Ltd.); Ligation system: 0.8 μL gel recovery product, 1.2 μL linearized vector, 5 μL HB-infusion Master Mix (2x), and ddH2O to 10 μL; Reaction program: 50℃ for 20 min, and stored at 4℃.

[0054] 4. Construction of recombinant bacteria 2: (1) Remove the competent states from the -80℃ freezer and place them on ice to thaw; (2) Pipette 10 μL of the ligation product into the competent cells and gently mix. (3) Ice bath for 25 min, then heat shock at 42℃ for 45 s, then ice bath for 3 min; (4) Add 250 µL of antibiotic-free LB medium to the clean bench, mix well and incubate at 37°C in a shaker for 1 h; (5) Take 100 µL of reaction solution and spread it on a solid culture medium containing kanamycin. Invert the plate and incubate overnight at 37°C.

[0055] 5. Overexpression StCYP481 Obtaining Arabidopsis thaliana strains: (1) The recombinant bacteria 2 obtained was extracted using a plasmid extraction kit and transformed into Agrobacterium GV3101; (2) Arabidopsis thaliana was infected by the flower-dipping method, and T0 generation seeds were harvested; (3) Using MS medium containing kanamycin, semi-quantitative and real-time PCR to... StCYP481 Transgenic Arabidopsis thaliana was identified. Figure 4 The results of semi-quantitative and real-time quantitative PCR detection of wild-type and transgenic plants are shown (WT represents wild-type control plants, and OE1-6 represent overexpressing plants selected from resistance plates). StCYP481 (Transgenic plants). Figure 4 It can be seen that in transgenic Arabidopsis thaliana strains overexpressing [the virus], StCYP481The transcriptional level of the gene was significantly higher than that of the wild type (WT), indicating that the genetic transformation of transgenic Arabidopsis thaliana was successful and can be used for subsequent experiments.

[0056] (4) The obtained T3 generation homozygotes StCYP481 The overexpression lines were used for salt stress treatment, phenotypic observation, and physiological index determination. Results: After treatment with different concentrations of salt stress, the germination rate and taproot length of the transgenic plants (OE2 / 3 / 5) were significantly higher than those of the wild-type plants. Figure 5 As shown; when Arabidopsis thaliana overexpression and wild-type plants grown in soil were treated with salt stress (200 mM NaCl), the transgenic plants (OE2 / 3 / 5) showed better growth than the wild-type Arabidopsis thaliana. Figure 6 As shown; after salt stress treatment, the Fv / Fm, proline, and soluble sugar contents in transgenic plants (OE2 / 3 / 5) were significantly higher than those in wild-type plants, while the ion leakage rate was significantly lower than that in wild-type plants, such as Figure 7 As shown; under salt stress, transgenic plants (OE2 / 3 / 5) accumulated less reactive oxygen species (H2O2 and O2) than wild-type plants. - ),like Figure 8 As shown.

[0057] In summary, the present invention provides StCYP481 The gene can significantly improve the salt tolerance of plants, increase the plant's Fv / Fm, proline and soluble sugar content, reduce ion leakage rate, and reduce reactive oxygen species (H2O2 and O2) under stress conditions. - The accumulation of ). The nucleotide sequence shown in Seq ID NO.1 of this invention is specifically as follows: The nucleotide sequence shown in Seq ID NO.2 of this invention is specifically as follows: The nucleotide sequence shown in Seq ID NO.3 of this invention is specifically as follows: GCCAGAGCAGTATCCACAAG The nucleotide sequence shown in Seq ID NO.4 of this invention is specifically as follows: GCCTTATCTTACGCTCACTAGC The nucleotide sequence shown in Seq ID NO.5 of this invention is specifically as follows: ATGGAGATACCATACAATTTTAAAC The nucleotide sequence shown in Seq ID NO.6 of this invention is specifically as follows: CTATAACTTGTACAAAATTAAAGGAGC The nucleotide sequence shown in Seq ID NO.7 of this invention is specifically as follows: GACCATGATTACGCCAAGCTTGCCAGAGCAGTATCCACAAG The nucleotide sequence shown in Seq ID NO.8 of this invention is specifically as follows: GGACTGACCACCCGGGGATCCCGCCTTATCTTACGCTCACTAGC The nucleotide sequence shown in Seq ID NO.9 of this invention is specifically as follows: GTTGATACATATGCCCGTCGACATGGAGATACCATACAATTTTAAAC The nucleotide sequence shown in Seq ID NO.10 of this invention is specifically as follows: CGCCCTTGCTCACCATGGATCCCTATAACTTGTACAAAATTAAAGGAGC The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A potato salt stress resistance gene StCYP481 or promoter proStCYP481 Its characteristics are, The proStCYP481 The nucleotide sequence is shown in Seq ID NO.

1. StCYP481 The CDS sequence is shown in Seq ID NO.

2.

2. The promoter of claim 1 proStCYP481 Its application in identifying soil salt stress and cultivating salt-stress-resistant transgenic plants is characterized by... The application is overexpression in plants. proStCYP481 It can enhance the plant's ability to recognize soil salt stress.

3. A recombinant vector 1, characterized in that, The recombinant vector 1 includes the promoter according to claim 1. proStCYP481 .

4. The recombinant vector 1 according to claim 3, characterized in that, The recombinant vector 1 is pBI121-proStCYP481::GUS; the construction method of the recombinant vector 1 is as follows: the promoter proStCYP481 sequence is inserted into the restriction enzyme site of the vector pBI121 using homologous recombination; the restriction enzyme site is... Hind III and Bam HI.

5. A recombinant bacterium 1, characterized in that, The recombinant bacteria 1 comprises the recombinant vector 1 according to any one of claims 3-4.

6. The recombinant bacteria 1 according to claim 5, characterized in that, The method for constructing the recombinant bacteria 1 is as follows: the recombinant vector 1 according to any one of claims 3-4 is introduced into the bacterial cell; the bacterial cell is Agrobacterium.

7. The gene according to claim 1 StCYP481 Its application in improving plant salt tolerance is characterized by, The application is overexpression in plants. StCYP481 Genes can enhance a plant's resistance to salt stress.

8. A recombinant vector 2, characterized in that, The recombinant vector 2 contains the gene described in claim 1. StCYP481 .

9. The recombinant vector 2 according to claim 8, characterized in that, The recombinant vector 2 is 35S::StCYP481-GFP; the construction method of the recombinant vector 2 is as follows: the StCYP481 gene sequence is inserted into the restriction enzyme site of the vector pRI101 using homologous recombination; the restriction enzyme site is... Sal I and Bam HI.

10. A recombinant bacterium 2, characterized in that, The recombinant bacteria 2 comprises the recombinant vector 2 according to any one of claims 8-9.